Multi-respiratory-tract pathogen mixed infection animal model as well as establishment method and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a multi-respiratory-tract pathogen mixed infection animal model and an establishment method and application thereof. The construction method provided by the invention comprises the following steps: firstly, infecting a female BALB / c mouse by using an influenza virus and mycoplasma pneumoniae virus mixture to construct a mycoplasma viral infection animal model, infecting for 20-28 hours, and finally successfully constructing a mixed infection mouse model. The state of the infected mouse is further observed, and the weight and death conditions, the clinical symptoms and tissue pathological changes of the infected animal model and the like are recorded. Therefore, the construction method provided by the invention is simple, and the constructed animal model is a safe, effective and economical tool and can be used for rapid preclinical evaluation of the screening process of medical products such as respiratory tract mixed infection detection kits, vaccines, medicines and the like under biosafety level 2 laboratory conditions.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to an animal model of mixed infection of multiple respiratory pathogens, and a method for establishing the model and application thereof. Background Art

[0002] Respiratory pathogens have overlapping epidemic seasons, and the peak of epidemics is generally concentrated in the autumn and winter seasons. Respiratory viruses refer to viruses that invade and reproduce in the respiratory tract, which can cause local respiratory infections and systemic infections. Respiratory pathogens have the characteristics of short infection incubation period, rapid spread, and wide impact on the population. They are the main pathogens that cause acute respiratory infections. In acute respiratory infections, viruses account for 70% to 80% of pathogens, and bacteria account for 20% to 30%. Among them, influenza is an acute respiratory infection caused by influenza virus (Influenza A virus, IAV), which is mainly transmitted through droplets in the air. In the early stage of the disease, it presents common flu symptoms, and in severe cases it can progress to bronchitis and pneumonia.

[0003] Among respiratory diseases, Mycoplasma pneumoniae (MP) infection is mainly transmitted through droplets, with a high incidence in autumn and winter. It can adhere to the surface of respiratory mucosal epithelial cells and cause lung infection.

[0004] Streptococcus pneumoniae (S.pn) can adhere to and colonize the surface of the upper respiratory tract of healthy people for a long time without causing any clinical symptoms. After entering the lower respiratory tract, it can cause lobar pneumonia under certain circumstances.

[0005] Influenza virus and Mycoplasma pneumoniae lung infection can reduce human immunity and increase the possibility of secondary infection with other pathogens. Because respiratory viruses (including influenza virus, rhinovirus, adenovirus, etc.) have similar tissue tropism, transmission routes, susceptible populations, etc., mixed infection often occurs when multiple respiratory pathogens overlap.

[0006] Mixed infection of respiratory diseases refers to the simultaneous infection of two or more pathogens, mostly combined infections between mycoplasmas, viruses, and bacteria. Compared with single pathogen infection, the symptoms of mixed infection tend to be more severe and last longer. Most clinical mixed respiratory infections are mainly combinations of viruses, bacteria, and mycoplasmas. "Mixed infection" is manifested in the ability to infect multiple pathogens at the same time, or several pathogens are infected successively. Relatively speaking, successive infections are more common. Infections with other pathogens such as influenza virus, Streptococcus pneumoniae, and respiratory syncytial virus are on the rise, and mixed infections with multiple pathogens have occurred in many places. Mixed infections involve two or more pathogens, and traditional antiviral bacterial drugs and vaccines only target a single pathogen and cannot provide effective protection. This makes the development of broad-spectrum vaccines and broad-spectrum antiviral drugs crucial to the prevention or treatment of multiple respiratory pathogen infections. However, the prior art has not yet formed an animal model that simultaneously contains viruses, mycoplasmas, and bacteria, which limits the research on mixed infection diseases.

[0007] Therefore, constructing an animal model simultaneously infected with viruses, mycoplasmas, and bacteria to study the pathogenic mechanism of mixed infection of respiratory diseases is necessary for the screening and preparation of broad-spectrum vaccines and drugs. Summary of the invention

[0008] Based on the above problems, the present invention provides a method for establishing an animal model of mixed infection with multiple respiratory pathogens. The animal model constructed by the present invention is close to the symptoms and causes of mixed infection in animals in real life, and is safe and effective. It can be used for rapid preclinical evaluation of respiratory mixed infection detection kits, vaccines, drugs and other drug screening processes under biosafety level 2 laboratory conditions.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0010] A method for establishing an animal model of mixed infection with multiple respiratory pathogens comprises the following steps:

[0011] S1. Expand the influenza virus to obtain a virus suspension, and simultaneously enrich and culture Mycoplasma pneumoniae and Streptococcus pneumoniae to obtain Mycoplasma pneumoniae suspension and Streptococcus pneumoniae suspension, respectively;

[0012] S2, mixing the virus suspension obtained in step S1 with the Mycoplasma pneumoniae suspension to prepare a virus-mycoplasma mixture;

[0013] S3, using the virus-mycoplasma mixture prepared in step S2 to infect the animal model, and 20 to 28 hours after infection, using the pneumococcal suspension obtained in step S1 to perform secondary infection to obtain a mixed infection animal model;

[0014] S4. Conduct clinical symptom detection and tissue pathological change verification on the mixed infection animal model obtained in step S4, and ensure that the verification is accurate.

[0015] Preferably, the influenza virus described in step S1 is H1N1 influenza virus PR8 subtype; the Mycoplasma pneumoniae is Mycoplasma pneumoniae ATCC15531; and the Streptococcus pneumoniae is Streptococcus pneumoniae ATCC49619.

[0016] The present invention selects the H1N1 virus PR8 subtype, which causes animals to suffer from influenza, and the Mycoplasma pneumoniae is derived from the American Standard Bacteria Library (ATCC15531), which is an atypical pathogen and belongs to the class of Soft-walled Fungi in the bacterial kingdom in microbiological classification. The Streptococcus pneumoniae is derived from the American Standard Bacteria Library (ATCC49619).

[0017] Preferably, the virus mycoplasma mixture in step S2 includes TCID 50 1.0×10 -2 / mL of H1N1 and 10 6 ccu / mL of Mycoplasma pneumoniae.

[0018] Preferably, the concentration of the Streptococcus pneumoniae suspension used for secondary infection in step S3 is 1×10 7 CFU / mL.

[0019] Preferably, the animal model described in step S3 is a 6-week-old SPF-grade BALB / c mouse.

[0020] The mice selected in the experiment of the present invention are SPF-grade female mice without specific pathogens. In the actual dripping process, the mycoplasma virus mixture is first used to infect mice, and 50 μL is dripped into the nose of each mouse; on the second day after infection, Streptococcus pneumoniae is dripped into the nose to infect mice, and 70 μL is dripped into the nose of each mouse.

[0021] The present invention also provides an animal model of mixed infection of multiple respiratory pathogens, which is obtained by adopting the establishment method.

[0022] The present invention also provides an application of the multi-respiratory pathogen mixed infection animal model in screening preventive and therapeutic drugs for diseases caused by mixed respiratory pathogens.

[0023] Preferably, the disease includes acute lung injury, viral pneumonia, acute respiratory tract infection, bronchitis.

[0024] The present invention also provides an application of the multi-respiratory pathogen mixed infection animal model in vaccine screening.

[0025] The present invention also provides an application of the multi-respiratory pathogen mixed infection animal model in the study of disease development and mechanism of respiratory pathogen mixed infection.

[0026] Common clinical mixed respiratory infections are mostly caused by viruses, mycoplasmas, and bacteria. Mixed infections of influenza and mycoplasma pneumoniae are prone to induce secondary bacterial infections, including Streptococcus pneumoniae (the highest proportion), Staphylococcus aureus, Haemophilus influenzae, etc.; we need to continue to pay attention to the superposition risks caused by multiple diseases (including influenza virus, mycoplasma pneumonia, bacterial pneumonia, etc.). Therefore, the construction of a compound infection animal model is crucial for a deeper understanding of the above superposition risks.

[0027] The present invention develops an animal model for mixed infection of respiratory pathogens for studying mixed infection of influenza virus and mycoplasma pneumonia, and secondary infection of pneumococcus. The present invention uses the influenza virus and mycoplasma pneumonia virus mixture provided to infect female BALB / c mice, construct a virus mycoplasma infection animal model, and drip pneumococcus nasally 20 to 28 hours after virus mycoplasma infection, which is used to construct mice with mixed infection of respiratory pathogens secondary to bacterial infection after virus mycoplasma pneumonia co-infection. Since mice have a respiratory structure similar to that of humans, the clinical manifestations and biochemical and tissue lesions of the animal model constructed by the present invention after infection are similar to those of human mixed infection of respiratory pathogens. The state of the mice after infection is further observed, and the weight and death, clinical symptoms and histopathological changes of the infected animal model are recorded. It is found that the animal model constructed by the present invention can correctly reflect the symptoms of mixed infection of the respiratory tract, and is closer to the symptoms and causes of mixed infection of animals in real life. Therefore, the animal model provided by the present invention is a safe, effective and economical model, which can be used for rapid preclinical evaluation under biosafety level 2 laboratory conditions, and can also be used for screening of respiratory mixed infection detection kits, vaccines, drugs, etc.

[0028] Compared with the prior art, the present invention has the following advantages:

[0029] (1) The present invention provides an ideal platform for simulating human respiratory pathogen infection diseases, and is inexpensive and convenient for quantitative detection;

[0030] (2) The animal model of the present invention not only helps to find new methods for treating mixed respiratory pathogens, but also helps to gain a deeper understanding of the hazards of mixed respiratory virus infections, the interactive relationships and pathogenic mechanisms of mixed respiratory virus infections, and provides researchers with a controllable and relatively predictable environment for simulating human diseases and evaluating the safety and effectiveness of drugs for treating respiratory infections;

[0031] (3) The animal model provided by the present invention has broad application prospects in verifying the effectiveness of broad-spectrum vaccines and antiviral drugs in preventing and treating mixed viral infections, and at the same time provides an important theoretical basis for the prevention and treatment of mixed respiratory viral infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the cell morphology after 72 h of culture;

[0033] Figure 2 This is the result of Mycoplasma pneumoniae culture;

[0034] Figure 3 This is a picture of the culture results of Streptococcus pneumoniae;

[0035] Figure 4 This is a comparison of the mouse status before and after infection;

[0036] Figure 5 This is a comparison chart of the changes in weight and survival rate of mice infected with different pathogens;

[0037] Figure 6 This is a picture of the lung tissue lesions of mice infected with different pathogens;

[0038] Figure 7 This is the result diagram of virus content after mixed infection;

[0039] Figure 8 This is the result of MP culture after mixed infection;

[0040] Fig. 9 This is the result of SPN culture after mixed infection;

[0041] Fig.10 qRT-PCR lung testing of viral / bacterial / mycoplasma loads in infected animals;

[0042] Fig.11 This is a diagram showing the results of organ pathology tests on mixed-infected mice. DETAILED DESCRIPTION

[0043] The present invention is further described below in conjunction with examples. These examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually carried out according to conventional conditions in the art or according to the conditions recommended by the manufacturer; the raw materials, reagents, etc. used, unless otherwise specified, are all raw materials and reagents that can be obtained from commercial channels such as conventional markets. Any non-substantial changes and substitutions made by those skilled in the art on the basis of the present invention belong to the scope of protection claimed by the present invention.

[0044] Example 1 Construction of a mouse model of mixed infection with respiratory pathogens

[0045] The method for constructing the mouse model is as follows:

[0046] First, 6-week-old SPF-grade BALB / c female mice weighing 20 g were prepared and housed in a laboratory with a temperature of 20 to 26° C. and a relative humidity of 40% to 70% with alternating light and dark during the day and night.

[0047] S1. Inoculate 5×10 5 / mL MDCK cells, the cell supernatant was collected after 4 days of culture, and a 10-fold serial dilution was made. After three days of culture at 37°C and 5% CO2, the cultured cells were observed under a microscope. The results were as follows Figure 1 As shown, Figure 1 A in the middle represents the cell morphology before virus inoculation, and B represents the cell microscopic morphology after virus inoculation and culture for 3 days. Under the microscope, a large number of cells were seen floating. The supernatant was collected and centrifuged. After centrifugation, the supernatant was taken and used as TCID 50 (i.e., the virus dilution at which 50% of the cells develop a pathological effect) test. TCID after determination 50 The experimental results are TCID 50 =10 -5 / mL. Determination of H1N1 virus TCID 50 For 10 -5 / mL, the present invention dilutes the influenza virus to TCID 50 =10 -2 / mL as seed virus.

[0048] TCID of A / PR / 8 / 34(H1N1) virus strain on MDCK cells 50 The determination results were calculated using the Karber method, and the test results are shown in Table 1 below. The calculation formula is 1gTCID 50 =Ld(s-0.5), where L = the logarithm of the highest dilution; d = the difference between the dilution logarithms; s = the sum of the ratios of positive tubes. 1 gTCID 50 =-1-1(4.5-0.5)=-5

[0049] Table 1 TCID of H1N1 virus strain of the present invention 50 Test results

[0050] Virus dilution The ratio of CPE cells (positive tubes) <![CDATA[10 -1 ]]> 6 / 6＝1 <![CDATA[10 -2 ]]> 6 / 6＝1 <![CDATA[10 -3 ]]> 6 / 6＝1 <![CDATA[10 -4 ]]> 6 / 6＝1 <![CDATA[10 -5 ]]> 3 / 6＝0.5 <![CDATA[10 -6 ]]> 0 / 6＝0 <![CDATA[10 -7 ]]> 0 / 6＝0

[0051] Then take out the Mycoplasma pneumoniae from the -80℃ refrigerator and transfer it to 10mL Mycoplasma pneumoniae liquid culture medium (purchased from Haibo Biotechnology, catalog number HBPT079) at a ratio of 1:10. Put the MP (i.e. Mycoplasma pneumoniae) into a 37℃ constant temperature incubator for constant temperature culture for 8 days. When the culture medium changes from red to orange-yellow, collect the Mycoplasma pneumoniae. Dilute the Mycoplasma pneumoniae with the Mycoplasma pneumoniae liquid culture medium 10 times in sequence, and dilute to 10 10 , set up pure culture medium as negative control, culture in a 37℃ constant temperature box for 2 weeks, when the color does not change, the last tube changes from red to yellow, which is the magnitude of Mycoplasma pneumoniae, and the Mycoplasma pneumoniae CCU is determined to be 10 6 / mL.

[0052] Take 100 μL of the Mycoplasma pneumoniae solution and dilute it to 1 mL, evenly spread it on the PPLO solid culture medium, wait for the liquid on the surface of the culture medium to dry, place it in a 37°C incubator and culture it for 7 days, then use an optical microscope to observe and count the number of Mycoplasma pneumoniae. The microscope model is Olympus CX43, the microscope diameter dview = FN / objective lens magnification = 1022mm = 2.2mm, and the camera image area is 1500μm×996.5μm≈0.015cm 2 The area of ​​a 9mm plate is 63.62cm 2 The number of colonies on the plate N = plate area / field area*number of colonies per field of view, and the number of Mycoplasma pneumoniae is calculated to be 2×10 7 CFU / mL.

[0053] The Mycoplasma pneumoniae was inoculated into the Mycoplasma pneumoniae liquid culture medium at a dilution ratio of 1:10. The Mycoplasma pneumoniae liquid culture medium was observed to change from red to orange-yellow, indicating that the Mycoplasma pneumoniae culture was successful. Figure 2 Mycoplasma pneumoniae was inoculated into PPLO solid medium and cultured at 37°C for 7 days. Fried egg-like colonies were observed under optical microscopy and Dienes staining. Figure 2 The cultured Mycoplasma pneumoniae (ATCC15531) was diluted in a gradient ratio of 1:10 and inoculated into the Mycoplasma pneumoniae liquid culture medium. The color change units were observed after 0d, 7d, and 14d of culture. After 14 days, 10 -6 The maximum dilution factor is indicated at the tube. Figure 2 As shown in C.

[0054] Streptococcus pneumoniae (ATCC49619) was inoculated on a sheep blood plate by streaking and cultured in a 37°C, 5% CO2 incubator for 24 hours. Figure 3As shown, a single Streptococcus pneumoniae colony is visible, accompanied by an α-hemolytic ring. Use a cotton swab to pick up a Mycoplasma pneumoniae colony and resuspend it in a turbidity tube to make the turbidity of the bacterial solution reach 0.5 McFarland turbidity, that is, the concentration of the bacterial solution is approximately equal to 1×10 8 CFU / mL.

[0055] S2. Take 10 mice of similar size and use a TCID 50 =10 -2 / mL of H1N1 and 10 6 CCU / mL of the virus mixture of Mycoplasma pneumoniae was used to infect mice. Each mouse was dripped into the nose with 50 μL. After 24 hours of infection with the mixture, Streptococcus pneumoniae was diluted 10 times and 1×10 7 CFU / mL of Streptococcus pneumoniae was used for secondary infection, and then the mortality of mice was observed within 5 days.

[0056] Take 10 mice of similar size and use a TCID 50 =10 -2 / mL of H1N1 and 10 6 A virus-mycoplasma mixture of Mycoplasma pneumoniae at a concentration of CCU / mL was prepared, and the mycoplasma-virus mixture was used to infect mice, and 50 μL was dripped into the nose of each mouse, and then the mortality rate of the mice was observed within 7 days.

[0057] Take 10 mice of similar size and use a TCID 50 1.0×10 -2 mL of H1N1 was used to infect mice, and 50 μL was dripped into the nose of each mouse, and then the mortality of the mice was observed within 7 days.

[0058] Take 10 mice of similar size and use 10 6 Mice were infected with CCU / mL of Mycoplasma pneumoniae, and 50 μL was dripped into the nose of each mouse, and then the mortality of the mice was observed within 7 days.

[0059] The phenotype of mice after infection was that after nasal instillation, the mice showed depression, huddling, rough hair, slow movement, listlessness, and heavy breathing. Figure 4 A; uninfected mice have smooth fur, stable condition, good appetite, normal hair, and are active and lively. Figure 4 B and C. Preliminary evidence that mice were infected with pathogens.

[0060] Example 2 Changes in body weight and survival rate of mixed-infection mice

[0061] The mice infected in Example 1 were autopsied 7 days later. The behavioral characteristics of the mice were monitored during the experiment. The survival rate and body weight of the mice were recorded over time and presented using Kaplan-Meier curves.

[0062] Weight results are as follows Figure 5 As shown in A, it can be seen that the weight of mice in the normal group fluctuated within the normal range, the weight of mice infected with Mycoplasma pneumoniae fluctuated slightly, and the weight increased after the 5th day, the weight of mice infected with H1N1 decreased on the third day, the weight of mice co-infected with influenza virus and Mycoplasma pneumoniae decreased significantly on the second day after infection, and the weight of mice secondarily infected with Streptococcus pneumoniae also decreased significantly on the second day, and the weight loss was greater than that of the group co-infected with the two pathogens.

[0063] The survival rate results are as follows Figure 5 As shown in B, it can be seen that there was no death in the normal group mice, mice infected with influenza virus alone and mice infected with Mycoplasma pneumoniae alone within 7 days, the double mixed infected mice died on the 6th day, and the 7-day survival rate was 75%, while the mice secondarily infected with Streptococcus pneumoniae died on the 5th day, and the 7-day survival rate was 50%.

[0064] Example 3 Lung Tissue Lesions in Mixed Infection Mice

[0065] The complete lung tissue was collected, and the pathological changes of the lung tissue of mice were observed and recorded. Figure 6 As shown in the figure, the lung tissue of the normal group was pink and elastic, without dark red lesions, and the lung surface texture was clear. After MP infection, dark red lesions appeared in the hilar part of the lung tissue of mice, and most of the lung lobes had no lesions in appearance. Dark red lesions appeared in the hilar part of the lung tissue of mice in the virus group, and the congestion area was larger than that in the MP group. Scattered congestion spots appeared in some lobes, which were dark red or dark red. Compared with the virus group, the area of ​​dark red lesions in mice co-infected with H1N1 and Mycoplasma pneumoniae was larger, and some lobes showed large-scale congestion. On the 3rd day of infection, the lesions were not only limited to the hilar part, but also appeared in the lobes. On the 7th day of infection, lesions appeared in a large area of ​​the whole lung, and some congested areas were smooth and uniform, and the surface texture disappeared. Compared with the other groups, the lungs of mice in the secondary pneumococcal infection group were larger in volume, and the lung tissue was dark red as a whole, which was significantly darker than the normal pink lung tissue. On the 3rd day of infection, lesions appeared in the hilar and lobes. On the 7th day of infection, lesions appeared in a large area of ​​the whole lung, and only some lobes retained the normal pink color at the edges. One lobe was gray-red, and its texture was harder than other lobes, indicating pulmonary consolidation. Dark black lesions appeared in this lobe, indicating congestion, and some congested areas were smooth and uniform, and the surface texture disappeared.

[0066] Example 4 Measurement of virus titer and live bacterial load in lung tissue of mixed-infection mice

[0067] The mice infected in Example 1 were dissected on the 7th day after infection. The lung tissues of the mice were homogenized: the lung tissues of the mice in each group were taken out, washed with physiological saline, weighed and ground, and finally smeared on blood agar plates, and cultured at 37°C and 5% CO2 for a total of 24 hours. The number of Streptococcus pneumoniae colonies in the three groups of lung tissues (i.e., PBS group, H1N1+MP (Mycoplasma pneumoniae), H1N1+MP+SPN (Streptococcus pneumoniae)) was counted.

[0068] Mouse lung homogenate was diluted as shown in the table below and inoculated into 1×10 4 The cells were cultured on a 96-well plate of MDCK cells and placed in an incubator at 37°C and 5% CO2. After three days of culture, the TCID of influenza virus was calculated by the Reed-Muench method. 50 . H1N1+MP mixed infection and H1N1+MP mixed infection followed by Streptococcus pneumoniae infection.

[0069] The results are as follows Figure 7 As shown, Figure 7 In the 96-well plate, each row represents a dilution, from top to bottom: homogenate stock solution, 10 -1 , 10 -2 , 10 -3 The culture results of the following dilutions were all negative and are no longer listed. In the figure, A is H1N1+MP-1Day, TCID 50 For 10 -4 / mL, B is H1N1+MP-3Day is 10 -3.375 / mL, C is H1N1+MP-7Day is 10 -2.375 / mL, D is H1N1+MP+SPN-3Day is 10 -3.25 / mL, E is H1N1+MP+SPN-7Day is 10 -2 / mL.

[0070]

[0071]

[0072] The supernatant of mouse lung homogenate was spread on PPLO solid medium and cultured in a 37°C incubator for 7 days. The number of live Mycoplasma pneumoniae was counted and calculated by microscopy. Figure 8 The culture results are shown in the following table.

[0073] Group Colony count (CFU / mL) Normal 0 H1N1+MP-1day <![CDATA[8.3×10 6 ]]> H1N1+MP-3day <![CDATA[1.4×10 7 ]]> H1N1+MP-7day <![CDATA[1.6×10 7 ]]> H1N1+MP+SPN-3day <![CDATA[8.9×10 6 ]]> H1N1+MP+SPN-7day <![CDATA[7×10 6 ]]>

[0074] Take the supernatant of mouse lung homogenate, spread it on blood plate and culture it in 37℃ incubator overnight, and count the number of pneumococcal colonies on the blood plate. Fig. 9 As shown in Figure 2, there was no growth of Streptococcus pneumoniae in the Normal and H1N1+MP groups. The number of colonies in lung homogenate was 2.6×10- 5 CFU / mL, the number of colonies in lung homogenate 4 days after infection with SPN (7 days after infection with H1N1+MP) was 3.6×10 6 CFU / mL.

[0075] Example 5 qRT-PCR lung virus / bacteria / mycoplasma detection

[0076] On the 1st, 3rd and 7th days after the challenge, the lungs of the mice were collected, ground with a homogenizer, tissue RNA was extracted, reverse transcribed into cDNA (the kit was purchased from Acre, catalog number AG11728), and cDNA was used as a template for quantitative reverse transcription polymerase chain reaction (qRT-PCR) (the kit was purchased from Acre, catalog number AG11718). The RNA extraction process is as follows: Trizol was collected in a centrifuge tube, and then chloroform was added to the mixture at 200 μL chloroform / mL Trizol, and the mixture was shaken and mixed, and then allowed to stand at room temperature. After standing for 15 minutes, centrifuged at 4°C 12000g for 15 minutes, and the upper aqueous phase was transferred to another centrifuge tube. Isopropanol was added at 0.5mL isopropanol / mL Trizol and mixed, and allowed to stand at room temperature for 10 minutes. Centrifuged at 4°C 12,000g for 10 minutes, the supernatant was discarded, and the RNA precipitated at the bottom of the tube. Add 75% ethanol at a rate of 1 mL 75% ethanol / mL Trizol, gently shake the centrifuge tube, and suspend the precipitate. Centrifuge at 4°C, 8000 g for 5 min, discard the supernatant, and air dry at room temperature to obtain RNA. Resuspend the RNA sample with 50 μL DEPC and test its content.

[0077] Test results such as Fig.10 As shown, Fig.10 A is the M2 gene of H1N1, B and C are the P1 genes of MP, and D is the Str-A gene of SPN for qPCR detection. The chart is 2 ^-△△Ct The results showed that mice were successfully infected with H1N1, MP, and Streptococcus pneumoniae.

[0078] The detection sequence is as follows:

[0079] H1N1

[0080] M2-F:CAAGTGATCCTCTCGTCATTGC

[0081] M2-R:ACTCTGCTGTTCCTGTTGATATTCT

[0082] MP

[0083] P1-F:CTTTGCGTTACGCCGGTATG

[0084] P1-R:GGCGTTTGCGGGTTTAACTT

[0085] S.Pn

[0086] SrtA-F:CTGGGATCCGTTCTAACTTCTCAATGGGATG

[0087] SrtA-R:CCGCTCGAGTTAATAAAATTGTTTATATGGTTG

[0088] Example 6 Lung injury scores and other organ pathology in mixed-infection mice

[0089] On the third day after mouse immunization, three mice were taken from each group. After euthanasia, the tissues were surgically removed and pathological sections of the main organs were prepared. The specific operations are as follows: (1) Sampling: After surgically obtaining the mouse heart, liver, spleen, lungs, and kidneys, cut them into appropriate sizes with a scalpel and put them into an embedding box; promptly put them into 4% paraformaldehyde for immersion and fixation for 3 days, and rinse the tissues with running water to remove excess paraformaldehyde; (2) Dehydration: Preheat the dehydrator in advance, set the dehydration program, and put the rinsed tissue blocks into the dehydrator for dehydration; (3) Embedding: Preheat the embedding machine, immerse the tissue blocks in paraffin for embedding, demold them after cooling, and seal them for storage; (4) Slicing: Precool the tissue blocks in advance, slice them continuously, Put the slices into the slide spreader, flatten them, pick them up, and dry them in a 56℃ oven for later use; Dewaxing: Put the dried paraffin slices into xylene I solution (15min), xylene II solution (15min), anhydrous ethanol I (10min), anhydrous ethanol II (10min), 95% ethanol (5min), 90% (5min), 80% (5min), double distilled water (5min) in the following order. Toluene I and toluene II are the same as anhydrous ethanol I and anhydrous ethanol II, except that the new and old solvents are distinguished. Hematoxylin eosin (HE) staining preparation: Stain the dewaxed slices according to the method provided by the H&E staining kit, seal the slices with neutral gum, and take photos under an optical microscope for observation.

[0090] The results are as follows Fig.11 As shown in the figure, the bronchial structure of the Normal group was intact, with no exudation in the lumen, the alveolar structure was intact, with no exudation in the alveolar cavity, and the heart, liver, kidney, and spleen tissue structures were intact, with no pathological changes.

[0091] HE sections after H1N1+MP infection showed damage to the bronchial epithelial structure, thickening of the bronchial wall, inflammatory cell infiltration around the bronchial cavity, cell fragments of dead epithelial cells, inflammatory cells, and red blood cells in the bronchi, and some bronchial lumens were completely blocked by cell fragments. The alveolar wall thickened, congestion and inflammatory cell infiltration occurred between the alveoli, the alveolar cavity volume decreased, and mucus exudation appeared in some cell cavities. The above pathological changes mainly appeared around the bronchi, and the alveolar structure around the lungs was still intact. The tissue structure of the heart, liver, kidney, and spleen was intact, and no pathological conditions had yet appeared.

[0092] After secondary SPN infection, the bronchial wall thickens, a large number of inflammatory cells infiltrate around the wall, the bronchial lumen is narrowed, bleeding, inflammatory cells and mucus exudate, and inflammatory cell fragments appear in some bronchi. The alveolar wall thickens, inflammatory cells infiltrate, red blood cells, inflammatory cells and mucus exudate in the original alveolar cavity structure, most of the alveolar structure in the middle part of the lung lobe disappears, and only a small part of the pneumonia edge area still has alveolar structure. The heart, liver, kidney, and spleen tissue structures are intact, and no pathological conditions have yet appeared.

[0093] Finally, it should be noted that the above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those familiar with the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A method for establishing an animal model of mixed infection with multiple respiratory pathogens, characterized in that: The process includes the following: S1. Expand the influenza virus to obtain a virus suspension, and simultaneously enrich and culture Mycoplasma pneumoniae and Streptococcus pneumoniae to obtain Mycoplasma pneumoniae suspension and Streptococcus pneumoniae suspension, respectively; S2, mixing the virus suspension obtained in step S1 with the Mycoplasma pneumoniae suspension to prepare a virus-mycoplasma mixture; S3, using the virus-mycoplasma mixture prepared in step S2 to infect the animal model, and 20 to 28 hours after infection, using the pneumococcal suspension obtained in step S1 to perform secondary infection to obtain a mixed infection animal model; S4. Conduct clinical symptom detection and tissue pathological change verification on the mixed infection animal model obtained in step S4, and ensure that the verification is accurate.

2. The method of establishing as claimed in claim 1, characterized in that: The influenza virus described in step S1 is H1N1 influenza virus PR8 subtype; the Mycoplasma pneumoniae is Mycoplasma pneumoniae ATCC15531; and the Streptococcus pneumoniae is Streptococcus pneumoniae ATCC49619.

3. The establishment method according to claim 1, characterized in that: The virus mycoplasma mixture in step S2 includes TCID 50 1.0×10 -2 / mL of H1N1 and 10 6 ccu / mL of Mycoplasma pneumoniae.

4. The establishment method according to claim 1, characterized in that: The concentration of the pneumococcal suspension used for secondary infection in step S3 is 1×10 7 CFU / mL.

5. The establishment method according to claim 1, characterized in that: The animal model described in step S3 is 6-week-old SPF-grade BALB / c mice.

6. An animal model of mixed infection with multiple respiratory pathogens, characterized in that: Obtained by the establishment method described in any one of claims 1-5.

7. Use of the animal model of mixed infection with multiple respiratory pathogens as claimed in claim 6 in screening drugs for preventing and treating diseases caused by mixed respiratory pathogens.

8. The use according to claim 7, characterized in that The diseases include acute lung injury, viral pneumonia, acute respiratory tract infection, and bronchitis.

9. Use of the animal model of mixed infection with multiple respiratory pathogens as claimed in claim 6 in vaccine screening.

10. Use of the animal model of multiple respiratory pathogen mixed infection as claimed in claim 6 in the study of disease development and mechanism of mixed infection of respiratory pathogens.

Images