Primers PK-F2 and PK-R and method for qualitatively or quantitatively detecting pichia kudriavzevii

Abstract

The invention belongs to the technical field of bioengineering. The invention provides a primer PK-F2 and a primer PK-R. The sequence of the primer PK-F2 is 5 '-TGGAGTTTTGTGACGAGCCT-3', and the sequence of the primer PK-R is 5 '-TGGAGTTTTGTGACGAGCCT-3'. The sequence of the primer PK-R is 5 '-CAGGTTCCGCAGCAGCTATA-3', and the sequence of the primer PK-R is shown in the specification. According to the primer PK-F2 and the primer PK-R provided by the invention, rapid quantitative detection of pichia kudriavzevii in samples such as yeast for making hard liquor, fermented grains and the like can be realized through a qPCR (quantitative polymerase chain reaction) technology; the method has the advantages of high accuracy, good effectiveness and high sensitivity.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering. Background Art

[0002] Pichia kudriavzevii is an emerging non-Saccharomyces yeast that is widely distributed in the natural environment. It often plays an important role as a key microorganism in the spontaneous fermentation process of traditional fermented foods and beverages. Its unique functions in utilizing organic acids, releasing hydrolases, generating flavor compounds, and exhibiting probiotic properties make it a highly potential fermentation agent in the food and feed industry.

[0003] Compared with Saccharomyces cerevisiae, Pichia kudriavzevii exhibits stronger environmental tolerance and can grow under extreme conditions such as high temperature, low pH, and high osmotic pressure, which makes it more adaptable in harsh industrial fermentation processes.

[0004] However, currently, the commonly used detection technologies for Pichia kudriavzevii mainly rely on traditional microbial isolation and culture methods and high-throughput sequencing technology. Among them, the former relies on culture medium design, cumbersome operation, long time consumption, and high manpower and material costs; while the latter has high sequencing costs, complex data analysis, poor timeliness, and is easily affected by sequencing depth and bias, and has limited quantitative accuracy. Therefore, the development of a fast, simple, accurate and low-cost quantitative method for Pichia kudriavzevii is of great practical significance for optimizing fermentation processes, improving product quality and ensuring food safety. Summary of the invention

[0005] In view of this, the present invention provides a primer PK-F2 and PK-R, wherein the sequence of the primer PK-F2 is: 5'-TGGAGTTTTGTGACGAGCCT-3'; and the sequence of the primer PK-R is: 5'-CAGGTTCCGCAGCAGCTATA-3'.

[0006] The present invention also provides a method for qualitatively detecting Pichia kudriavzevii, comprising: after the primers PK-F2 and PK-R are used to perform colony PCR on the detection bacterial solution, if the PCR product has a band within 100 to 250 bp on the electrophoresis map, the bacterial solution is Pichia kudriavzevii.

[0007] The invention also provides a kit for detecting Pichia kudriavzevii, which contains the primers PK-F2 and PK-R.

[0008] The present invention also provides a method for quantitatively detecting Pichia kudriavzevii, comprising: extracting genomic DNA from a sample according to a sodium laurate-20T enzymatic method, using the obtained genomic DNA as a template, performing qPCR with the primers PK-F2 and PK-R described in claim 1, and obtaining a Cq value; substituting the Cq value into a standard curve to calculate the cell content.

[0009] Furthermore, the reaction system of the qPCR is:

[0010] .

[0011] Furthermore, the reaction conditions of the qPCR are:

[0012] .

[0013] Furthermore, the method for drawing the standard curve includes: calculating the number of cells in the Pichia kudriavzevii suspension; extracting the genomic DNA of Pichia kudriavzevii in the bacterial suspension according to the sodium laurate-20T enzymatic method, and gradient diluting the genomic DNA; measuring the Cq values ​​corresponding to the cell numbers of different gradient dilutions, and drawing the standard curve.

[0014] The primers PK-F2 and PK-R provided by the present invention can realize the rapid quantitative detection of Pichia kudriavzevii in samples such as Daqu and fermented grains through qPCR technology, with high accuracy, good effectiveness and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is an agarose gel electrophoresis identification diagram of different strains of Pichia kudriavzevii and different species of yeast colony PCR.

[0016] Among them, PK: Pichia kudriavzevii, among which PK1, PK2, PK3, PK4, PK5, PK6, and PK7 represent Pichia kudriavzevii from 7 different sample sources.

[0017] Among them, SC is Saccharomyces cerevisiae, WA is Wickerhamomyces anomalus, TD is Torulaspora delbrueckii, SP is Schizosaccharomyces pombe, NG is Nakaseomyces glabratus, ZB is Zygosaccharomyces bailii, CT is Candida tropicalis, and PF is Pichia fermentans.

[0018] Figure 2 It is the verification of the uncharacterized protein C5L36_0D01220 gene of Pichia kudriavzevii.

[0019] Figure 3 is the standard curve. DETAILED DESCRIPTION

[0020] The present invention will be further described below in conjunction with specific embodiments.

[0021] The culture medium involved in the following examples is as follows:

[0022] YPD solid medium: 1% yeast extract, 2% tryptone, 2% glucose, and 2% agar.

[0023] Example 1

[0024] Design of primers specific to Pichia kudriavzevii

[0025] Pichia kudriavzevii is a core yeast in fermentation systems such as liquor brewing. The specific uncharacterized protein C5L36_0D01220 gene of Pichia kudriavzevii was searched through the Kyoto Encyclopedia of Genes and Genomes (KEGG Pathway) to obtain a 645 bp nucleotide sequence encoding the specific gene, and the sequence is shown in SEQ ID NO.1 in the sequence table.

[0026] The nucleotide sequence was compared using the BLAST search tool (BLAST) of the National Center for Biotechnology Information (NCBI) of the United States. The comparison results showed that the nucleotide sequence had 100% similarity with the Pichia kudriavzevii uncharacterized protein C5L36_0D01220 gene sequence, indicating that the 645bp nucleotide sequence corresponding to the Pichia kudriavzevii uncharacterized protein C5L36_0D01220 gene is a highly specific sequence of Pichia kudriavzevii.

[0027] Primer Parameters were set using the Primer3Plus tool, including Product SizeRanges: 80-180bp; Primer Size: minimum 15bp, optimum 20bp, maximum 25bp; Primer Tm: minimum 55, optimum 60, maximum 65; Primer GC%: minimum 40, optimum 50, maximum 60; others were set as default. The designed upstream and downstream primers were placed in the Primer-BLAST of NCBI for primer specificity verification, and the Database was set to core_nt; Organism was set to Pichiakudriavzevii, and the other parameters were set as default. Products on target templates only had Pichia kudriavzevii uncharacterized protein C5L36_0D01220 and Pichia kudriavzevii GS1-1chromosome 4, which indicated that the selected primer pair was a specific primer pair suitable for this environment, and the PCR product length was 150bp, which was a part of the Pichia kudriavzevii uncharacterized protein C5L36_0D01220 gene.

[0028] The primer information is as follows: PK-F2: 5'-TGGAGTTTTGTGACGAGCCT-3'; PK-R: 5'-CAGGTTCCGCAGCAGCTATA-3'.

[0029] Example 2

[0030] Isolation and purification of common yeasts in fermentation environments such as Pichia kudriavzevii

[0031] First, core yeasts were selected from samples of high-temperature Daqu and koji-making environment during fermentation. More than 25 g of samples were weighed into a sterilized 500 mL Erlenmeyer flask containing 225 mL of sterile water and 5 glass beads with a diameter of 5 mm. The samples were then placed in a constant temperature shaker at 30°C and 200 r / min for 30 min and allowed to stand for 1 min to obtain a bacterial suspension. The bacterial suspension was diluted in sequence and 10 -3 , 10 -4 and 10 -5 The three dilutions of the sample bacterial suspension were spread on YPD solid culture medium plates and cultured in a constant temperature incubator at 30°C for 72 hours. Single colonies were selected and numbered as core yeast-like strains.

[0032] Secondly, use YPD to prepare solid slant culture medium, separate and purify the core yeast-like strains screened out, transfer them to test tube slant, culture them at 30°C, and store them at 4°C after the culture is completed.

[0033] Finally, the DNA of yeast from a single colony was crudely extracted using the alkaline lysis method, and the universal forward primer NL1 (5'-GCATATCAATAAGCGGAGGAAAAG-3') and reverse primer NL4 (5'-GGTCCGTGTTTCAAGACGG-3') were used to perform colony PCR on the genome to identify the strain. PCR reaction system (Table 1) and reaction conditions (Table 2). The sequence amplified by PCR was compared with the 26S rDNA D1 / D2 region sequence of the model strain in the NCBI website system to obtain the specific information of the target strain, and Pichia kudriavzevii was screened from a group of core yeasts.

[0034] Table 1 PCR system

[0035]

[0036] Table 2 PCR reaction conditions

[0037]

[0038] Example 3

[0039] Specificity Verification of Primer Pairs for Pichia kudriavzevii

[0040] In order to detect the effectiveness and accuracy of the primer pair (PK-F2 and PK-R) in Example 1, we selected 7 strains of Pichia kudriavzevii from different samples for experiment, and selected Saccharomyces cerevisiae, Wickerhamomyces anomalus, Torulaspora delbrueckii, Schizosaccharomyces pombe, Nakaseomyces glabratus, Zygosaccharomyces bailii, Candida tropicalis, Pichia fermentans, a total of 8 yeast strains, one each as negative controls. The above 15 yeast strains were subjected to crude DNA extraction by alkaline lysis method, and colony PCR was performed using primer pairs (PK-F2 and PK-R). PCR reaction system (Table 1) and conditions (Table 2), PCR products were identified by 1% agarose gel electrophoresis.

[0041] The results showed that the PCR products of 7 strains of Pichia kudriavzevii had bands within 100-250 bp, while the PCR products of 8 other species (negative control) did not have any bands (e.g. Figure 1 Then we performed Sanger sequencing on the PCR product. The sequencing results were compared with the uncharacterized protein C5L36_0D01220 gene of Pichia kudriavzevii by BLAST in the NCBI database and showed that the similarity was 100% (as shown in Figure 2 This result shows that the use of this pair of primers can indeed specifically amplify the uncharacterized protein C5L36_0D01220 gene of Pichia kudriavzevii, thereby achieving rapid identification of Pichia kudriavzevii in the sample.

[0042] Example 4

[0043] Quantification of the uncharacterized protein C5L36_0D01220 gene in Pichia kudriavzevii

[0044] 1. Counting the number of cells in a suspension of Pichia kudriavzevii

[0045] Prepare a suspension of Pichia kudriavzevii, and quantify the number of cells in it three times using a hemocytometer. The average value is the number of Pichia kudriavzevii cells at this concentration, which is 3.03×10 8 cells.

[0046] 2. Serial dilution of genomic DNA

[0047] Then, the genomic DNA of Pichia kudriavzevii was extracted from the bacterial suspension by the sodium laurate-20T enzymatic method, and the genomic DNA was diluted in a 10-fold gradient to the corresponding cell number of 10 7 , 10 6 , 10 5 , 10 4 , 10 3 cells.

[0048] 3. Measure the Cq value corresponding to the number of cells in different gradient dilutions and draw a standard curve

[0049] The primers (PK-F2 and PK-R) in Example 1 were used to perform qPCR on the above 6 genomic DNAs. The reaction system (Table 3) and reaction conditions (Table 4) of qPCR were set up three times for each genomic DNA, and the average of the three Cq values ​​was used as the horizontal axis, and the LG value of the number of cells was used as the vertical axis to draw a standard curve (see the standard curve Figure 3 ); At the same time, the standard curve expression y=-0.3314x+12.503, R2=0.997, where x is the Cq value and y is the LG value of the cell number.

[0050] Table 3 qPCR reaction system

[0051]

[0052] Table 4 qPCR reaction conditions

[0053]

[0054] Table 5. Cq data values ​​for drawing the standard curve

[0055]

[0056] Table 6. Cq and LG data values ​​for drawing the standard curve

[0057]

[0058] Example 5

[0059] Quantitative application of uncharacterized protein C5L36_0D01220 gene from Pichia kudriavzevii

[0060] Weigh 25 g of Daqu sample into a sterilized 500 mL Erlenmeyer flask containing 225 mL of sterile water and 5 glass beads with a diameter of 5 mm, then place it in a shaker at 30 °C and 200 r / min for 30 min, let it stand for 1 min to obtain a bacterial suspension, take 1 mL of the bacterial suspension and place it in a 1.5 mL centrifuge tube, centrifuge it at 4 °C and 12000 rpm for 10 min, discard the supernatant and keep the precipitate for extraction of genomic DNA.

[0061] The bacterial suspension was diluted in a gradient manner and 10 -3 , 10 -4 and 10 -5 The three dilutions of the sample bacterial suspension were spread on YPD solid culture medium plates and cultured in a constant temperature incubator at 30°C for 72 hours. Single colonies were picked and numbered, and colony PCR was performed using specific primers PK-F2 and PK-R.

[0062] The experimental results showed that the PCR product had bands between 100 and 250 bp, indicating that the Daqu sample contained Pichia kudriavzevii.

[0063] The genomic DNA in the sample (collected precipitate) was extracted according to the sodium laurate-20T enzymatic method. The obtained genomic DNA was used as a template and qPCR was performed using the above-mentioned specific primers PK-F2: TGGAGTTTTGTGACGAGCCT and PK-R: CAGGTTCCGCAGCAGCTATA. The reaction system and conditions were the same as those in Example 4. The obtained Cq value of 22.3998 was substituted into Figure 3 The standard curve was used to calculate the number of Pichia kudriavzevii cells in 1 mL of bacterial suspension to be 10 5 cells, and the final content of Pichia kudriavzevii in the Daqu sample was about 9×10 5 cells / g.

Claims

1. Primers PK-F2 and PK-R, characterized in that: The sequence of the primer PK-F2 is: 5'-TGGAGTTTTGTGACGAGCCT-3'; The sequence of the primer PK-R is: 5'-CAGGTTCCGCAGCAGCTATA-3'.

2. A method for qualitatively detecting Pichia kudriavzevii, characterized in that: include: After the primers PK-F2 and PK-R described in claim 1 are used to perform colony PCR on the test bacterial solution, if the PCR product has a band within 100 to 250 bp on the electrophoresis map, the bacterial solution is Pichia kudriavzevii.

3. A kit for detecting Pichia kudriavzevii, characterized in that: Contains the primers PK-F2 and PK-R according to claim 1.

4. A method for quantitatively detecting Pichia kudriavzevii, characterized in that: include: The genomic DNA in the samples was extracted using the sodium laurate-20T enzymatic method. Using the obtained genomic DNA as template, qPCR was performed using the primers PK-F2 and PK-R described in claim 1, Obtain Cq value; Substitute the Cq value into the standard curve to calculate the cell content.

5. The method for quantitatively detecting Pichia kudriavzevii according to claim 4, characterized in that: The reaction system of the qPCR is: 。 6. The method for quantitatively detecting Pichia kudriavzevii according to claim 4, characterized in that: The reaction conditions of the qPCR are: 。 7. The method for quantitatively detecting Pichia kudriavzevii according to claim 4, characterized in that: The method for drawing the standard curve is as follows: Count the number of cells in the Pichia kudriavzevii suspension; The genomic DNA of Pichia kudriavzevii was extracted from the bacterial suspension by the sodium laurate-20T enzymatic method, and the genomic DNA was graded and diluted; Measure the Cq values ​​corresponding to the cell numbers in different gradient dilutions and draw a standard curve.

Images