An alfalfa U6 promoter for improving gene editing efficiency and its application

By cloning the MsU6-3, MsU6-20 and MsU6-38 promoters from the alfalfa genome, the gene editing vector is constructed, and the gene editing efficiency of alfalfa is improved, and the problem of low efficiency in the existing technology is solved. It is suitable for alfalfa trait improvement and molecular breeding.

CN119876160BActive Publication Date: 2025-07-18QINGDAO AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510377019.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-07-18
Estimated Expiration
2045-03-28

AI Technical Summary

Technical Problem

In the prior art, the homozygous mutation efficiency of the CRISPR/Cas9 gene editing vector of alfalfa is low, which is difficult to meet the needs of alfalfa gene function research and biological breeding. The gene editing efficiency of the commonly used Arabidopsis U6 promoter is only about 60%.

Method used

Three endogenous U6 promoters of MsU6-3, MsU6-20 and MsU6-38 were cloned from the alfalfa genome, and gene editing vectors carrying these promoters were constructed. Through alfalfa hairy root transformation and high-throughput sequencing, it was found that their gene editing efficiency could reach 100%.

Benefits of technology

It improves the success rate and editing efficiency of alfalfa gene editing, solves the problem of low homozygous mutation efficiency of the CRISPR/Cas9 system in alfalfa, and provides a new gene editing strategy suitable for alfalfa trait improvement, molecular breeding and gene function research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876160B_ABST
    Figure CN119876160B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of gene editing, and specifically relates to a Medicago sativa U6 promoter for improving gene editing efficiency and its application. The promoter is MsU6-3 of the sequence shown in SEQ ID NO.2, MsU6-20 of the sequence shown in SEQ ID NO.3, or MsU6-38 of the sequence shown in SEQ ID NO.4. In the present invention, bioinformatics analysis was used to search for the endogenous U6 promoter of Medicago sativa flowers, and then CRISPR / Cas9 gene editing vectors carrying MsU6-3, MsU6-20, or MsU6-38 were designed. The gene editing efficiency of the promoters MsU6-3, MsU6-20, and MsU6-38 provided by the present invention was verified to reach 100% by using hairy root transformed plants and sequencing technology. The promoters provided by the present invention are of great significance for accelerating the research on gene functions and molecular breeding techniques of alfalfa in the future.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and particularly relates to a Medicago sativa U6 promoter for improving gene editing efficiency and its application. Background Art

[0002] Medicago sativa is a very important autotetraploid forage crop, which has an important position in China's livestock production and provides high-quality protein and essential nutrients for the global livestock breeding industry. At present, the breeding of alfalfa varieties mainly focuses on traditional methods such as hybridization and selection, and the breeding speed of excellent varieties is slow and the quantity is small, which is difficult to meet the market demand of alfalfa. Therefore, it is urgent to provide new strategies for alfalfa variety improvement to obtain excellent varieties with high yield, good quality and strong stress resistance.

[0003] In recent years, the CRISPR / Cas9 gene editing technology has brought revolutionary changes to plant biology and crop breeding. Since alfalfa is an autotetraploid plant with a complex genetic background, it is difficult to efficiently obtain homozygous mutants, which poses a great challenge to gene editing. At present, the homozygous mutation efficiency of most reported CRISPR / Cas9 gene editing vectors related to alfalfa is relatively low, which restricts the process of using the CRISPR / Cas9 technology to carry out gene function research and biological breeding in alfalfa.

[0004] The U6 promoter is a type II promoter, which can bind to eukaryotic RNA polymerase III and transcribe U6 RNA. The U6 promoter is commonly used for the transcription of gRNA in CRISPR / Cas9 gene editing vectors and is a key element in the vector. The U6 promoter has species specificity. In gene editing, using the endogenous U6 of the plant to transform the U6 promoter of the species itself or a closely related species can achieve higher promoter efficiency. The optimization of the U6 promoter can effectively regulate the expression of gRNA, thus significantly affecting the gene editing efficiency, specificity of the CRISPR / Cas9 system and its applicability in different organisms or tissues. An efficient U6 promoter can greatly improve the success rate and editing efficiency of gene editing. However, the promoters commonly used in currently developed CRISPR / Cas9 gene editing vectors related to alfalfa are the Arabidopsis thaliana U6 promoter, and the gene editing efficiency of this promoter is limited, only about 60%. Summary of the Invention

[0005] In view of the technical problems existing in the above-mentioned prior art, the present invention provides a Medicago sativa U6 promoter for improving gene editing efficiency. The promoter is MsU6-3 with the sequence shown in SEQ ID NO.2, or MsU6-20 with the sequence shown in SEQ ID NO.3, or MsU6-38 with the sequence shown in SEQ ID NO.4. The gene editing efficiencies of the promoters MsU6-3, MsU6-20 and MsU6-38 provided by the present invention can all reach 100%, and can be used for preparing gene editing vectors, and have broad application potential in aspects such as variety improvement of alfalfa.

[0006] In the first aspect of the present invention, a Medicago sativa U6 promoter for improving gene editing efficiency is provided. The Medicago sativa U6 promoter for improving gene editing efficiency is MsU6-3, or MsU6-20, or MsU6-38; the nucleotide sequence of MsU6-3 is as shown in SEQ ID NO.2; the nucleotide sequence of MsU6-20 is as shown in SEQ ID NO.3; the nucleotide sequence of MsU6-38 is as shown in SEQ ID NO.4.

[0007] In the second aspect of the present invention, an application of the above-mentioned Medicago sativa U6 promoter for improving gene editing efficiency in improving the gene editing efficiency of the CRISPR / Cas9 system is provided.

[0008] In the third aspect of the present invention, an application of the above-mentioned Medicago sativa U6 promoter for improving gene editing efficiency in alfalfa trait improvement is provided.

[0009] In the fourth aspect of the present invention, an application of the above-mentioned Medicago sativa U6 promoter for improving gene editing efficiency in alfalfa gene function research is provided.

[0010] In the fifth aspect of the present invention, an application of the above-mentioned Medicago sativa U6 promoter for improving gene editing efficiency in alfalfa molecular breeding technology is provided.

[0011] In the sixth aspect of the present invention, a gene editing vector is provided. The gene editing vector carries the above-mentioned Medicago sativa U6 promoter MsU6-3, or MsU6-20, or MsU6-38 for improving gene editing efficiency.

[0012] In the seventh aspect of the present invention, a construction method of the above-mentioned gene editing vector is provided. The construction method includes the following steps:

[0013] Sequentially connect the nucleotide sequences of the above-mentioned Medicago sativa U6 promoter MsU6-3, or MsU6-20, or MsU6-38 for improving gene editing efficiency with the sgRNA and gRNA scaffold nucleotide sequences of the gene to be edited to obtain a recombinant fragment;

[0014] Connect the recombinant fragment with the expression vector to obtain the gene editing vector.

[0015] Furthermore, the gene to be edited is FTa1 , FTa1 The nucleotide sequence of the gene is shown in SEQ ID NO.5.

[0016] Furthermore, the FTa1 sgRNAs of the gene are sgRNA1 and sgRNA2; the nucleotide sequence of sgRNA1 is shown in SEQ ID NO.6; the nucleotide sequence of sgRNA2 is shown in SEQ ID NO.7;

[0017] SEQ ID NO.6: 5’-AATCAACCCAGAGTGAGTGT-3’;

[0018] SEQ ID NO.7: 5’-AGGTTGGTGACTGATATTCC-3’.

[0019] Furthermore, the FTa1 nucleotide sequence of the gRNA scaffold of the gene is shown in SEQ ID NO.9.

[0020] SEQ ID NO.9: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCA

[0021] ACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0022] Furthermore, the expression vector is pRGEB31.

[0023] The eighth aspect of the present invention provides an application of the above-mentioned gene editing vector in improving the gene editing efficiency of alfalfa.

[0024] The ninth aspect of the present invention provides an application of the above-mentioned gene editing vector in improving the genetic transformation efficiency of alfalfa.

[0025] In summary, compared with the prior art, the present invention has the following beneficial advantages and effects:

[0026] The present invention for the first time cloned three endogenous U6 promoters of Medicago sativa from the Medicago sativa genome, namely the promoter MsU6-3 of the sequence shown in SEQ ID NO.2, the promoter MsU6-20 of the sequence shown in SEQ ID NO.3, or the promoter MsU6-38 of the sequence shown in SEQ ID NO.4. By respectively constructing gene editing vectors carrying these three promoters, and combining with the alfalfa hairy root transformation method and high-throughput sequencing to detect the gene editing efficiency of the MsU6-3, MsU6-20 or MsU6-38 promoter, it was found that the gene editing efficiency of MsU6-3, MsU6-20 and MsU6-38 can all reach 100%. The Medicago sativa U6 promoter for improving gene editing efficiency provided by the present invention can be used in the fields of alfalfa trait improvement, alfalfa molecular breeding or alfalfa gene function research.

[0027] The present invention also provides a gene editing vector and a preparation method thereof. The gene editing vector carries the nucleotide sequence of SEQ ID NO.2 or SEQ ID NO.3 or SEQ ID NO.4. The gene editing vector can improve the gene editing efficiency of alfalfa, solves the problem of low homozygous mutation efficiency of the CRISPR / Cas9 gene editing vector of alfalfa, and establishes a new alfalfa gene editing strategy. Brief Description of the Drawings

[0028] Figure 1 It is an evolutionary tree of the MsU6 promoter.

[0029] Figure 2 It is a flow chart of alfalfa hairy root transformation; Figure 2 Figure A of is a picture of seed germination, Figure 2 Figure B of is a picture of the first root cutting and infection, Figure 2 Figure C of is a picture of the culture for 8 days after the first root cutting, Figure 2 Figure D of is a picture of the second root cutting, Figure 2 Figure E of is a picture of the culture for 7 days after the second root cutting; Figure 2 Figure B of, Figure 2 Figure C of, Figure 2 Figure D of, and Figure 2 Figure E of are samples at different growth stages of the same batch of seedlings; the seeds in the upper row and the lower row are multiple repetitions of a batch of seedlings. Detailed Embodiments

[0030] In order to enable those skilled in the art to better understand and implement the technical solutions of the present invention, the present invention will be further described below in conjunction with specific embodiments and the drawings.

[0031] In the description of the present invention, unless otherwise specified, the reagents used are commercially available, and the methods used are conventional techniques in the art.

[0032] Biological materials involved in the examples:

[0033] Zhongmu No. 1 was obtained by purchasing from the store of China Forage Network; the competent cells of Agrobacterium rhizogenes Ar.1193 were purchased from Shanghai Weidi Biotechnology Co., Ltd.; in the present invention, the alfalfa U6 promoter is labeled as MsU6; the alfalfa U6 promoter obtained in the present invention is represented by MsU6-X, where X is an Arabic numeral and X is used to distinguish alfalfa U6 promoters with different nucleotide sequences.

[0034] Since alfalfa is an autotetraploid plant with a complex genetic background, it is difficult to efficiently obtain homozygous mutants, which poses a great challenge to gene editing in alfalfa. At present, the homozygous mutation efficiency of most reported CRISPR / Cas9 gene editing vectors related to alfalfa is relatively low, restricting the process of using CRISPR / Cas9 technology to carry out gene function research and biological breeding in alfalfa. And the promoter commonly used in the currently developed CRISPR / Cas9 gene editing vectors related to alfalfa is the Arabidopsis U6 promoter, and the gene editing efficiency of this promoter is limited, only about 60%.

[0035] The present invention provides an alfalfa U6 promoter for improving gene editing efficiency and its application. The alfalfa U6 promoter for improving gene editing efficiency is MsU6-3 or MsU6-20 or MsU6-38; the nucleotide sequence of MsU6-3 is shown in SEQ ID NO.2; the nucleotide sequence of MsU6-20 is shown in SEQ ID NO.3; the nucleotide sequence of MsU6-38 is shown in SEQ ID NO.4. MsU6-3 or MsU6-20 or MsU6-38 can be used to construct gene editing vectors for improving the gene editing efficiency or the genetic transformation efficiency of alfalfa genes; the promoter or gene editing vector provided by the present invention has broad application potential in aspects such as variety improvement of alfalfa.

[0036] Example 1: Obtaining of the promoter

[0037] The conserved sequence of Arabidopsis U6 snRNA is shown in SEQ ID NO.1. The nucleotide sequence shown in SEQ ID NO.1 was used to search and align in the Xinjiang big-leaf alfalfa genome database with the website address of https: / / phytozome.jgi.doe.gov to obtain candidate alfalfa U6 promoters;

[0038] SEQ ID NO.1:

[0039] gtcccttcggggacatccgataaaattggaacgatacagagaagattagcatggcccctgcgcaaggatgacacgcataaatcgagaaatggtccaaatttt。

[0040] Due to the complex alfalfa genome data and huge computational workload, the conventional genomic BLAST cannot be performed on a general web page. Screening through software reading is limited by the huge genomic file and cannot be compared either. Therefore, the present invention combines code setting instructions, without the need for manual waiting and operation, so as to extract the sequence containing the promoter. The specific method for obtaining the promoter is as follows:

[0041] S1. Input vim script.py in the Terminal under the Linux system. After pressing Enter, start editing the script: blastn - query cp_TRL_nucleotide sequence shown in SEQ ID NO.1 to be compared - subject cp_genomic file name - out out_output file name - evalue 1e - 5 - outfmt6. Input python script.py in the Terminal and press Enter to start running the script and execute the code in the script to obtain the position information of the comparison result;

[0042] S2. According to the position information of the comparison result, use the code for extracting sequence information to extract the information. The code for extracting sequence information is: extractseq - sequence genome.fa - regionXXX - XXXX - outseq new.fa; where XXX - XXXX represents the start sequence and end sequence in the comparison result; according to the position information of the comparison result, calculate the position information of 2000 bp upstream and 2000 bp downstream of the comparison result containing the promoter sequence, and extract the sequence according to the code for extracting information to obtain the RNA sequence containing MsU6;

[0043] S3. Find the MsU6 promoter sequence among different RNA sequences containing MsU6, and then truncate the 5' end of the MsU6 promoter sequence by 300 bp for the construction of the gRNA promoter vector.

[0044] As Figure 1 shown, the present invention obtained 44 MsU6 promoters from the alfalfa genome database. Through bioinformatics analysis, an evolutionary tree of the MsU6 promoter was constructed. Further, according to the evolutionary tree, the promoters were divided into 17 groups, and the specific information is shown in Table 1.

[0045] Table 1 Consistency grouping of the promoter evolutionary tree

[0046]

[0047] Note: The underlined promoter is the candidate MsU6 promoter of the present invention. Since a single promoter cannot be aligned, the " / " in the corresponding column of identity indicates no data.

[0048] The nucleotide sequence of MsU6-3 is shown in SEQ ID NO.2, the nucleotide sequence of MsU6-20 is shown in SEQ ID NO.3, and the nucleotide sequence of MsU6-38 is shown in SEQ ID NO.4.

[0049] SEQ ID NO.2:

[0050] CTAGTCTAAACACAAATTGCAATGCTCTACGTTGCTTTCATGGGTTTCAACTTTGAGGCTAATAATGTAAAAAGAGAGGTTATATATCTAATTCTGTGAAGGGCACTATACAACACAATATAGTTGATGATTTATAAACTTTTGTATTACTTTTACTTTAAAGTGACAACGAAAGGAGGGAAGAGGGTTCATTTCATGTTGGTAAGTAAGTGCGTTGTTTTAGTTTTGTAAATAGTCCCACATCGCTTAAATGAAAGAAATATACAGTGTTTATATAACGCTAGCGCAGTGAATGGCTTG.

[0051] SEQ ID NO.3:

[0052] CAGCAAAAATCAGGTTGGACTACCATAAGCAGCACCGCATATTACACTTAATGGGGTAAACTAGAACGAGCCACATCACCTCATTGGTTTGAGTACTGTGAGGGAGAGGGAGGAACTTCTTCACTACTCAACTCAACTCACTGAGAGTGAGAGTAAGATGCATGCACCTACCTCGGTTGCTTTCGCTGATTCCGGTGAATGTTGAGAAATAAATGTTATGTTTGCTTGCTATTAGTCCCACATCGCTTACATATTCTTAAGTTCTCATGTTTATATAATCTAGACGAACAACAGGGCTTG.

[0053] SEQ ID NO.4:

[0054] GAACTAGTCCAAACCCAACAAGTTGCAATGCTCTATACGTAGATTTCATAGGTTTCAACTTTGAGGAAAGATTCCTAATAATGTAAAATGAGAGCTGAGGTATCTAATTGTGTGAAGGGCACTAGACAACACAATACAGTTGATGATTTCAAAACTTTTGTATTACTTAAAGTGACAACGAAGGGAGGGAAGAGGGTTCATTTCATGTTGGTAGTAAGTGCGTTGTTTTAGTTGTGAAAATAGTCCTACATTGAAACAAACATGGAATGTTTATATTACGCTAGCGCACTTCAACTAATG。

[0055] Example 2: Construction of gene editing vector

[0056] S1. From the 17 groups of promoters in Table 1, select the candidate MsU6 promoters MsU6-1, MsU6-2, MsU6-3, MsU6-4, MsU6-5, MsU6-6, MsU6-11, MsU6-18, MsU6-20, MsU6-21, MsU6-22, MsU6-25, MsU6-27, MsU6-33, MsU6-35 and MsU6-38 for testing.

[0057] S2. The FTa1 gene of alfalfa can regulate the flowering of alfalfa. Mutating this gene can delay the flowering period of alfalfa. FTa1 The nucleotide sequence of the gene is shown in SEQ ID NO.5; respectively connect the nucleotide sequences of the MsU6 promoters selected in step S1 with FTa1 the nucleotide sequences of the sgRNA and the gRNA scaffold of the gene in sequence. Specifically: respectively combine and synthesize fragments of the nucleotide sequences of the promoters selected in step S1 with the nucleotide sequences of tRNA, sgRNA1, gRNA scaffold, tRNA, sgRNA2, and gRNA scaffold in sequence. Use the synthetic fragment linked to the Arabidopsis thaliana AtU6 promoter as a control experiment. The synthetic fragment is synthesized by Nanjing GenScript Corporation; the nucleotide sequence of sgRNA1 is shown in SEQ ID NO.6, the nucleotide sequence of sgRNA2 is shown in SEQ ID NO.7, the nucleotide sequence of tRNA is shown in SEQ ID NO.8, and the nucleotide sequence of gRNA scaffold is shown in SEQ ID NO.9.

[0058] SEQ ID NO.5:

[0059]

[0060] SEQ ID NO.6: 5'-AATCAACCCAGAGTGAGTGT-3'.

[0061] SEQ ID NO.7: 5'-AGGTTGGTGACTGATATTCC-3'.

[0062] SEQ ID NO.8: AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGCCACGGTA

[0063] CAGACCCGGGTTCGATTCCCGGCTGGTGCA.

[0064] SEQ ID NO.9: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCA

[0065] ACTTGAAAAAGTGGCACCGAGTCGGTGC.

[0066] S3. Respectively ligate the synthetic fragments obtained in step S2 through EcoR Ⅰ- EcoR Ⅰ restriction enzyme sites with the expression vector pRGEB31 to obtain CRISPR / Cas9 gene editing vectors ligated with different alfalfa promoters: MsU6-1-pRGEB31, MsU6-2-pRGEB31, MsU6-3-pRGEB31, MsU6-4-pRGEB31, MsU6-5-pRGEB31, MsU6-6-pRGEB31, MsU6-11-pRGEB31, MsU6-18-pRGEB31, MsU6-20-pRGEB31, MsU6-21-pRGEB31, MsU6-22-pRGEB31, MsU6-25-pRGEB31, MsU6-27-pRGEB31, MsU6-33-pRGEB31, MsU6-35-pRGEB31 and MsU6-38-pRGEB31. At the same time, ligate the synthetic fragment ligated with the Arabidopsis thaliana AtU6 promoter with the expression vector pRGEB31 to obtain the gene editing vector AtU6-pRGEB31.

[0067] Example 3: Detection of promoter editing efficiency

[0068] 1. Hairy root genetic transformation

[0069] Using the alfalfa hairy root genetic transformation technology, the CRISPR / Cas9 gene editing vectors and the gene editing vector AtU6-pRGEB31 constructed in Example 2 and ligated with different alfalfa promoters were respectively transferred into alfalfa to detect the gene editing efficiency of the promoters. The specific steps are as follows.

[0070] S1. Preparation of explants: Cultivate Zhongmu No. 1 seeds until germination, use the sterile alfalfa seedlings germinated for two days as plant materials, and cut off 3 mm of the root tip with a scalpel.

[0071] S2. Preparation of Agrobacterium rhizogenes liquid: MsU6-1-pRGEB31, MsU6-2-pRGEB31, MsU6-3-pRGEB31, MsU6-4-pRGEB31, MsU6-5-pRGEB31, MsU6-6-pRGEB31, MsU6-11-pRGEB31, MsU6-18-pRGEB31, MsU6-20-pRGEB31, MsU6-21-pRGEB31, MsU6-22-pRGEB31, MsU6-25-pRGEB31, MsU6-27-pRGEB31, MsU6-33-pRGEB31, MsU6-35-pRGEB31, MsU6-38-pRGEB31 and AtU6-pRGEB31 were respectively transferred into the competent cells of Agrobacterium rhizogenes Ar.1193 suitable for alfalfa hairy root transformation, amplified and cultured, and evenly spread on TY solid medium for 1 d, which can be used for the infection of the seedling incision after the first root cutting; the preparation method of TY solid medium is as follows: Weigh 5 g of tryptone, 3 g of yeast extract, 15 g of agar powder, make up the volume to 1 L with water, sterilize at 121 °C for 20 min, and then add 10 mL of sterile 1 M calcium chloride aqueous solution, and mix to obtain TY solid medium.

[0072] S3. Infection and co-culture: Put the explants obtained in step S1 into the solid medium prepared in step S2 to dip the bacterial liquid, and culture on 1 / 4 MS medium without antibiotics at 24 °C for 3 d, and then transfer the explants to 1 / 4 MS medium containing 2 mg / mL glufosinate for culture until hairy roots grow.

[0073] S4. Isolation and subculture of hairy roots: After 8 d, thoroughly wash the agar on the hairy roots under running water, perform the second root cutting, and transfer the hairy roots cut from the explants to 1 / 4 MS medium containing 2 mg / mL glufosinate for subculture to obtain hairy root plants, as Figure 2 shown.

[0074] 2. Verification of hairy root transformed plants

[0075] Extract the root DNA of the obtained hairy roots. Using this DNA as a template, design amplification primers with the sequences shown in SEQ ID NO.10 and SEQ ID NO.11;

[0076] SEQ ID NO.10: 5’-TGGACAATGAGGAAAACGAGGAC-3’;

[0077] SEQ ID NO.11: 5’-TCTGGGTGGTCTGGTTCTCTCTG-3’.

[0078] Use the amplification primers to amplify the root DNA of the hairy roots, and perform high-throughput sequencing on the amplification products to obtain the sequencing results.

[0079] 3. Sequencing results and analysis

[0080] Analyze the gene editing efficiency of the promoter and the plant mutation types based on the amplification results and sequencing results in step 2. The plant samples with obvious bands amplified are defined as positive seedlings, and the plants with sgRNA1 and / or sgRNA2 mutations found after sequencing are defined as mutant plants.

[0081] (1) Analysis results of the gene editing efficiency of the Arabidopsis thaliana AtU6 promoter and plant mutation types

[0082] The gene editing efficiency of the Arabidopsis thaliana AtU6 promoter is 69.7%. Among the 33 positive seedlings, 23 are mutated. The mutation types of the 23 mutant plants include single-base mutations, base deletions of 1bp - 6bp, and base insertions of 1bp; as shown in Table 2, 21 plants have sgRNA1 mutations and 11 plants have sgRNA2 mutations.

[0083] Table 2 Single-plant editing efficiency of AtU6

[0084]

[0085] (2) The editing efficiency results of the 16 Medicago sativa promoters selected are shown in Table 3.

[0086] Table 3 Editing efficiency of 16 promoters

[0087]

[0088] According to the results in Table 3, the editing efficiencies of the promoters MsU6-3, MsU6-20, and MsU6-38 all reach 100%. The high-throughput sequencing results of the promoters MsU6-3, MsU6-20, and MsU6-38 are analyzed as follows.

[0089] The high-throughput sequencing results of the MsU6-3 promoter are shown in Table 4. Among the 26 positive seedlings, the number of gene mutation strains is 26, and the mutation efficiency is 100%. Among them, the mutation types include single-base mutations, base deletions of 1 bp to 6 bp, and base insertions of 1 bp. There are 26 plants with mutations in sgRNA1 and 21 plants with mutations in sgRNA2.

[0090] Table 4 Single-plant editing efficiency of MsU6-3

[0091]

[0092] The high-throughput sequencing results of the MsU6-20 promoter are shown in Table 5. Among the 21 positive seedlings, the number of gene mutation strains is 21, and the mutation efficiency is 100%. Among them, the mutation types include single-base mutations, base deletions of 1 bp to 6 bp, and base insertions of 1 bp. There are 21 plants with mutations in sgRNA1 and 17 plants with mutations in sgRNA2.

[0093] Table 5 Single-plant editing efficiency of MsU6-20

[0094]

[0095] The high-throughput sequencing results of the MsU6-38 promoter are shown in Table 6. Among the 20 positive seedlings, the number of gene mutation strains is 20, and the mutation efficiency is 100%. Among them, the mutation types include single-base mutations, base deletions of 1 bp to 6 bp, and base insertions of 1 bp. There are 19 plants with mutations in sgRNA1 and 13 plants with mutations in sgRNA2.

[0096] Table 6 Single-plant editing efficiency of MsU6-38

[0097]

[0098] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they learn the basic creative concepts.

[0099] Obviously, those skilled in the art can make various changes and deformations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and deformations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these changes and deformations.

Claims

1. An alfalfa U6 promoter for improving gene editing efficiency, characterized in that, The alfalfa U6 promoter for improving gene editing efficiency is MsU6-3; the nucleotide sequence of MsU6-3 is shown in SEQ ID NO.

2.

2. Use of the alfalfa U6 promoter for improving gene editing efficiency according to claim 1 in improving the gene editing efficiency of the CRISPR / Cas9 system.

3. Use of the alfalfa U6 promoter for improving gene editing efficiency according to claim 1 in alfalfa trait improvement.

4. Use of the alfalfa U6 promoter for improving gene editing efficiency according to claim 1 in alfalfa gene function research.

5. Use of the alfalfa U6 promoter for improving gene editing efficiency according to claim 1 in alfalfa molecular breeding technology.

6. A gene editing vector, characterized in that, The gene editing vector carries the alfalfa U6 promoter MsU6-3 for improving gene editing efficiency according to claim 1.

7. A method for constructing the gene editing vector according to claim 6, characterized in that, The construction method comprises the following steps: Sequentially connecting the nucleotide sequence of the alfalfa U6 promoter MsU6-3 for improving gene editing efficiency with the sgRNA and gRNA scaffold nucleotide sequences of the gene to be edited to obtain a recombinant fragment; Connecting the recombinant fragment with an expression vector to obtain the gene editing vector.

8. The method for constructing a gene editing vector according to claim 7, wherein The expression vector is pRGEB31.

9. Use of the gene editing vector according to claim 6 in improving the gene editing efficiency of alfalfa.

10. Use of the gene editing vector according to claim 6 in improving the genetic transformation efficiency of alfalfa genes.

Citation Information

Patent Citations

  • Promoter and application thereof

    CN106434664A

  • Method for obtaining multifoliaolate alfalfa material by using MsPALM1 artificial site-directed mutant

    CN108949774A