DsRNA of insect neuropeptide ecdysis triggering hormone ETH gene as well as preparation method and application of dsRNA

Abstract

The invention belongs to the technical field of biology, and relates to prevention and treatment of ladybird beetles, in particular to dsRNA of an insect neuropeptide ecdysis triggering hormone ETH gene and a preparation method and application of the dsRNA. Through transcriptome sequencing, screening to obtain the neuropeptide ETH gene of the ladybird; a fragment with the gene sequence as shown in SEQ ID No.2 is selected for synthesizing dsRNA (dsETH). After 3-day-old larvae dsETH (concentration is greater than or equal to 1 ng / mu L) of the ladybird are fed, more than 70% of the ladybird malforms and cannot eat on the seventh day, more than 70% of the ladybird dies on the tenth day, and the malformation rates of 5 ng / mu L, 10 ng / mu L, 25 ng / mu L and 100 ng / mu L respectively reach 85%, 90%, 95% and 100%. The invention provides a new prevention and treatment target for prevention and treatment of the ladybug 28 based on RNA (Ribonucleic Acid) interference.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the prevention and treatment of Coccinella twentiespotted. Background Art

[0002] As the scale of agricultural production continues to expand, the annual losses caused by pest damage are also increasing. Although chemical pesticides have become the first choice for pest control due to their high efficiency, low cost and ease of use, long-term reliance on chemical pesticides has caused a series of serious problems, including but not limited to pesticide residues, increased pest resistance, increased environmental pollution, threats to food safety, and damage to natural enemies. In response to these challenges, dsRNA pesticides based on RNA interference (RNAi) technology are gradually gaining widespread attention. When insects ingest dsRNA, it is broken down into short-chain RNAs of about 21 nucleotides, which can accurately pair with and degrade the mRNA transcribed from the target gene, thereby silencing the target gene. dsRNA is not only easily degraded in the environment and has no residue, it is highly environmentally friendly and exhibits high insecticide specificity. To date, dsRNAs of various target genes that are critical to insect physiological activities have been used for pest control. The silencing of these genes can kill pests and is extremely safe for non-target organisms. Therefore, the development and application of dsRNA pesticides are expected to significantly reduce the use of chemical pesticides, thereby reducing the negative impact of pesticides on the environment.

[0003] Coccinella twentiespottedii Henosepilachna vigintioctopunctata ) is a key pest on Solanaceae and Cucurbitaceae vegetables and Solanum nigrum. It is widely distributed throughout the country and causes serious damage. In northern regions, the pest has two generations a year, while in the Yangtze River Basin and its south, it can have three to five generations a year. At present, chemical control is still the main means of controlling this pest. Although there have been research attempts on biological control, its actual application is still relatively limited. Chemical control not only easily leads to pesticide resistance in pests, but may also affect the growth and development of beneficial organisms such as natural enemies and pollinating insects, and damage the ecological environment. In view of this, the research and development of environmentally friendly control methods for Solanum twentieth-spotted Coccinella is particularly urgent and important. dsRNA has a characteristic that it is easy to degrade during use. The application with publication number CN112410345A discloses the control of Coccinella twentieth-spotted FTZ-F1 gene by dsRNA against Coccinella twentieth-spotted , and the control effect is achieved by feeding 100ng / μL of dsRNA; given that different dsRNAs have different mechanisms of action, their lethal effects on pests are also different, so it is necessary to screen more target genes to optimize the control effect. In order to further explore the dsRNA of genes that can achieve control effects at low concentrations, our research group conducted in-depth excavation. Summary of the invention

[0004] The present invention provides a dsRNA of an insect neuropeptide molting triggering hormone ETH gene and a preparation method and application thereof, providing a new control target and application method for green control of pests.

[0005] The technical solution of the present invention is achieved in this way: A dsRNA of an insect neuropeptide molting triggering hormone ETH gene comprises a nucleotide sequence as shown in SEQ ID No. 2 and a reverse complementary nucleotide sequence thereof.

[0006] The nucleotide sequence shown in SEQ ID No. 2 is obtained by PCR amplification using the upstream primer SEQ ID No. 5 and the downstream primer SEQ ID No. 6 designed based on SEQ ID No. 1, and contains a T7 promoter with a fragment length of 324 bp, and is used to synthesize dsRNA.

[0007] The preparation method of the dsRNA of the insect neuropeptide molting trigger hormone ETH gene comprises the following steps: designing upstream primers and downstream primers according to the insect neuropeptide molting trigger hormone ETH gene, using Coccinella twentiespotted cDNA as a template, obtaining a DNA fragment by PCR, and synthesizing dsRNA by in vitro transcription using the DNA as a template.

[0008] The nucleotide sequence of the insect neuropeptide molting triggering hormone ETH gene is shown in SEQ ID No. 1. The sequence was obtained by transcription sequencing, and was retrieved and compared with the published genome data of Coccinella twentieth-spotted, and further PCR cloned to obtain an open reading frame sequence of 468 bp in length.

[0009] The upstream primer sequence is shown in SEQ ID No.3, and the downstream primer sequence is shown in SEQ ID No.4.

[0010] A recombinant vector containing the above gene.

[0011] An engineered bacterium containing the above-mentioned gene.

[0012] The use of the dsRNA of the insect neuropeptide molting triggering hormone ETH gene, the gene, the recombinant vector or the engineered bacteria in the preparation of an agent for controlling Coccinella twentieth-spotted, an agent for reducing the survival rate of Coccinella twentieth-spotted or an agent for inhibiting the expression of the insect neuropeptide molting triggering hormone ETH gene of Coccinella twentieth-spotted.

[0013] The above application steps are: feeding Coccinella twentiestices to the eggplant by spraying leaves containing the dsRNA liquid.

[0014] An insecticide for controlling Coccinella twentieth-spotted, comprising the above-mentioned dsRNA.

[0015] The minimum effective concentration of dsRNA in the above pesticides is 1 ng / μL; the preferred concentration is 1-100 ng / μL.

[0016] A method for preventing and controlling Coccinella twentiespinata comprises the following steps: feeding Coccinella twentiespinata larvae with feed containing the above-mentioned dsRNA.

[0017] The concentration of the above dsRNA in the above feed is 1-100 ng / μL.

[0018] Since the ETH gene of the eggplant Coccinella truncatula of the present application has a high homology with that of the potato Coccinella truncatula, the interference sequence can be used for interference and control of the gene in these two Coccinella truncatula.

[0019] Furthermore, the Coccinella twentiespotted is a larva of Coccinella twentiespotted within 3 days of age; the concentration of dsRNA is 1-100 ng / μL; and the dsRNA includes dsRNA synthesized by the above-mentioned gene or the above-mentioned recombinant vector or the above-mentioned engineered bacteria.

[0020] The present invention has the following beneficial effects: 1. The present invention obtains the ETH gene of Coccinella twenty-eight-spotted by sequencing the transcriptome of the nervous system of Coccinella twenty-eight-spotted and compares it with the genome. After cloning and sequencing, the gene sequence is determined to be SEQ ID No. 1; the fragment of the gene sequence SEQ ID No. 2 is selected for synthesizing dsRNA. After feeding 3-day-old larvae of Coccinella twenty-eight-spotted with dsETH for 7 days, most of the Coccinella twenty-eight-spotted appeared deformed and could not eat, and most of them died after 10 days. On the 7th day after Coccinella twenty-eight-spotted took dsETH with a final concentration of 1 ng / μL, 5 ng / μL and 100 ng / μL, the deformity rate was 70.00%, 85.00% and 100.00% respectively (once the deformity stopped eating), and the mortality rate on the 10th day was 70%, 85.0% and 100.0% respectively, providing a new control target for pest control based on RNA interference. Moreover, this application has a very good effect when using dsETH at a concentration of 1 ng / μL (the deformity rate and mortality rate reach 70%), and the insecticidal effect is better at a concentration above 5 ng / μL, which is more conducive to application in the field.

[0021] 2. The neuropeptide signaling system has great potential as a target for pest control due to its important physiological functions. The insect neuropeptide molting trigger hormone ETH was first identified in the tobacco hornworm in 1966. Subsequently, more studies have found that ETH is an essential molecule for regulating the insect molting process. Reduced or absent expression of ETH will cause the new and old cuticles of insects to be unable to separate and die. After using dsETH to interfere with the expression of the ETH gene of Coccinella truncatula, the molting of Coccinella truncatula was blocked, which inhibited feeding and growth and development, and then led to the death of Coccinella truncatula. Compared with traditional insecticides for the control of Coccinella truncatula, dsETH has the characteristics of small dosage and low pollution to the environment and non-target organisms. It is a safe and effective new insecticide. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 This is a sequence comparison of the ETH gene of the eggplant coccinella 28-spotted and potato coccinella 28-spotted; HVP is the eggplant coccinella 28-spotted; HVT is the potato coccinella 28-spotted.

[0024] Figure 2 This is the electrophoresis diagram of dsETH in Example 1 of the present invention.

[0025] Figure 3 This is a graph showing the deformity rate of 3-day-old larvae of Coccinella twentiespotted in Example 2 of the present invention after being fed dsETH at concentrations of 0.1, 1, 5, 10, 25 and 100 ng / µL.

[0026] Figure 4 This is a graph showing the mortality of 3-day-old larvae of Coccinella twentiespinata in Example 2 of the present invention after being fed with dsETH at concentrations of 0.1, 1, 5, 10, 25 and 100 ng / µL.

[0027] Figure 5 This is a diagram of the deformed phenotype of Coccinella twentiespotted after being treated with dsETH in Example 2 of the present invention.

[0028] Figure 6 This is a diagram showing the death phenotype of Coccinella twentiespotted after being treated with dsETH in Example 2 of the present invention.

[0029] Figure 7is the relative expression level of the ETH gene in Example 3 of the present invention after dsETH treatment of 3-day-old Coccinella twentiestices larvae for 2 and 4 days (*** indicates P <0.001, Independent t-tests, SPSS version 20.0 software). DETAILED DESCRIPTION

[0030] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0032] Example 1: Obtaining the ETH gene fragment of Coccinella twentiespinata and its dsRNA 1. Obtaining the ETH gene fragment of Coccinella twentiespotted 1) Searching for the ETH gene in the genome of Coccinella twentiespinipes 2) The transcriptome of the nervous system of Coccinella twentieth-spotted was sequenced and compared with the genome of Coccinella twentieth-spotted using bioinformatics methods. Figure 1 As shown, the open reading frame of the ETH gene of Coccinella twentiethoptera was obtained, the sequence length was 468 bp, and the sequence was shown in SEQ ID No.1.

[0033] 3) Design of primers for the ETH gene of Coccinella twentiespinata Based on the obtained ETH gene of Coccinella twentiethicans, primers were designed: The upstream primer is SEQ ID No. 3: ATGTGGTTCTCGAATTCTCT; The downstream primer is SEQ ID No. 4: TCAAACATAATTTGTGGTTC.

[0034] The primers used in the present invention were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0035] 4) Extract total RNA from Coccinella twentiesticulates.

[0036] 5) Take the nervous system tissues of 50 Coccinella twentiespotted larvae, place them in 200 μL of Trizol (TaKaRa) solution, and extract the total RNA of the nervous system tissues of Coccinella twentiespotted according to the instructions of the Trizol kit.

[0037] 6) Reverse transcription to synthesize cDNA TaKaRa reverse transcription kit was used to synthesize the cDNA of Coccinella twentiespotted according to the instruction manual.

[0038] 7) Obtaining and sequencing the open reading frame fragment of the ETH gene of Coccinella twentiespotted Using Novozyme MasterMix and designed primers, the obtained cDNA was used as a template, and the open reading frame fragment of the ETH gene of Coccinella twentieth-spotted was obtained through PCR reaction, and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The gene open reading frame sequence was obtained by first-generation sequencing.

[0039] 8) Analysis of the open reading frame sequence of the ETH gene in Coccinella twentiespinipes The obtained open reading frame sequence of the ETH gene of Coccinella twentiethoptera was compared with the sequence in the database to determine the correctness of the sequence. The sequence is shown in SEQ ID No.1.

[0040] 2. In vitro synthesis of dsETH from Coccinella truncatula 1) Based on the obtained sequence of the ETH gene of Coccinella twentiespottedii SEQ ID No.1, primers for dsETH synthesis template were designed on the NCBI website.

[0041] The primer sequences are: SEQ ID No.5: GATCACTAATACGACTCACTATAGGGAGAAGAAGTGGCGGTAGTAAAGGC; SEQ ID No.6: GATCACTAATACGACTCACTATAGGGAGAGGTTCGCTTGGAACGACCATA.

[0042] 2) In vitro synthesis of dsRNA of the ETH gene of Coccinella twentiespinata Using the designed dsRNA primers and the cDNA of Coccinella twentiespotted as a template, a dsRNA synthesis template was obtained by PCR using the Novagen MasterMix kit. The template sequence is shown in SEQ ID No. 2. After purification by the PCR product purification kit, the Novagen dsRNA synthesis kit was used to synthesize Coccinella twentiespotted dsETH in vitro according to the instructions. The electrophoresis pattern is shown in Figure 2shown.

[0043] Example 2: Using dsRNA to silence the ETH gene of Coccinella truncatula leads to the death of Coccinella truncatula 1) Different concentrations of dsETH (0.1, 1, 5, 10, 25 and 100 ng / μL) were prepared, and a dsEGFP control group (Control) with a concentration of 100 ng / μL was used to feed Coccinella twentiespecies to determine the insecticidal efficiency of dsETH against Coccinella twentiespecies.

[0044] 2) This experiment was conducted in 6 groups (Control, 0.1, 1, 5, 10, 25 and 100 ng / μL), with 40 nightshade beetles in each group. Use a hole puncher to take fresh nightshade leaves with a diameter of 13 mm, apply 5 μL of dsETH or dsEGFP solution on both sides and dry them appropriately, select 3-day-old larvae and place them in a 90 mm diameter culture dish (10 in each culture dish), and spread a layer of filter paper at the bottom of the culture dish to keep the moisture. After the larvae are starved for 4 hours, the leaves coated with dsRNA are placed in the culture dish to feed the larvae, and normal fresh nightshade leaves are added after the larvae have finished feeding. The culture dishes are placed in an artificial climate box at 26°C, relative humidity of 80%, and a photoperiod of L:D=14:10 for feeding.

[0045] 3) After feeding dsETH to Coccinella truncatula, the number of deaths of Coccinella truncatula was counted every day and the mortality rate was calculated. The results showed that after Coccinella truncatula fed on leaves treated with dsETH at concentrations of Control, 0.1, 1, 5, 10, 25 and 100 ng / μL, Coccinella truncatula began to show a deformed phenotype that could not molt on the third day, and could not eat after the deformity appeared. The deformity rates on the seventh day were 25.00%, 70.00%, 85.00%, 90.00%, 95.00% and 100.00%, respectively ( Figure 3 ), the mortality rates on the 10th day were 25.00%, 70.00%, 85.00%, 90.00%, 95.00% and 100.00% respectively ( Figure 4 The molting of deformed Coccinella truncatula was inhibited ( Figure 5 ), and being unable to eat leads to death ( Figure 6 ), which has the effect of controlling pests. The results showed that leaves treated with dsETH at a concentration of more than 1 ng / μL had a good insecticidal effect on Coccinella twentiethoctessima.

[0046] Example 3: Detection of ETH gene silencing efficiency in Coccinella truncatula 1) Ten 3-day-old Coccinella erinaceus larvae of the same size were placed in a 90 mm diameter culture dish. Using the leaf smear method, dsETH with a concentration of 10 ng / μL was smeared on the leaves, with 5 μL smeared on the front and back of the leaves. After smearing, the larvae were placed in the culture dish and fed with Coccinella erinaceus starved for 4 h. The control group was fed with the same concentration of dsEGFP in the same way and raised in an artificial climate box at 26°C and a photoperiod of 14L:10D.

[0047] 2) Total RNA was extracted from Coccinella truncatula fed with dsETH for 2 and 4 days, and Coccinella truncatula fed with dsEGFP was used as the control. There were 3 biological replicates in each group, and each replicate contained at least 3 Coccinella truncatula. The extracted total RNA was reverse transcribed into cDNA, and the relative expression level of the ETH gene in Coccinella truncatula was detected by fluorescence quantitative PCR. RPL13 and RPS18 were used as internal reference genes to calculate the silencing efficiency of the target gene.

[0048] 3) The results showed that dsETH took effect after 2 days of feeding, causing the expression level of the ETH gene in E. twentiethoptera significantly lower than that in the control group. The expression level decreased by 91.56% and 91.71% at 2 days and 4 days, respectively ( Figure 7 ).

[0049] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A dsRNA of the neuropeptide molting triggering hormone ETH gene of Coccinella twentiespinata, characterized in that: It includes the nucleotide sequence shown in SEQ ID No. 2 and the reverse complementary nucleotide sequence thereof.

2. The method for preparing dsRNA of the neuropeptide molting triggering hormone ETH gene of Coccinella twentiespinipes according to claim 1, characterized in that: The steps are: (1) Upstream and downstream primers were designed based on the ETH gene, and the DNA fragment was obtained by PCR using the cDNA of Coccinella twentiespinata as a template; (2) Design dsRNA primer pairs based on the DNA fragments, and then synthesize dsRNA by in vitro transcription using the insect cDNA as a template.

3. The method for preparing dsRNA of the neuropeptide molting triggering hormone ETH gene of Coccinella twentiespinipes according to claim 2, characterized in that: The nucleotide sequence of the ETH gene in step (1) is shown as SEQ ID No.1; the nucleotide sequence of the upstream primer is shown as SEQ ID No.3, and the nucleotide sequence of the downstream primer is shown as SEQ ID No.

4.

4. The method for preparing dsRNA of the neuropeptide molting triggering hormone ETH gene of Coccinella twentiespinipes according to claim 2, characterized in that: The nucleotide sequences of the dsRNA primer pair in step (2) are shown in SEQ ID No. 5 and SEQ ID No.

6.

5. Use of the dsRNA according to claim 1 in preparing an agent for controlling Coccinella twentiespotted.

6. Use of the dsRNA according to claim 1 in the preparation of an agent for increasing the deformity rate of Coccinella twenty-eight-spotted.

7. An insecticide for controlling Coccinella twentieth-spotted, characterized in that: Comprising the dsRNA of claim 1.

8. The insecticide for controlling Coccinella twentiespotted according to claim 7, characterized in that: The minimum effective concentration of dsRNA in the insecticide is 1 ng / μL.

9. A method for controlling Coccinella twentieth-spotted, characterized in that: The method comprises the following steps: feeding the larvae of Coccinella twenty-eight-spotted with feed containing the dsRNA according to claim 1.

10. The method for controlling Coccinella twentiespottedii according to claim 9, characterized in that: The concentration of the dsRNA according to claim 1 in the feed is 1-100 ng / μL, and the feeding time is ≤7 days.

Images