KOD dna polymerase mutant, method for producing the same, and use thereof

By constructing mutants by mutating KOD DNA polymerase at specific sites and inserting amino acids, the problem of low efficiency of wild-type KOD DNA polymerase in amplifying long DNA fragments has been solved, achieving more efficient amplification results, which are suitable for PCR amplification reagents and kits.

CN119876080BActive Publication Date: 2025-11-07BEIJING QINGKE BIOTECHNOLOGY CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510065607.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-15
Publication Date
2025-11-07
Estimated Expiration
2045-01-15

AI Technical Summary

Technical Problem

Wild-type KOD DNA polymerase is less efficient at amplifying long DNA fragments, limiting its application in situations requiring the amplification of long DNA fragments.

Method used

By mutating wild-type KOD DNA polymerase at specific sites and inserting amino acids, a KOD DNA polymerase mutant was constructed to enhance its ability to amplify large DNA fragments. The enzyme was then expressed in Escherichia coli using a recombinant expression vector.

Benefits of technology

The KOD DNA polymerase mutant exhibits higher activity when amplifying large DNA fragments and has good soluble expression properties, making it suitable for PCR amplification reagents and kits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876080B_ABST
    Figure CN119876080B_ABST
Patent Text Reader

Abstract

The present application provides a KOD DNA polymerase mutant, a production method and application thereof, wherein the KOD DNA polymerase mutant has an amino acid sequence as shown in SEQ ID NO. 1. The production method comprises the following steps: culturing a recombinant host cell or a recombinant strain capable of secreting the KOD DNA polymerase mutant, and separating the KOD DNA polymerase mutant from the obtained culture product. The KOD DNA polymerase mutant of the present application has the characteristics of good amplification activity, especially good amplification activity for large fragment nucleic acids; and the KOD DNA polymerase mutant produced by the production method of the present application has good soluble expression performance; the KOD DNA polymerase mutant of the present application has good application prospect in the preparation of reagents and / or kits for PCR amplification.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biotechnology, and particularly relates to a KOD DNA polymerase mutant and a production method and application thereof. BACKGROUND

[0002] Polymerase Chain Reaction (PCR) is a basic and key technology in modern molecular biology, which realizes the in-vitro amplification of specific DNA fragments by simulating the in-vivo DNA replication process. Due to its high efficiency and specificity, PCR technology is widely used in fields such as gene cloning, genome sequencing, forensic identification, and diagnosis of genetic and infectious diseases.

[0003] KOD DNA polymerase, derived from Thermococcus kodakaraensis KOD1 strain, is a highly heat-stable DNA polymerase that can be expressed in Escherichia coli. The enzyme not only has 5' to 3' DNA polymerase activity, but also has 3' to 5' exonuclease activity, making it more faithful than Taq DNA polymerase, about 50 times that of Taq enzyme. Compared with other existing DNA polymerases, it has stronger heat resistance and fidelity. Although KOD DNA polymerase has the above advantages, the wild-type KOD DNA polymerase has limitations in amplifying long DNA fragments. Specifically, the wild-type KOD DNA polymerase has low efficiency in amplifying long DNA fragments, which limits its use in applications requiring long DNA amplification. Therefore, it is necessary to modify the wild-type KOD DNA polymerase to improve its ability to amplify long DNA fragments. SUMMARY

[0004] In view of the deficiencies in the prior art, the present application provides a KOD DNA polymerase mutant and a production method and application thereof. The KOD DNA polymerase mutant of the present application has good amplification activity, especially for long nucleic acid fragments. The KOD DNA polymerase mutant produced by the production method of the present application has good soluble expression performance. The KOD DNA polymerase mutant of the present application has good application prospects in the preparation of reagents and / or kits for PCR amplification.

[0005] The above object of the present application is achieved by the following technical solutions:

[0006] In a first aspect, the present application provides a KOD DNA polymerase mutant, which has an amino acid sequence as shown in SEQ ID NO. 1.

[0007] In a second aspect, the present application provides a method for obtaining the KOD DNA polymerase mutant of the first aspect, wherein the KOD DNA polymerase mutant is obtained by mutating a wild-type KOD DNA polymerase at the following positions: T33N, F38I, E50D, T61K, T64R, V68A, Q72K, V80I, I107V, V127I, M137L, A153G, E154K, G167E, N175K, V176I, R188K, R196K, C223A, N229K, A231T, V282I, Q285K, T296A, T297E, N304G, L327F, K375R, Q382E, E385A, R476K, Y493F, R501K, T522E, T524V, K526R, Y532F, I537L, S539A, M561K, A574L, L630I, D633H, K638E, V691I, R746K, S766G, T774K, and further mutated by inserting KE between D235 and G236, inserting L between R380 and R381, inserting N between D552 and A553, and inserting K at the end, wherein the wild-type KOD DNA polymerase has an amino acid sequence as set forth in SEQ ID NO. 2.

[0008] In a third aspect, the present application provides a nucleic acid molecule comprising a nucleotide fragment encoding the KOD DNA polymerase mutant of the first aspect.

[0009] In some embodiments of the present application, the nucleotide fragment has a base sequence as set forth in SEQ ID NO. 3.

[0010] In a fourth aspect, the present application provides a recombinant expression vector comprising the nucleic acid molecule of the third aspect.

[0011] In some embodiments of the present application, the recombinant expression vector is recombined from an expression vector and the nucleic acid molecule of the third aspect.

[0012] In some embodiments of the present application, the expression vector is selected from the pET series expression vectors, preferably a pET-32a plasmid, a pET-28a plasmid, or a pET-41a plasmid.

[0013] In a fifth aspect, the present application provides a recombinant host cell comprising the nucleic acid molecule of the third aspect or the recombinant expression vector of the fourth aspect.

[0014] In some embodiments of the present application, the host cell comprises a prokaryotic cell.

[0015] In some embodiments of the present application, the host cell is a competent cell, preferably a BL21 (DE3) competent cell.

[0016] In a sixth aspect, the present application provides a recombinant strain, comprising the recombinant host cell of the fifth aspect.

[0017] In some embodiments of the present application, the recombinant strain is obtained by transforming a host strain with the recombinant expression vector of the fourth aspect; preferably, the host strain is selected from the group consisting of E. coli.

[0018] In a seventh aspect, the present application provides a method for producing the KOD DNA polymerase mutant of the first aspect, comprising the following steps:

[0019] culturing the recombinant host cell of the fifth aspect or the recombinant strain of the sixth aspect, and isolating the KOD DNA polymerase mutant from the resulting culture product.

[0020] In some embodiments of the present application, the culturing conditions include that the culture medium is selected from the group consisting of LB medium, preferably liquid LB medium; the culturing temperature is 20-40°C; and the inoculation amount is 0.5%-1.5%.

[0021] In some embodiments of the present application, the isolating includes subjecting the cells containing the KOD DNA polymerase mutant to a disruption treatment to release the KOD DNA polymerase mutant; preferably, the disruption treatment is performed by using enzymatic and / or physical disruption methods, preferably using an ultrasonic disrupter.

[0022] In some embodiments of the present application, the isolating includes, before subjecting the cells containing the KOD DNA polymerase mutant to a disruption treatment, centrifuging the culture solution to collect the bacterial cells, and resuspending the bacterial cells with a lysis buffer; preferably, the lysis buffer comprises 20-50 mM Tris-Cl, 50-500 mM NaCl, 5%-10% glycerol, and has a pH of 7.8-8.8, and / or, when resuspending, the volume of the lysis buffer to the mass of the bacterial cells is (50-1000) mL:(0.01-0.2) g.

[0023] In some embodiments of the present application, the isolating further includes centrifuging the cell solution subjected to the disruption treatment, and recovering the supernatant; preferably, the centrifugation is performed at 5000-15000 rpm, and / or the centrifugation time is 30-90 min.

[0024] In some embodiments of the present application, the method further comprises purifying the isolated KOD DNA polymerase mutant; preferably, purifying by affinity chromatography; more preferably, the purifying comprises the following steps:

[0025] (1) mixing the KOD DNA polymerase mutant to be purified with Ni-NTA filler, rotating incubation at 0-10℃ for 10-20 min. Subsequently, centrifugation at 1000-2000 rpm for 30-90 s, collecting the liquid part.

[0026] Optionally, (2) collecting the filler obtained after centrifugation in step (1) and sequentially washing with buffers containing 20 mM imidazole, 50 mM imidazole and 300 mM imidazole, collecting the washing liquid, and combining the washing liquid with the liquid part collected in step (1).

[0027] In an eighth aspect, the present application provides use of the KOD DNA polymerase mutant of the first aspect or the KOD DNA polymerase mutant produced by the production method of the seventh aspect in the preparation of a reagent and / or kit for PCR amplification.

[0028] In a ninth aspect, the present application provides a PCR amplification reagent, which comprises the KOD DNA polymerase mutant of the first aspect or the KOD DNA polymerase mutant produced by the production method of the seventh aspect.

[0029] In some embodiments of the present application, the reagent further comprises at least one of PCR water, PCR reaction buffer and dNTPs.

[0030] In a tenth aspect, the present application provides a PCR amplification kit, which comprises the KOD DNA polymerase mutant of the first aspect or the KOD DNA polymerase mutant produced by the production method of the seventh aspect or the PCR amplification reagent of the ninth aspect.

[0031] The beneficial effects of the present application are as follows:

[0032] The KOD DNA polymerase mutant of the present application has the characteristics of good amplification activity, especially good amplification activity for large fragment nucleic acids; and the KOD DNA polymerase mutant produced by the production method of the present application has good soluble expression performance; the KOD DNA polymerase mutant of the present application has good application prospect in the preparation of a reagent and / or kit for PCR amplification. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1Part of the results of Blast performed on the NCBI website is shown.

[0034] Figure 2 Part of the results of the conservative site analysis performed using the Weblogo website (https: / / weblogo.berkeley.edu / logo.cgi) is shown.

[0035] Figure 3 Concentration detection results of wild-type KOD DNA polymerase and KOD DNA polymerase mutant at the same concentration are shown; in the figure, M represents a KOD DNA polymerase standard, 1 represents wild-type KOD DNA polymerase, and 2 represents KOD DNA polymerase mutant.

[0036] Figure 4 Results of amplification of 5000b nucleic acids using wild-type KOD DNA polymerase and KOD DNA polymerase mutant, respectively, are shown; in the figure, M represents a KOD DNA polymerase standard, 1 represents wild-type KOD DNA polymerase, and 2 represents KOD DNA polymerase mutant. DETAILED DESCRIPTION

[0037] The technology of the present application is further illustrated by the following examples. These examples are illustrative and exemplary of the present application and do not limit the scope of the present application in any way.

[0038] KOD DNA polymerase mutant was designed and its amplification activity was compared with that of wild-type KOD DNA polymerase, and the specific process was as follows:

[0039] (1) Design KOD DNA polymerase mutant

[0040] By using the sequence of wild-type KOD DNA polymerase (the sequence shown in SEQ ID NO. 2), performing Blast on the NCBI website, only selecting sequences with a homology of more than 70%, eliminating sequences identical to the sequence shown in SEQ ID NO. 2, eliminating super-long sequences containing inteins, eliminating mutant sequences from invention patents or published literature, eliminating sequences with more than 5 consecutive amino acid residue insertions or deletions, downloading the final remaining sequences after screening, using Bioedit software to perform alignment again by ClustalW method, inputting the alignment results into the Weblogo website (https: / / weblogo.berkeley.edu / logo.cgi) for conservation analysis, and identifying key sites that may affect enzyme activity and stability. According to the SequenceLogo file obtained by conservation analysis, only the most conservative amino acid residues are used for each amino acid site, and the KOD DNA polymerase mutant with multi-site mutations is constructed by site substitution. Among them, the results of the Blast performed on the NCBI website are shown in SEQ ID NO. 3, and the results of the conservation site analysis performed using the Weblogo website (https: / / weblogo.berkeley.edu / logo.cgi) are shown in SEQ ID NO. 4. Figure 1 Figure 2 The mutation sites of the KOD DNA polymerase mutant relative to the wild-type KOD DNA polymerase are: T33N, F38I, E50D, T61K, T64R, V68A, Q72K, V80I, I107V, V127I, M137L, A153G, E154K, G167E, N175K, V176I, R188K, R196K, C223A, N229K, A231T, V282I, Q285K, T296A, T297E, N304G, L327F, K375R, Q382E, E385A, R476K, Y493F, R501K, T522E, T524V, K526R, Y532F, I537L, S539A, M561K, A574L, L630I, D633H, K638E, V691I, R746K, S766G, T774K; and mutations have occurred in the following ways: KE is inserted between D235 and G236, L is inserted between R380 and R381, N is inserted between D552 and A553, and K is inserted at the end.

[0041] The amino acid sequence of the KOD DNA polymerase mutant is shown in SEQ ID NO. 1:

[0042] ​MILDTDYITEDGKPVIRIFKKENGEFKIEYDRNFEPYIYALLKDDSAIEDVKKITAERHGKVVRVKRAEKVKKKFLGRPIEVWKLYFTHPQDVPAIRDKIREHPAVVDIYEYDIPFAKRYLIDKGLIPMEGDEELKLLAFDIETLYHEGEEFGKGPILMISYADEEEARVITWKKIDLPYVDVVSTEKEMIKRFLKVVKEKDPDVLITYNGDNFDFAYLKKRAEKLGIKFTLGRDKEGSEPKIQRMGDRFAVEVKGRIHFDLYPVIRRTINLPTYTLEAVYEAIFGKPKEKVYAEEIAEAWETGEGLERVARYSMEDAKVTYELGKEFFPMEAQLSRLIGQSLWDVSRSSTGNLVEWFLLRKAYERNELAPNKPDERELARRLRESYAGGYVKEPERGLWENIVYLDFRSLYPSIIITHNVSPDTLNREGCKEYDVAPQVGHRFCKDFPGFIPSLLGDLLEERQKIKKKMKATIDPIEKKLLDYRQRAIKILANSFYGYYGYAKARWYCKECAESVTAWGREYIEMVIREIEEKFGFKVLYADTDGFFATIPGADNAETVKKKAKEFLKYINAKLPGLLELEYEGFYKRGFFVTKKKYAVIDEEGKITTRGLEIVRRDWSEIAKETQARVLEAILKHGDVEEAVRIVKEVTEKLSKYEVPPEKLVIHEQITRDLKDYKATGPHVAVAKRLAARGIKIRPGTVISYIVLKGSGRIGDRAIPFDEFDPTKHKYDAEYYIENQVLPAVERILKAFGYRKEDLRYQKTRQVGLGAWLKPKGKK

[0043] The amino acid sequence of the wild-type KOD DNA polymerase is shown in SEQ ID NO. 2 (GenBank: BAD84190.1, uniprot: P77933):

[0044] MILDTDYITEDGKPVIRIFKKENGEFKIEYDRTFEPYFYALLKDDSAIEEVKKITAERHGTVVTVKRVEKVQKKFLGRPVEVWKLYFTHPQDVPAIRDKIREHPAVIDIYEYDIPFAKRYLIDKGLVPMEGDEELKMLAFDIETLYHEGEEFAEGPILMISYADEEGARVITWKNVDLPYVDVVSTEREMIKRFLRVVKEKDPDVLITYNGDNFDFAYLKKRCEKLGINFALGRDGSEPKIQRMGDRFAVEVKGRIHFDLYPVIRRTINLPTYTLEAVYEAVFGQPKEKVYAEEITTAWETGENLERVARYSMEDAKVTYELGKEFLPMEAQLSRLIGQSLWDVSRSSTGNLVEWFLLRKAYERNELAPNKPDEKELARRRQSYEGGYVKEPERGLWENIVYLDFRSLYPSIIITHNVSPDTLNREGCKEYDVAPQVGHRFCKDFPGFIPSLLGDLLEERQKIKKKMKATIDPIERKLLDYRQRAIKILANSYYGYYGYARARWYCKECAESVTAWGREYITMTIKEIEEKYGFKVIYSDTDGFFATIPGADAETVKKKAMEFLKYINAKLPGALELEYEGFYKRGFFVTKKKYAVIDEEGKITTRGLEIVRRDWSEIAKETQARVLEALLKDGDVEKAVRIVKEVTEKLSKYEVPPEKLVIHEQITRDLKDYKATGPHVAVAKRLAARGVKIRPGTVISYIVLKGSGRIGDRAIPFDEFDPTKHKYDAEYYIENQVLPAVERILRAFGYRKEDLRYQKTRQVGLSAWLKPKGT

[0045] The nucleic acid sequence encoding the KOD DNA polymerase mutant (amino acid sequence as shown in SEQ ID NO. 1) is as shown in SEQ ID NO. 3:

[0046]

[0047] (2) The KOD DNA polymerase mutant was compared with the wild-type KOD DNA polymerase in terms of amplification activity, and the specific process included the following steps:

[0048] (2-1) Obtain KOD DNA polymerase plasmid

[0049] The nucleic acid sequences respectively encoding the above wild-type KOD DNA polymerase (the amino acid sequence is shown as SEQ ID NO. 2) and the KOD DNA polymerase mutant (the amino acid sequence is shown as SEQ ID NO. 1) were sent to Nanjing Qikexing Biological Technology Co., Ltd. The nucleic acid sequences were synthesized into a commercial pET-28a expression vector based on the T7 promoter, and the expression vector used contained an operator sequence that responded to IPTG induction.

[0050] (2-2) Obtain KOD DNA polymerase expressing competent cells

[0051] 1) The wild-type KOD DNA polymerase plasmid and KOD DNA polymerase mutant plasmid obtained in step (2-1) were respectively added to 100 μL of BL21 (DE3) competent cells, ice-bathed for 30 min, 42°C heat shocked for 45 s, and then ice-bathed for 2 min. Then 900 μL of LB was added, and the mixture was incubated at 37°C and 220 rpm for 1 h. Then the bacterial liquid was taken and spread on LB plates containing kanamycin, and incubated at 37°C overnight.

[0052] 2) The strains on the LB plate were picked into 4 mL of LB liquid medium and incubated at 37°C and 180 rpm for 4 h. Then 4 mL of bacterial liquid was transferred to 500 mL of LB liquid medium, and the incubation was continued at 37°C and 160 rpm for 4 h. Then the temperature was reduced to 16°C and the speed was reduced to 130 rpm, and 0.5 mM of IPTG was added to induce expression for 16 h.

[0053] 3) The LB liquid medium obtained in step 2) was centrifuged at 3500 rpm for 10 min, and the bacterial cells were collected, weighed, and the weight of the collection tube was subtracted to obtain the wet weight of each bacterial cell. Then the bacterial cells were resuspended in 50 mL of lysis buffer (50 mM Tris-Cl pH8.0, 300 mM NaCl, 10% glycerol). The resuspended bacterial cells were then broken using an ultrasonic disrupter, with the following ultrasonic conditions: power 60 W, interval 6 s, work 3 s, and total time 30 min. After the ultrasonic breaking treatment, the bacterial cell lysate was centrifuged at 9000 rpm for 60 min, and the supernatant was collected.

[0054] 4) The supernatant obtained in step 3) was mixed with 5 mL of Ni-NTA filler respectively, and incubated at 4°C for 15 min. Then, the liquid part was collected by centrifugation at 1500 rpm for 1 min, and the filler part was washed with buffers containing 20 mM imidazole, 50 mM imidazole and 300 mM imidazole respectively, and the liquid part obtained by washing the filler was collected, and the liquid collected after centrifugation was combined with the liquid obtained by washing the filler.

[0055] 5) The concentrations of wild-type KOD DNA polymerase and KOD DNA polymerase mutant in the two combined liquids obtained in step 4) were detected respectively, and the KOD DNA polymerase in the two combined liquids was adjusted to the same concentration using a buffer containing 300 mM imidazole. The detection results of the concentrations of KOD DNA polymerase in the two combined liquids after adjustment are shown in Table 1. Wherein, the detection concentration was carried out by using the SDS-PAGE precast gradient gel provided by Beijing Qianke Biological Technology Co., Ltd. according to the instructions thereof (electrophoresis at 150 V for 25 min), and then the protein band was stained using the rapid staining kit provided by Beijing Qianke Biological Technology Co., Ltd. Figure 3

[0056] (2-3) Activity detection of KOD DNA polymerase

[0057] A pair of primers were designed according to a 5 kb length region of the mouse genome purchased from Promega, wherein the sequence of the forward primer was tttgagtccaggtacaggataac, and the sequence of the reverse primer was cagttaggaaacagatacggatga; the reagents were prepared according to the PCR amplification system in Table 1, and the amplification was carried out according to the amplification program in Table 2. The wild-type KOD DNA polymerase was used as a control to calculate the reference of amplification activity, and the results are shown in Table 3. Figure 4

[0058] Table 1 PCR amplification system

[0059]

[0060] In Table 1, KOD FX Neo refers to wild-type KOD DNA polymerase or KOD DNA polymerase mutant

[0061] Table 2 Amplification program

[0062]

[0063] In Table 2, 30 sec. / kb refers to denaturation for 30 s per 1 kb according to the length of the nucleic acid sequence of the template.

[0064] ​​Table 3 amplification activity results

[0065]

[0066] As can be seen from Table 3, the amplification activity of the KOD DNA polymerase mutant was 40% higher than that of the wild-type KOD DNA polymerase for a 5 kb template.

[0067] It should be noted that the above-described embodiments are merely intended to explain the present application and are not intended to limit the present application in any way. The present application has been described with reference to the embodiments, but it should be understood that the words used are words of description rather than limitation, and it should be understood that modifications can be made by those skilled in the art within the scope of the present application as defined by the appended claims. Although the present application has been described with reference to specific methods, materials and embodiments, it should be understood that the present application is not limited to the particular examples disclosed, but extends to all methods and applications falling within the scope of the present application.

Claims

1. A mutant of KOD DNA polymerase, characterized in that, The amino acid sequence of the KOD DNA polymerase mutant is shown as SEQ ID NO.

1.

2. The method for obtaining the mutant of KOD DNA polymerase according to claim 1, wherein, The KOD DNA polymerase mutant is mutated from wild-type KOD DNA polymerase at the following sites: T33N, F38I, E50D, T61K, T64R, V68A, Q72K, V80I, I107V, V127I, M137L, A153G, E154K, G167E, N175K, V176I, R188K, R196K, C223A, N229K, A231T, V282I, Q285K, T296A, T297E, N304G, L327F, K375R, Q382E, E385A, R476K, Y493F, R501K, T522E, T524V, K526R, Y532F, I537L, S539A, M561K, A574L, L630I, D633H, K638E, V691I, R746K, S766G, T774K, and is mutated in the following way: inserting KE between D235 and G236, inserting L between R380 and R381, inserting N between D552 and A553, and inserting K at the end; wherein the amino acid sequence of the wild-type KOD DNA polymerase is shown as SEQ ID NO.

2.

3. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the KOD DNA polymerase mutant of claim 1, and the nucleotide sequence of the KOD DNA polymerase mutant is shown as SEQ ID NO.

3.

4. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid molecule of claim 3.

5. The recombinant expression vector of claim 4, wherein, The recombinant expression vector is recombined from an expression vector and the nucleic acid molecule of claim 3.

6. The recombinant expression vector of claim 5, wherein, The expression vector is a pET-32a plasmid, a pET-28a plasmid, or a pET-41a plasmid.

7. A recombinant host cell, characterized in that, The recombinant host cell comprises the nucleic acid molecule of claim 3 or the recombinant expression vector of any one of claims 4-6.

8. A recombinant bacterial strain, characterized in that, The recombinant strain comprises the recombinant host cell of claim 7.

9. The recombinant bacterial strain of claim 8, wherein, The recombinant strain is obtained by transforming a host strain with the recombinant expression vector of any one of claims 4-6.

10. The recombinant bacterial strain of claim 9, wherein, The host strain is selected from Escherichia coli.

11. The method for producing the mutant of KOD DNA polymerase according to claim 1, characterized by, The production method comprises the following steps: culturing the recombinant host cell of claim 7 or the recombinant strain of any one of claims 8-10, and isolating the KOD DNA polymerase mutant from the resulting culture product; 12. The production method according to claim 11, characterized by, The culture conditions include: the culture medium is selected from LB medium; the culture temperature is 20-40°C; the inoculation amount is 0.5%-1.5%; and / or, the isolation comprises subjecting the cells containing the KOD DNA polymerase mutant to a crushing treatment to release the KOD DNA polymerase mutant; and / or, the method further comprises purifying the isolated KOD DNA polymerase mutant.

13. The production method according to claim 12, characterized by, The LB medium is a liquid LB medium; and / or, the crushing treatment is performed by using an enzymatic method and / or a physical crushing method; and / or, purified by an affinity chromatography method.

14. The production method according to claim 13, characterized by, The disruption treatment is performed using an ultrasonic disrupter.

15. Use of the KOD DNA polymerase mutant of claim 1 or the KOD DNA polymerase mutant produced by the production method of any one of claims 11 to 14 in the preparation of a reagent and / or a kit for PCR amplification.

16. A PCR amplification reagent, characterized by, The reagent includes the KOD DNA polymerase mutant of claim 1 or the KOD DNA polymerase mutant produced by the production method of any one of claims 11 to 14.

Citation Information

Patent Citations

  • Recombinant KOD polymerase

    CN112585264A

  • KOD DNA polymerase mutant, and preparation method and application thereof

    CN113604450A