Construction method of MAFLD animal model based on GATA4 gene and application of MAFLD animal model in prevention and treatment drugs

Abstract

The invention discloses a GATA4 gene-based MAFLD animal model construction method and application in prevention and treatment drugs, and belongs to the field of mouse model construction, and the GATA4 gene-based MAFLD MASH animal model construction method comprises the following steps: S1, hybridizing a GATA flox transgenic hybrid mouse and a Vil1-Cre transgenic mouse to obtain an F1 generation, and hybridizing the GATA flox transgenic hybrid mouse and a Vil1-Cre transgenic mouse with the genotype of GATA4 flox / +, Vil1-Cre transgenic mouse in the F1 generation to obtain a GATA4 flox / +, Vil1-Cre transgenic mouse to obtain a GATA4 flox / +, Vil1-Cre transgenic mouse; the method comprises the following steps: S1, carrying out selfing on transgenic mice with GATA4 flox / flox and Vil1-Cre to obtain F2-generation mice, and S2, sequentially giving GATA4 intestinal specific knockout mice with genotypes of GATA4 flox / flox and Vil1-Cre in the F2-generation mice with high-fat and high-cholesterol feed (HFD), and inducing to obtain an intestinal GATA4 specific knockout metabolism-related steatohepatitis (MASH) and hepatic fibrosis mouse model. The invention provides a model construction method of MASH and hepatic fibrosis animals in which the intestinal GATA4 gene is specifically knocked out, and application of the intestinal GATA4 serving as a target to preparation of drugs for preventing and treating related diseases such as liver injury and liver diseases caused by the MASH, and the intestinal GATA4 has an important clinical prospect.

Description

Technical Field

[0001] The present invention relates to the field of animal model construction, and more specifically, to an intestinal GATA4 gene-specific knockout MASH and liver fibrosis animal model, a construction method and application thereof, and an application of the GATA4 gene in the development of drugs for preventing and treating MASH and liver fibrosis. Background Art

[0002] Metabolic dysfunction associated fatty liver disease (MAFLD) is the most common liver disease in the world and has become the first among chronic liver diseases in the world. With the rapid increase in the incidence of MAFLD, the global adult MAFLD prevalence is between 20% and 25%, and in the overweight and obese population, this proportion has jumped to 39%. 25% of MAFLD patients will develop metabolic related steatohepatitis (MASH), which increases the risk of cirrhosis, liver failure and hepatocellular carcinoma. MASH is characterized by fatty degeneration, inflammatory damage and fibrosis of hepatocytes, and is an important link in the development of liver fibrosis, cirrhosis and even hepatocellular carcinoma (HCC). Among them, liver fibrosis is the main predictor of mortality and adverse liver events in MASH patients. In addition, there is a close synergistic effect between MAFLD and metabolic syndrome and type 2 diabetes. This interaction further increases the risk of arteriosclerotic cardiovascular and cerebrovascular diseases and various extrahepatic malignancies. In view of this, MAFLD has become one of the important issues to be addressed in the field of global public health.

[0003] The diagnosis of MAFLD and MASH mainly relies on medical history, physical examination, blood tests and imaging examinations. Elevated liver enzyme levels in blood tests indicate liver damage, while imaging examinations (such as ultrasound, CT, MRI) can be used to detect liver fat deposition and fibrosis. In addition, the diagnosis of MASH relies on histological evaluation of liver biopsy (NAS scoring system), which is still the gold standard for diagnosing MASH, but invasive procedures limit its clinical application. Imaging techniques (such as transient elastography FibroScan, MRI-PDFF) can assess liver fat content and hardness, but it is difficult to distinguish simple fatty liver from MASH. In recent years, blood biomarkers (such as CK-18, FGF21) combined with clinical scores (FIB-4, NFS) have significantly improved the efficacy of non-invasive diagnosis.

[0004] However, the first-line treatment still focuses on lifestyle intervention (weight loss ≥ 7%). Due to poor patient compliance, clinical drug treatment is urgently needed for many patients. At present, the development of MASH drugs focuses on multiple pathological links: such as metabolic regulators: such as the thyroid hormone receptor β agonist Resmetirom (approved by the US FDA) improves fatty degeneration by promoting lipid metabolism; anti-inflammatory / anti-fibrosis drugs: such as caspase inhibitors, CCR2 / 5 inhibitors, LOXL2 inhibitors and ASK1 inhibitors; and combination therapy: such as clinical trials of GLP-1 receptor agonists combined with FXR agonists show synergistic effects. In-depth exploration of the pathogenesis of hepatocytes in the occurrence and development of MASH is of great significance for finding more effective intervention targets.

[0005] However, there are still many shortcomings in the field of MASH research and technology, especially in the specific treatment of metabolism-related liver injury, which urgently needs breakthroughs. Summary of the invention

[0006] In view of the problems existing in the prior art, the first purpose of the present invention is to provide a MASH animal model with intestinal GATA4 gene specific knockout, which has more severe pathological damages such as transaminase and liver steatosis and inflammation compared with MASH constructed by traditional high-fat diet (HFD); the second purpose of the present invention is to provide an animal model of liver fibrosis with intestinal GATA4 gene specific knockout, which has more severe liver inflammation and liver fibrosis than the liver fibrosis model constructed by traditional HFD combined with intraperitoneal injection of carbon tetrachloride; the third purpose of the present invention is to provide the use of intestinal GATA4 gene in drugs for the prevention and treatment of MASH or liver fibrosis.

[0007] To solve the above problems, the present invention adopts the following technical solutions.

[0008] A method for constructing a MASH animal model in MAFLD based on the GATA4 gene, the construction method is as follows: S1: GATA flox transgenic heterozygous mice and Vil1-Cre transgenic mice were hybridized to obtain F1 generation, and the transgenic mice of the F1 generation with the genotype of GATA4 flox / +, Vil1-Cre were self-fertilized to obtain F2 generation mice; S2: The F2 generation of mice with the genotype of GATA4 flox / flox and Vil1-Cre GATA4 intestinal-specific knockout mice were sequentially given a high-fat, high-cholesterol diet to induce the GATA4 intestinal-specific knockout MASH model.

[0009] The present invention also provides a method for constructing an animal model of liver fibrosis in MAFLD based on the GATA4 gene, and the construction method is as follows: S1: GATA flox transgenic heterozygous mice and Vil1-Cre transgenic mice were hybridized to obtain F1 generation, and the transgenic mice of the F1 generation with the genotype of GATA4 flox / +, Vil1-Cre were self-fertilized to obtain F2 generation mice; S2: F2 generation mice with GATA4 flox / flox and Vil1-Cre GATA4 intestinal-specific knockout mice were given HFD and intraperitoneally injected with carbon tetrachloride to induce a GATA4 intestinal-specific knockout liver fibrosis mouse model.

[0010] The present invention also provides an application of an animal model obtained by using the method for constructing a MASH animal model in MAFLD, which is used for studying and developing animal experiments on the effects of intestinal GATA4 gene on MASH and for applications in new drug development.

[0011] The present invention also provides an application of an animal model obtained by using the method for constructing an animal model of liver fibrosis in MAFLD, which is used to study and develop the application of intestinal GATA4 gene in animal experiments on the progression of MASH to liver fibrosis and in the development of new drugs.

[0012] The present invention also provides an application of a GATA4 gene as a target in a product for inhibiting the development of MASH into liver fibrosis, and an application of the GATA4 gene as a drug target for inhibiting the development of MASH into liver fibrosis.

[0013] Furthermore, the GATA4 gene is used in the preparation of a drug for preventing or treating MASH or liver fibrosis.

[0014] Furthermore, the GATA4 gene is used in the preparation of a drug for improving liver function decline and liver pathological damage caused by MASH or liver fibrosis.

[0015] Furthermore, the GATA4 gene is used in the preparation of a drug for alleviating abnormal liver function caused by MASH or liver fibrosis.

[0016] Furthermore, the GATA4 gene is used in the preparation of a drug for improving liver inflammation, steatosis and liver fibrosis caused by MASH or liver fibrosis.

[0017] Furthermore, the GATA4 gene is used in the preparation of a drug for improving CCL2 / CCR2 axis abnormalities and intrahepatic inflammatory environment caused by MASH or liver fibrosis.

[0018] Compared with the prior art, the advantages of the present invention are: 1. Compared with the traditional MASH model constructed by HFD, the animal model prepared by the present invention has more severe pathological damages such as transaminase and liver steatosis and inflammation.

[0019] 2. The present invention constructed a mouse model with specific knockout of the intestinal GATA4 gene, and prepared a MASH animal model with specific knockout of the intestinal GATA4 gene by feeding HFD for 14 weeks. After analyzing the animal model, we found that long-term high-fat diet caused significant liver function abnormalities and liver damage, and the knockout of intestinal GATA4 aggravated the liver function abnormalities, liver pathology and inflammation levels caused by the high-fat diet.

[0020] 3. The present invention constructed a mouse model with specific knockout of the intestinal GATA4 gene, and used HFD combined with intraperitoneal injection of carbon tetrachloride for 12 weeks to prepare an animal model of liver fibrosis with specific knockout of the intestinal GATA4 gene. The combined modeling of HFD combined with intraperitoneal injection of CCl4 led to increased inflammation levels and liver fibrosis, and the knockout of intestinal GATA4 further aggravated liver inflammation and liver fibrosis.

[0021] Fourth, the present invention also constructed an adeno-associated virus (OE-GATA4-AAV9) containing the GATA4 coding region sequence, and constructed a mouse model of intestinal GATA4 overexpression by intraperitoneal injection. After the model was successfully constructed, the HFD model was given for 14 weeks to prepare the MASH model. After the last feeding, the mice were fasted for 12 hours and the samples were collected for analysis. The results showed that the overexpression of intestinal GATA4 significantly improved the abnormal transaminase, liver steatosis and inflammatory response caused by a high-fat diet.

[0022] 5. After successfully constructing a mouse model of intestinal GATA4 overexpression by intraperitoneal injection, the present invention used HFD combined with CCl4 intraperitoneal injection to induce liver fibrosis; and conducted sample analysis. The results showed that overexpression of intestinal GATA4 significantly improved the abnormal transaminase, liver steatosis and inflammatory response in mice with liver fibrosis.

[0023] 6. The application of the GATA4 gene as a target in preventive and therapeutic drugs provided by the present invention aims at the current lack of specific treatment for MASH and MASH-related liver fibrosis in clinical practice, and expands the application of intestinal GATA4 gene in the prevention and treatment of MASH and liver fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1The graphs show the changes in liver function index levels in littermate control mice (WT), MASH model mice (HFD), MASH mice with intestinal GATA4 specific knockout (GATA4-CKO+HFD), and MASH mice with intestinal GATA4 overexpression (GATA4-OE+HFD) after being fed a normal diet or a high-fat diet (HFD). Figure 2 HE pathological staining of the liver of littermate control mice (WT), MASH model mice (HFD), MASH mice with intestinal GATA4 knockout (GATA4-CKO+HFD), and MASH mice with intestinal GATA4 overexpression (GATA4-OE+HFD) after being fed a normal diet or a high-fat diet (HFD). Figure 3 Schematic diagram of liver RNA-Seq analysis results of littermate control mice (WT), MASH model mice (HFD), MASH mice with intestinal GATA4 specific knockout (GATA4-CKO+HFD), and MASH mice with intestinal GATA4 overexpression (GATA4-OE+HFD); Figure 4 Schematic diagram of the changes in serum inflammatory cytokine levels in littermate control mice (WT), liver fibrosis model mice (HFD+ CCl4), liver fibrosis mice with intestinal GATA4 specific knockout (GATA4-CKO+HFD+CCl4), and liver fibrosis mice with intestinal GATA4 overexpression (GATA4-OE+HFD+CCl4), as well as the results of RNA-Seq analysis on the expression of genes related to epithelial-mesenchymal transition (EMT) and fibrosis. DETAILED DESCRIPTION

[0025] Embodiment 1:

[0026] 1. Method and principle for constructing a mouse model of intestinal GATA4-specific knockout: The mice used in the present invention are GATAflox and Vil1-Cre transgenic mice. GATA flox mice have LoxP sites flanking the exons of the GATA binding protein 4 (GATA4) gene. GATA4 is a zinc finger transcription factor belonging to the GATA family. Villin-Cre is a transgenic mouse model that uses the Vil1 gene promoter to control the expression of Cre recombinase, and Vil1 is a gene encoding the villin 1 protein. Vil1-Cre mice carry the Cre recombinase expression element driven by the endogenous mouse Vil1 promoter. When hybridized with mice containing LoxP flanking sequences, Cre recombinase-mediated recombination results in the deletion of the sequence between the two unidirectional LoxP sites on the chromosome in the villus and crypt epithelial cells of the small and large intestines of the offspring mice. The expression of the Cre recombinase transgene begins at 12.5 days after fertilization, and some chimeric activity can also be observed in the colon.

[0027] 2. Animal sources: All experimental animals used in the present invention are constructed, raised and bred in the animal center of Saiye (Suzhou) Biotechnology Co., Ltd. The above mice are raised in an SPF-level clean environment with a temperature controlled at 18~22°C, a humidity of 50~70%, and automatic light control (12h light / 12h dark). Mouse cages, feed and bedding are sterilized, and drinking water is sterilized at high temperature and high pressure. The breeding room is disinfected daily to ensure that the breeding environment meets the requirements of the SPF-level animal environment, and the bedding is replaced every 3 days. Animal breeding, maintenance and experimental treatment are carried out in accordance with the guidelines of the Ethics Committee of Zhejiang Chinese Medical University.

[0028] 3. The method for constructing a mouse model of intestinal GATA4 specific knockout of the present invention comprises the following steps: (1) GATA flox transgenic heterozygous mice and Vil1-Cre transgenic mice were hybridized to obtain the F1 generation.

[0029] The identification method and results of F1 generation mice are as follows: (1.1) PCR identification (a) PCR primer information The primer sequences for GATA4 flox genotype identification are as follows: F: TAGAGTACCACAGACCAGAAAGC; R:CACCTAACCTACTCAGACTCTTTTCTTC.

[0030] The primer sequences for Vil1-Cre genotype identification are as follows: F: CATATTGGCAGAACGAAAACGC; R: CCTGTTTCACTATCCAGGTTACGG.

[0031] (b) Amplify the PCR product according to the following reaction system and reaction conditions: The amplification reaction system is 25 μL, including 9 μL ddH2O, 12.5 μL Premix Taq Polymerase, 1.5 μL DNA template and 1 μL each of primers; The reaction conditions were as follows: pre-denaturation at 94 °C for 3 min, denaturation at 94 °C for 30 s, annealing at 62 °C for 35 s, and extension at 72 °C for 35 s, and the three steps of denaturation → annealing → extension were repeated for 35 cycles, and finally DNA final extension was performed at 72 °C for 5 min. After the extension, the PCR product was obtained and kept at 12 °C.

[0032] (1.2) Agarose gel electrophoresis The PCR amplification product obtained in step (1.1) was subjected to 1% agarose gel electrophoresis; and the identification result was obtained by comparing it with the judgment criteria.

[0033] (a) Determination indicators Ⅰ. The GATA4 flox genotype determination index is: there are two genotypes, the one with both about 282 bp band and 242 bp band is the GATA4 flox heterozygous genotype (flox / +), and the one with only about 242 bp band is the wild type; II. The Vil1-Cre genotype determination index is: there are two genotypes, the one with a band of about 413 bp is the Vil1-Cre genotype, and the one without a band is the wild type.

[0034] (b) Identification results There are four genotypes of F1 mice: ①GATA4 flox / +, Vil1-Cre; ②GATA4 flox / +; ③Vil1-Cre and ④ wild-type mice.

[0035] (2) The F1 transgenic mice of step (1) with the genotype of GATA4 flox / +, Vil1-Cre are self-fertilized to obtain F2 mice.

[0036] The identification method and results of F2 generation mice are as follows: (2.1) PCR identification (a) PCR primer information The primer sequences for genotyping GATA4 flox transgenic mice are as follows: F: TAGAGTACCACAGACCAGAAAGC; R:CACCTAACCTACTCAGACTCTTTTCTTC.

[0037] The primer sequences for identifying the genotype of Vil1-Cre transgenic mice are as follows: F: CATATTGGCAGAACGAAAACGC; R: CCTGTTTCACTATCCAGGTTACGG.

[0038] (b) Amplify the PCR product according to the following reaction system and reaction conditions: The amplification reaction system was 25 μL, including 9 μL ddH2O, 12.5 μL Premix Taq Polymerase, 1.5 μL DNA template, and 1 μL each of primers; Reaction conditions: pre-denaturation reaction at 94 °C for 3 min, denaturation reaction at 94 °C for 30 s, annealing reaction at 62 °C for 35 s, extension reaction at 72 °C for 35 s, and repeat the three steps of denaturation → annealing → extension for 35 cycles, and finally react at 72 °C for 5 min for final DNA extension. After the extension, the PCR product was obtained and kept at 12 °C.

[0039] (2.2) Agarose gel electrophoresis The PCR amplification product obtained in step (2.1) was subjected to 1% agarose gel electrophoresis and the identification result was obtained by comparing it with the judgment criteria.

[0040] (a) Criteria: Ⅰ. GATA4 flox genotype determination indicators: There are 3 genotypes. The one with only the approximately 282 bp band is the GATA4 flox homozygous genotype (GATA4 flox / flox); the one with both the approximately 282 bp band and the 242 bp band is the GATA4 flox heterozygous genotype (GATA4 flox / +); the one with only the approximately 242 bp band is the wild type.

[0041] II. Indicators for judging the results of Vil1-Cre gene knockout: The presence of a band of about 413 bp indicates the Vil1-Cre genotype, and the absence of a band indicates the wild type; (b) Identification results: There are 6 genotypes of F2 mice, namely: ①GATA4 flox / flox, Vil1-Cre (GATA4 intestine-specific knockout mice); ②GATA4 flox / flox (flox homozygous); ③GATA4 flox / + (flox heterozygous); ④GATA4 flox / +, Vil1-Cre; ⑤Vil1-Cre and ⑥wild-type mice.

[0042] After identification, the F2 generation GATA4 gene-specific homozygous knockout mice (GATA4 flox / flox, Vil1-Cre) were obtained, which is a mouse model of intestinal GATA4-specific knockout.

[0043] Embodiment 2:

[0044] 1. Experimental animals: The mice used in the present invention were all 8-week-old male C57BL / 6 mice. All experimental animals were kept in the Experimental Animal Center of Zhejiang Chinese Medical University, with room temperature maintained at 18-22°C, humidity maintained at 50-70%, 12 h light / 12 h dark alternating lighting, and free access to water and food. Animal breeding, maintenance and experimental treatment were carried out in accordance with the guidelines of the Ethics Committee of Zhejiang Chinese Medical University.

[0045] 2. Method for constructing GATA4 gene into GPAAV-CMV-MCS-WPRE vector: First, design and synthesize GATA4 primers, amplify the target fragment, and then connect it to the vector after restriction digestion. The ligation product is transferred into the prepared bacterial competent cells, and the grown monoclonal colonies are sent to the sequencing company for sequencing. The correct clone is the successfully constructed vector. Then, the adeno-associated virus vector and its auxiliary packaging element vector plasmid with high purity and no endotoxin are extracted, and the constructed virus vector and its auxiliary packaging element plasmid are co-transfected into AAV Pro-293T cells using HG transgenereagent. After transfection for 6~8h, fresh culture medium is replaced with Enhancing buffer. After continuing to culture for 72h, the cells and supernatant rich in virus particles are collected after the cells fall off, and the high-titer virus concentrate is obtained after concentration and purification. The primer sequences of AAV-GATA4 constructed in this experiment are: 46671FW-60046: CGCGAATTCGAAGTATACCTCGAGGCCACCATGTACCAAAGCCTGGCCATGG; 46671RW-60047: GACTGTGTCTGACTGTGTCGGATCCTTACGCGGTGATTATGTCCCCA.

[0046] 3. As a technology for regulating gene expression at the animal level, intraperitoneal injection has been widely used in liver research and other fields. In order to further explore the function of GATA4 in HFD-induced liver injury, we used intraperitoneal injection of mouse OE-GATA4-AAV9 virus to achieve overexpression of GATA4 in the intestine.

[0047] Preparation of intestinal GATA4 overexpression mouse model by intraperitoneal injection of OE-GATA4-AAV9: Select experimental mice of uniform age and weight (25-30 g) and place them in a 2x10 11 vg virus, diluted according to the injection volume of 0.1 mL saline. Grasp the mouse, expose the abdomen, tilt the animal with the abdomen facing up and the head down, and insert the injection needle into the subcutaneous tissue 3 to 5 mm at the 1 / 3 to 1 / 4 position of the lower abdomen, about 5 mm away from the midline, and then insert the needle into the peritoneum at a 45° angle toward the head. After entering the abdominal cavity, there is no resistance, pull back the needle plug, and inject the virus injection solution if there is no blood, urine or intestinal contents flowing in. In order to prevent leakage, slightly rotate the needle, then slowly pull it out, and disinfect the injection site with an alcohol cotton ball.

[0048] 5. The method for preparing a MASH model using mice with intestinal GATA4 overexpression is as follows: OE-GATA4-AAV9 is injected into C57BL / 6 mice by intraperitoneal injection, and the intestinal GATA4 protein expression is identified after 3 weeks. The increase in intestinal GATA4 protein expression represents the successful construction of an intestinal GATA4 overexpression mouse model. The intestinal GATA4 overexpression MASH model is prepared by feeding the mice with a high-fat diet for 14 weeks.

[0049] VI. Reagents: The HFD used in the present invention was purchased from Nantong Trofi Feed Technology Co., Ltd., the HE dye kit was purchased from Wuhan Sevier Company, and the animal liver tissue RNA-Seq detection was completed by Shanghai Ouyi Biomedical Technology Co., Ltd.

[0050] Ⅰ. Experimental methods: The intestinal GATA4-specific knockout mice, intestinal GATA4-overexpressing mice and littermate control mice obtained in Example 1 with uniform age and weight were selected and divided into the following four groups: (1) WT group: mice from the same littermate as the control group that were given a normal diet; (2) HFD group: littermate control mice given HDF diet; (3) GATA4-CKO+HFD group: intestinal GATA4-specific knockout mice fed a HFD diet; (4) GATA4-OE+HFD group: intestinal GATA4 overexpressing mice fed with HFD diet.

[0051] The mice were fed according to the above grouping for 14 weeks, and after the last feeding, they were fasted but not watered for 12 h. After the fasting, the mice were dissected and various indicators were tested.

[0052] Ⅱ. The detection methods of various indicators of mice are as follows: (1) Determination of biochemical indicators: A biochemical detector was used to detect the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), chemokine ligand 2 (CCL2), interleukin 10 (IL-10) and tumor necrosis factor α (TNF-α) in the serum of the above mice.

[0053] (2) HE staining analysis: (a) The mouse liver tissue obtained after dissection was immersed in 4% neutral formaldehyde solution for fixation overnight, and then the tissue was dehydrated using a fully automatic tissue dehydrator, and paraffin was heated to enable the tissue to be embedded. After complete embedding, the paraffin block was frozen at -20°C and serially sliced ​​using a paraffin slicer; (b) baking the slices obtained in step (a) at 65°C for 15 min, and then performing a conventional dewaxing procedure; (c) The tissue sections subjected to conventional dewaxing procedures in step (b) were immersed in hematoxylin for staining for 3 min, and the nuclear staining was observed under a microscope, followed by rinsing with tap water for 2 min; (d) For the tissue sections washed in step (c), differentiate them with 1% hydrochloric acid alcohol for a few seconds, and then rinse them with tap water for 2 minutes after differentiation. (e) staining the material washed in step (d) with eosin for 3 min, and then rinsing with tap water for 2 min; (f) subjecting the washed material in step (e) to gradient alcohol dehydration treatment, and then using xylene to clear for 3 minutes, and clearing three times in succession; (g) sealing the transparent material in step (f) with a neutral resin and drying the slide in a fume hood; (h) photographing the dried film obtained in step (g) using a common upright optical microscope.

[0054] (3) RNA-seq of liver tissue RNA-Seq is the science of studying the overall expression of all transcripts (mainly mRNA) in cells or tissues at a specific time or under specific conditions. The main goal of RNA-Seq is to reveal the expression patterns and regulatory mechanisms of genes under different conditions, thereby helping us understand the functions of genes under different physiological and pathological states. To further explore the role of intestinal GATA4 in HFD-induced liver damage, we performed RNA-Seq analysis on the livers of each group of mice. The specific analysis steps are as follows: (a) Preparation of tissue samples: Take out the liver stored at -80 °C, remove blood residue and excess fat tissue, and wash the liver tissue sample with pre-cooled HBSS (Hanks balanced salt solution); (b) Total RNA extraction: Place liver tissue samples in an appropriate amount of TRIzol lysis buffer for homogenization; treat the homogenate with chloroform to separate RNA from protein and DNA. Add isopropanol to precipitate RNA and collect it by centrifugation. Wash the RNA precipitate with 75% ethanol and then dry it. Dissolve the dried RNA in RNase-free water. Use NanoDrop 2000 spectrophotometer (ThermoScientific, USA) to identify RNA purity and quantification; (c) RNA quality control and library construction: RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA); transcriptome libraries were constructed using the VAHTS Universal V5 RNA-seq Library Prep Kit according to the instructions; (d) Library quality control and sequencing: The quality and concentration of the library were tested using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) to ensure uniform fragment distribution. The library was then sequenced using the Illumina Novasek 6000 sequencing platform to generate 150 bp paired-end reads. Finally, the fastp software was used to process the raw reads in fastq format, and clean reads were obtained after removing low-quality reads for subsequent data analysis. (e) Data analysis: HISAT2 software was used to compare the reference genome and calculate gene expression, and gene read counts were obtained using HTSeq-count; DESeq2 software was then used to analyze differentially expressed genes, where genes that met the thresholds of q < 0.05 and |Log2(fold change)>1| were defined as differentially expressed genes (DEGs). (Transcriptome sequencing and analysis were performed by Shanghai Ouyi Biotechnology Co., Ltd.) III. Test results: Figure 1 In the figure, parts A and B are graphs showing the changes in serum ALT and AST levels in each group of mice under normal diet and high-fat diet. Figure 2 HE pathological staining images of the liver of each group of mice fed with normal diet or HFD.

[0055] Depend on Figure 1 and Figure 2 It can be seen that compared with the WT group, the levels of ALT and AST in the serum of mice in the HFD group were significantly increased ( Figure 1 A, B) HE staining of the liver showed increased inflammatory cell infiltration and lipid deposition ( Figure 2 In addition, compared with the HFD group, the ALT and AST levels in the serum of the GATA4-CKO+HFD group mice were further significantly increased after HFD treatment ( Figure 1 A, B), inflammatory cell infiltration and lipid deposition in the liver were also significantly aggravated ( Figure 2 However, compared with the HFD group, the ALT and AST levels in the serum of the GATA4-OE+HFD group were significantly decreased, and the inflammatory cell infiltration and lipid deposition in the liver were improved.

[0056] From the above content, it can be seen that specific knockout of intestinal GATA4 significantly aggravated HFD-induced liver dysfunction and liver pathological damage; while overexpression of intestinal GATA4 could significantly alleviate HFD-induced liver dysfunction and liver pathological damage. Figure 3 It can be seen that long-term high-fat diet will cause significant changes in the gene expression pattern of mouse liver tissue ( Figure 3 A, B, C). Long-term high-fat diet may cause changes in biological processes such as regulating chemokine-related pathways and cholesterol biosynthesis, thereby affecting biological pathways such as cytokine receptor interactions, chemokine signaling pathways, and Rap1 signaling pathways, leading to MASH ( Figure 3 D, E).

[0057] In recent years, the CCL2 / CCR2 axis has attracted widespread attention for its role in exacerbating inflammation and promoting fibrosis in the process of MASH. During the development of MASH, the liver secretes more CCL2, which can attract circulating monocytes and macrophages to migrate and infiltrate into the liver by binding to its specific receptor CCR2. This process not only promotes the accumulation of inflammatory cells in the liver, but also further amplifies the inflammatory cascade in the liver, thereby exacerbating the pathological process of MASH. We analyzed the RNA-Seq data of liver tissues in each group and found that under long-term HFD feeding, intestinal knockout GATA4 mice may be the key chemokine for regulation. The analysis results showed that compared with WT mice, the expression levels of C5AR1, CCL2 and PTAFR in the liver tissues of HFD mice were significantly increased. Compared with HFD mice, the expression levels of these three genes in the liver tissues of GATA4-CKO+HFD mice were further significantly increased, while the expression levels of these three genes in the liver tissues of GATA4-OE+HFD mice were significantly lower than those of HFD mice ( Figure 3 FH). We found that during the pathogenesis of MASH, knocking out the GATA4 gene led to a significant increase in the levels of chemokines such as CCL2 in serum, thereby enhancing the inflammatory response of the liver; conversely, overexpression of GATA4 could significantly reduce the levels of chemokines such as CCL2 in serum, thereby alleviating the inflammatory response of the liver.

[0058] From the above content, it can be seen that knocking out GATA4 can significantly increase the degree of HFD-induced gene expression disorder and the expression level of liver cytokines, but overexpression of GATA4 can reverse this condition.

[0059] Embodiment 3:

[0060] 1. Experimental animals: The present invention uses C57BL / 6 mice, all of which are 8-week-old male mice. All experimental animals were raised in the experimental animal center, with room temperature maintained at 18-22°C, humidity maintained at 50-70%, 12 h light / 12 h dark alternating lighting, and free access to water and food. Animal breeding, maintenance and experimental treatment were carried out in accordance with the guidelines of the Animal Ethics Committee.

[0061] 2. Reagents: HFD used in the present invention was purchased from Nantong Trofi Feed Technology Co., Ltd.

[0062] Experimental methods: In order to further explore the function of intestinal GATA4 in liver fibrosis, we prepared a liver fibrosis model by feeding HFD combined with intraperitoneal injection of carbon tetrachloride to intestinal GATA4-specific knockout mice, intestinal GATA4-overexpressing mice and control mice (WT group, negative control mice in the same litter). We selected intestinal GATA4-specific knockout mice, intestinal GATA4-overexpressing mice and negative control mice in the same litter obtained in Example 1 with uniform age and weight, and after one week of adaptive feeding, divided them into the following groups: (1) WT group: mice from the same littermate as the control group that were given a normal diet; (2) HFD+CCl4 group: 0.01 mL / 10 g carbon tetrachloride diluted in corn oil (1:1) was intraperitoneally injected twice a week, and the same littermate control mice were given HDF feed at the same time; (3) GATA4-CKO+HFD+CCl4 group: mice with intestinal GATA4-specific knockout were intraperitoneally injected with 0.01 mL / 10 g carbon tetrachloride diluted in corn oil (1:1) twice a week and fed a HFD diet; (4) GATA4-OE+HFD+CCl4 group: mice with intestinal GATA4 overexpression were intraperitoneally injected with 0.01 mL / 10 g carbon tetrachloride diluted in corn oil (1:1) twice a week and fed a HFD diet.

[0063] The above four groups of mice were fed continuously for 12 weeks. After the last feeding, they were fasted but not watered for 12 h. After the preparation, they were dissected and the serum was tested by ELISA, and the liver tissues of each group of mice were tested by RNA-seq, and the expression of genes related to epithelial-mesenchymal transition (EMT) and fibrosis were analyzed.

[0064] Serum ELISA results showed that compared with the WT group, the levels of CCL2 and TNF-α in the serum of the HFD+CCl4 group mice were significantly increased, while the level of IL-10 was significantly decreased. Compared with the HFD+CCl4 group mice, the levels of CCL2 and TNF-α in the serum of the GATA4-CKO+HFD+CCl4 group mice were further significantly increased, accompanied by a further significant decrease in the level of IL-10 ( Figure 4 AC). Compared with the mice in the HFD+CCl4 group, the levels of CCL2 and TNF-α in the serum of the mice in the GATA4-OE+HFD+CCl4 group were significantly decreased, while the level of IL-10 was significantly increased ( Figure 4 AC).

[0065] The basis for the CCL2 / CCR2 axis to affect the degree of liver fibrosis: In the process of liver fibrosis, a large number of studies have found that the CCL2 / CCR2 axis promotes the occurrence and development of liver fibrosis through various mechanisms. CCL2 activates hepatic stellate cells (HSCs), recruits macrophages into the liver through CCR2, and promotes their polarization into M2 macrophages, further activates HSCs, promotes the deposition of extracellular matrix (ECM), and promotes the progression of liver fibrosis. In a mouse model of liver fibrosis, the absence or pharmacological inhibition of CCR2 can significantly reduce the degree of liver fibrosis.

[0066] We analyzed the results of the experiment and found that after specific knockout of intestinal GATA4, the CCL2 / CCR2 axis in the mouse liver was activated. This change played a key role in the occurrence and development of liver fibrosis. Conversely, overexpression of intestinal GATA4 can effectively inhibit the activation of the CCL2 / CCR2 axis in the liver of mice with liver fibrosis. These results show that intestinal GATA4 may be a key molecular target for alleviating liver inflammation and improving liver fibrosis ( Figure 4 AC).

[0067] By performing RNA-seq analysis on liver tissues of mice with a liver fibrosis model established by a high-fat diet combined with intraperitoneal injection of CCl4, we found that long-term HFD intake combined with CCl4 treatment can significantly upregulate the expression of fibrosis-related genes in the liver of WT mice. It is worth noting that when intestinal GATA4 was specifically knocked out, the expression levels of fibrosis-related genes in mouse liver tissues increased further; conversely, when intestinal GATA4 was overexpressed, the expression levels of fibrosis-related genes in mouse liver tissues were significantly suppressed ( Figure 4 D). These results suggest that intestinal GATA4 plays an important role in regulating the progression of liver fibrosis and may become a potential target for the treatment of liver fibrosis in the future.

[0068] The above research results indicate that specific knockout of intestinal GATA4 significantly accelerates the disease progression of HFD-induced MASH, and leads to aggravated liver tissue damage, significantly increased levels of inflammatory cytokines, and abnormal expression of fibrosis-related genes in a mouse model of liver fibrosis; conversely, overexpression of intestinal GATA4 significantly improved liver tissue damage and inflammatory cytokine expression in mice and regulated the expression pattern of fibrosis-related genes.

[0069] In addition, long-term high-fat diet can lead to abnormal liver function, liver steatosis and cholesterol deposition in mice, and even lead to aggravated inflammatory response. It is worth noting that after specific knockout of intestinal GATA4, liver damage caused by long-term high-fat diet or liver fibrosis modeling was significantly aggravated. On the contrary, overexpression of intestinal GATA4 significantly improved liver function abnormalities and liver pathological damage in MASH or liver fibrosis mice.

[0070] On the one hand, the above study provides an animal model of MASH and liver fibrosis with more severe liver damage phenotypes such as elevated transaminases, liver steatosis, inflammation and fibrosis compared to traditional MASH and liver fibrosis models. On the other hand, the above study fully demonstrates that intestinal GATA4 can be used as an effective target for the prevention or treatment of MASH and liver fibrosis, which has important guiding significance in the development of drugs for the prevention and treatment of such diseases.

Claims

1. A method for constructing a MASH animal model in MAFLD based on the GATA4 gene, characterized in that: The construction method is as follows: S1: GATA flox transgenic heterozygous mice and Vil1-Cre transgenic mice were hybridized to obtain F1 generation, and the transgenic mice of the F1 generation with the genotype of GATA4 flox / +, Vil1-Cre were self-fertilized to obtain F2 generation mice; S2: F2 generation mice with GATA4 flox / flox and Vil1-Cre GATA4 intestinal-specific knockout genotypes were sequentially given a high-fat, high-cholesterol diet to induce an intestinal GATA4-specific knockout MASH model.

2. A method for constructing an animal model of liver fibrosis in MAFLD based on the GATA4 gene, characterized in that: The construction method is as follows: S1: GATA flox transgenic heterozygous mice and Vil1-Cre transgenic mice were hybridized to obtain F1 generation, and the transgenic mice of the F1 generation with the genotype of GATA4 flox / +, Vil1-Cre were self-fertilized to obtain F2 generation mice; S2: F2 generation mice with GATA4 flox / flox and Vil1-Cre GATA4 intestinal-specific knockout mice were given a high-fat and high-cholesterol diet and intraperitoneally injected with carbon tetrachloride to induce an intestinal GATA4-specific knockout liver fibrosis mouse model.

3. The use of the animal model cultivated by the method according to claim 1, characterized in that: Used to study and develop animal experiments and new drug development to investigate the effects of intestinal GATA4 gene on MASH in MAFLD.

4. The use of the animal model cultivated by the method according to claim 2, characterized in that: Used to study and develop the application of intestinal GATA4 gene in animal experiments and new drug development on the progression of MASH to liver fibrosis in MAFLD.

5. The use of GATA4 gene as a target in inhibiting the development of MASH into liver fibrosis in MAFLD, characterized by: The GATA4 gene is used as a drug target for inhibiting the development of MASH into liver fibrosis.

6. Use of GATA4 gene as a target in a drug for preventing or treating MASH or liver fibrosis, characterized in that: The use of the GATA4 gene in preparing a drug for preventing or treating MASH or liver fibrosis.

7. The use of the GATA4 gene as a target in a drug for preventing or treating MASH or liver fibrosis according to claim 6, characterized in that: The GATA4 gene is used in the preparation of a drug for improving liver function decline and liver pathological damage caused by MASH or liver fibrosis.

8. The use of the GATA4 gene as a target in a drug for preventing or treating MASH or liver fibrosis according to claim 7, characterized in that: The GATA4 gene is used in the preparation of a drug for alleviating abnormal liver function caused by MASH or liver fibrosis.

9. The use of the GATA4 gene as a target in a drug for preventing or treating MASH or liver fibrosis according to claim 7, characterized in that: The GATA4 gene is used in the preparation of a drug for improving liver inflammation, fatty degeneration and liver fibrosis caused by MASH or liver fibrosis.

10. The use of the GATA4 gene as a target in a drug for preventing or treating MASH or liver fibrosis according to claim 7, characterized in that: The GATA4 gene is used in the preparation of a drug for improving CCL2 / CCR2 axis abnormality and intrahepatic inflammatory environment caused by MASH or liver fibrosis.

Images