5-HTR1 gene and application thereof in improving anxiety behavior of portunus trituberculatus

Abstract

The 5-HTR1 gene disclosed by the invention is characterized in that the 5-HTR1 gene is Pt5-HTR1, and the nucleotide sequence of the Pt5-HTR1 is as shown in SEQ ID NO: 1. According to the invention, the 5-HTR1 gene is cloned for the first time, the nucleotide sequence of the 5-HTR1 gene is obtained, the 5-HTR1 gene of the portunus trituberculatus is successfully positioned on the tissue of the portunus trituberculatus by using an in-situ hybridization technology according to the characteristics of the 5-HTR1 sequence, and related expression analysis is carried out; meanwhile, the expression difference of the 5-HTR1 gene in different tissues of the portunus trituberculatus under the starvation condition is analyzed, analysis and verification show that the 5-HT1 participates in the behavior mechanism of the portunus trituberculatus, the behavior and physiological adaptation strategy of the portunus trituberculatus can be disclosed, and the application prospect is wide. The method has a good application prospect in the aspects of screening out a new variety of warm portunus trituberculatus and improving the breeding survival rate of the portunus trituberculatus.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, and in particular to a 5-HTR1 gene of a swimming crab (Portunus trituberculatus) and an application thereof. Background Art

[0002] 5-HT is an inhibitory neurotransmitter widely distributed in the central and peripheral nerve tissues of crustaceans. It can indirectly regulate a variety of physiological effects and behaviors by affecting the synthesis and release of neurohormones in the neuroendocrine system. 5-HT receptors (5-HTR) are a type of transmembrane protein that binds to 5-HT on the cell membrane. Studies have found that 5-HT and its receptors play an extremely important role in the physiological processes of animals. 5-HT must bind to the corresponding receptors to exert its effect. Under the mediation of the corresponding receptors, it participates in regulating a variety of behaviors such as aggression, feeding, cognition, social hierarchy and emotional regulation.

[0003] The swimming crab (P. trituberculatus) is a major marine crab species in my country. It is aggressive by nature, and its fighting behavior has led to serious cannibalism within the species. Fighting causes crabs with broken limbs, which in turn affects the survival, growth and quality of the crabs and increases the cost of breeding. Current studies have shown that the fighting behavior of the swimming crab (P. trituberculatus) is related to the level of 5-HT. Under the induction of stressors, the swimming crab (P. trituberculatus) will undergo adaptive physiological changes, stimulate the release and conversion of 5-HT, and mediate the corresponding receptors to participate in regulating a series of behavioral manifestations such as stress, endocrine and emotional responses of animals. Abnormal 5-HT levels cause adaptive changes in the neurotransmitter-receptor signaling pathway and lead to brain dysfunction. It is closely related to the pathogenesis of anxiety disorders and is widely present in the brain areas related to mammalian anxiety.

[0004] At present, there are no reports on the function of 5-HT1 and its receptor 5-HTR1 in the swimming crab. Therefore, it is necessary to further study the behavioral mechanism of 5-HT1 in the swimming crab. Summary of the invention

[0005] The first technical problem to be solved by the present invention is to provide a 5-HTR1 gene in view of the above-mentioned current state of the art.

[0006] The second technical problem to be solved by the present invention is to provide an application of 5-HTR1 gene in view of the above-mentioned current technical status.

[0007] The technical solution adopted by the present invention to solve the first technical problem is: the 5-HTR1 gene is characterized in that: the 5-HTR1 gene is Pt5-HTR1, and the nucleotide sequence of the Pt5-HTR1 is shown in SEQ ID NO:1.

[0008] Furthermore, the amino acid sequence of the 5-HTR1 gene is shown in SEQ ID NO:2.

[0009] The present invention also provides a method for cloning the above-mentioned 5-HTR1 gene, characterized in that it comprises the following steps:

[0010] (1) Designing specific primers based on the transcriptome sequence information, using the cDNA of the swimming crab (P. trituberculatus) as a template, obtaining the expressed sequence tag (EST) of 5-HTR1 by PCR amplification, connecting the obtained EST fragment to the vector, cloning and sequencing;

[0011] (2) Based on the expressed sequence tag (EST) of 5-HTR1, 5-HTR1 3'RACE upstream primer and 5'RACE downstream primer were designed, and the 3' and 5' terminal fragments were obtained by rapid amplification of cDNA ends (RACE) using the first strand of RACE cDNA as a template. The obtained 3' and 5' terminal fragments were connected to the vector, cloned and sequenced;

[0012] (3) The 3' and 5' terminal fragments obtained by sequencing were spliced ​​with the EST sequence of 5-HTR1 to obtain the full-length cDNA sequence of 5-HTR1.

[0013] Furthermore, the nucleotide sequences of the upstream primer and the downstream primer of the EST sequence of 5-HTR1 are shown in SEQ ID NO:3 and SEQ ID NO:4:

[0014] SEQ ID NO: 3 is 5-HTR1-EST-F: CTTGCTTTGGACGCCTACGA;

[0015] SEQ ID NO:4 is 5-HTR1-EST-R:GGAGGTGAGTTGAGCTGGA.

[0016] Furthermore, the nucleotide sequences of the 3'RACE upstream primers of 5-HTR1 are shown in SEQ ID NO:5 and SEQ ID NO:6:

[0017] SEQ ID NO:5 is 5-HTR1-3'Race-F:CTATCAGGACGCAGCCAGTGCACCCAA;

[0018] SEQ ID NO:6 is 5-HTR1-3'Race-R:CTGGAAGAGGAAGGGTTACTTAC.

[0019] Furthermore, the nucleotide sequences of the 5'RACE downstream primers of 5-HTR1 are shown in SEQ ID NO:7 and SEQ ID NO:8:

[0020] SEQ ID NO:7 is 5-HTR1-5'Race-F:CTTGCTTTGGACGCCTACGA;

[0021] SEQ ID NO: 8 is 5-HTR1-5'Race-R: GGAGGTGAGTTGAGCTGGA.

[0022] Furthermore, the nucleotide sequences of the specific primers for the 5-HTR1 gene are shown in SEQ ID NO:9 and SEQ ID NO:10:

[0023] SEQ ID NO: 9 is 5-HTR1-F: CGCCGCCTTCATCAGTTTGC;

[0024] SEQ ID NO: 10 is 5-HTR1-R: GCCTGTGCCTTACGCTCCT.

[0025] The present invention also provides a method for preparing a probe, characterized in that it comprises the following steps:

[0026] 1) Designing primers and amplifying according to the Pt5-HTR1 described in claim 1;

[0027] 2) connecting the amplified product obtained in step 1) with the pSPT18 bidirectional transcription vector to construct a recombinant plasmid;

[0028] 3) Sequencing the plasmid in step 2), and after sequencing is correct, amplifying using SP6 promoter primers and T7 promoter primers, and performing in vitro transcription after ethanol precipitation to obtain sense and antisense probes.

[0029] Furthermore, the nucleotide sequences of the primers are shown in SEQ ID NO: 11 and SEQ ID NO: 12:

[0030] SEQ ID NO: 11 is the sequence of the forward primer: CTGAGCTTTGTGACATGTGGACTT;

[0031] SEQ ID NO: 12 is the sequence of the reverse primer: GATCTTCCAGTACAGGATGAGGAT.

[0032] The present invention also provides a detection method, characterized in that it comprises the following steps:

[0033] S1 reverse transcription: taking the Swimming crabs in a full state as the positive control group and the Swimming crabs to be tested as the test group, extracting total RNA from any one of the muscle, ganglion, and liver tissues of the positive control and the test object, respectively, and then reversely transcribing to obtain cDNA of the positive control and the test group;

[0034] S2 amplification signal detection: using RT-PCR technology to amplify the two groups of cDNA obtained in step S1, the forward primer used for amplification is 5-HTR1-F as described in claim 7, and the reverse primer is 5-HTR1-R as described in claim 7. After the amplification is completed, the fluorescence signal is collected and the relative expression level of 5-HTR1 in the positive control and the group to be detected is calculated;

[0035] S3 comparative analysis: The relative expression levels of 5-HTR1 in the positive control and the test group were analyzed for significance.

[0036] The present invention also provides the promoter of the 5-HTR1 gene, characterized in that: the 5-HTR1 gene is Pt5-HTR1, the nucleotide sequence of Pt5-HTR1 is shown in SEQ ID NO: 1, and the nucleotide sequence of the corresponding promoter is shown in SEQ ID NO: 13. To solve the second technical problem, the present invention also provides the application of the 5-HTR1 gene.

[0037] Compared with the prior art, the advantages of the present invention are: the present invention cloned the 5-HTR1 gene for the first time and obtained the nucleotide sequence of the 5-HTR1 gene, successfully located the 5-HTR1 gene of the swimming crab three-tuberculate on the swimming crab three-tuberculate tissue by using the in situ hybridization technology according to the 5-HTR1 sequence characteristics, and made relevant expression analysis, and at the same time analyzed the expression difference of the 5-HTR1 gene in different tissues of the swimming crab three-tuberculate under the condition of starvation, and the analysis and verification showed that 5-HT1 was involved in the behavioral mechanism of the swimming crab three-tuberculate, which was helpful to reveal the behavioral and physiological adaptation strategies of the swimming crab three-tuberculate, and had good application prospects in the development of new types of drugs such as anti-anxiety drugs and the refined breeding management of the swimming crab three-tuberculate. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 is the full-length cDNA sequence diagram of 5-HTR1 of Example 1 of the present invention;

[0039] Figure 2The phylogenetic tree of the amino acid sequences of 5-HTR1 of the swimming crab Pt3-Tuberculosis and other crustacean species (the phylogenetic tree of the amino acid sequences of 5-HTR1 of the swimming crab Pt3-Tuberculosis in Example 1 of the present invention) is shown in FIG. Figure 2 (marked with ▲ in Chinese);

[0040] Figure 3 The figure is a result of multiple sequence alignment of amino acids of Pt5-HTR1 of Swimming crab of Example 1 of the present invention; through multiple sequence alignment, it is found that the regions where 11 conserved transmembrane helical regions of Pt5-HTR1 of Swimming crab of three tubercles and 5-HTR1 of other species are located are marked with shadows;

[0041] Figures 4a to 4c The three-dimensional structure of the protein of the swimming crab of Example 1 of the present invention and the 5-HTR1 of Homo sapiens are compared before and after; wherein, Figure 4a This is the three-dimensional structure diagram of the protein of the swimming crab three tubercles; Figure 4b The three-dimensional structure diagram of Homo sapiens 5-HTR1; Figure 4c This is a rendering of the three-dimensional structure overlap between the protein of the swimming crab (Portunus trituberculatus) and the 5-HTR1 of Homo sapiens;

[0042] Figures 5a to 5d The result diagram of the in situ hybridization analysis of Example 2 of the present invention; wherein, Figure 5a The electrophoresis results of the sense probe and the antisense probe are shown in FIG. Figure 5b This is a fluorescence staining image of the muscle tissue of the swimming crab. Figure 5c This is a fluorescence staining image of the nerve tissue of the swimming crab. Figure 5d This is the result of sense probe hybridization. The blue color represents the DAPI staining result, i.e., the cell nucleus staining result, and the green color represents the antisense probe staining result, i.e., the 5-HTR1 gene localization result;

[0043] Figures 6a to 6s The result diagram of the cross maze test of Example 3 of the present invention; wherein, Figure 6a~6d , Figure 6g~6i , Figure 6l~6q The figure above is the trajectory diagram and the trajectory heat map, the figure below is the heat map; Figure 6e , 6f , 6j, 6k, 6r, and 6s are histograms comparing the residence time of the three-tuberculate swimming crab in the light arm; specifically, Figure 6a~6d The movement trajectories and trajectory heat maps are shown in the following table: full state, 1-day starvation (control group, recorded as CK), 2-day starvation, and 3-day starvation state. Figure 6e This is a bar chart comparing the proportion of time spent in the bare arm by the swimming crab in a full state and one-day hungry state. Figure 6f This is a bar chart comparing the percentage of time spent in the bare arm by the swimming crabs that were hungry for 1 day, 2 days, and 3 days. Figure 6g~6iThe movement trajectories and trajectory heat maps of 4 days of hunger, 5 days of hunger, and 6 days of hunger, respectively. Figure 6j This is a bar chart comparing the percentage of time spent in the bare arm by the swimming crabs that were starved for 1 day and 4 days. Figure 6k This is a bar chart comparing the percentage of time spent in the bare arm by the swimming crabs that were hungry for 1 day, 5 days, and 6 days. Figure 6l~6q The movement trajectories and trajectory heat maps of 7 days of hunger, 8 days of hunger, 9 days of hunger, 10 days of hunger, 11 days of hunger, and 12 days of hunger, respectively. Figure 6r This is a bar chart comparing the percentage of time spent in the bare arm by the swimming crabs that were hungry for 1 day, 7 days, and 8 days. Figure 6s This is a bar chart comparing the percentage of time spent in the bare arm by the swimming crabs starved for 1 day, 9 days, 10 days, 11 days, and 12 days (Note: ns means no significant difference between the groups; ** means the difference between the groups is statistically significant and P<0.01; *** means the difference between the groups is extremely significant and statistically significant and P<0.001);

[0044] Figures 7a to 7s This is a result diagram of the open field experiment of Example 3 of the present invention; wherein, Figures 7a to 7d , Figure 7g~7o The figure above is the trajectory diagram and the trajectory heat map, the figure below is the heat map; Figure 7e , 7f , 7p~7r are the comparative bar graphs of the residence time of the three-tuberculate swimming crab in the central area; Figure 7s Comparison of the total movement distance of the three-tuberculate swimming crabs in the CK group, the group starved for 11 days, and the group starved for 12 days; specifically, Figures 7a to 7d The movement trajectories and trajectory heat maps are shown in the following table: full state, 1-day starvation (control group, recorded as CK), 2-day starvation, and 3-day starvation state. Figure 7e This is a bar chart comparing the residence time of the swimming crab in the central area in a full state and one-day hungry state. Figure 7f This is a bar chart comparing the residence time of swimming crabs in the central area after being hungry for one day, two days, or three days. Figure 7g~7o The movement trajectories and trajectory heat maps of swimming crabs that have been hungry for 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, and 12 days, respectively. Figure 7p~7r The comparison bar graph of the residence time of the three-tuberculate swimming crab in the central area after being starved for 7 days, 8 days, 9 days, 10 days, 11 days and 12 days respectively (Note: * indicates that the difference between the groups is statistically significant and P<0.05; ** indicates that the difference between the groups is statistically significant and P<0.01; *** indicates that the difference between the groups is extremely significant and statistically significant and P<0.001);

[0045] Figure 8This is a line graph showing the change of 5-HT concentration in the hemolymph of the swimming crab (Panthera trituberculata) as a function of starvation time in Example 3 of the present invention;

[0046] Fig. 9 This is a statistical diagram of the difference in the expression results of 5-HTR1 in different tissues of the swimming crab (P. trituberculatus) after 5 days of starvation treatment in Example 4 of the present invention; * in the figure indicates significant difference between the groups and P<0.05;

[0047] Fig.10 This is a statistical diagram showing the difference between the expression results of 5-HTR1 in the muscle tissue of Swimming crabs after starvation treatment for 5 days in Example 4 of the present invention and the control group; * in the figure indicates that the difference between the groups is significant and P<0.05;

[0048] Fig.11 This is a statistical diagram showing the difference between the expression results of 5-HTR1 in the eyestalk of the swimming crab trituberculate after 5 days of starvation treatment in Example 4 of the present invention and the control group; **** in the figure indicates that the difference between the groups is significant and P<0.0001;

[0049] Fig.12 This is a statistical diagram showing the difference between the expression results of 5-HTR1 in the ganglion of the swimming crab (P. trituberculatus) after 5 days of starvation treatment in Example 4 of the present invention and the control group; * in the figure indicates that the difference between the groups is significant and P<0.05;

[0050] Fig.13 This is a statistical diagram showing the difference between the expression results of 5-HTR1 in the gills of the swimming crab P. trituberculatus after 5 days of starvation treatment in Example 4 of the present invention and the control group; ns in the figure indicates that the difference between the groups is not significant;

[0051] Fig.14 This is a graph showing the electrophoresis results of 5-HTR1 gene after restriction digestion and amplification in Example 6 of the present invention, wherein M is the band of DNA marker, and the bands obtained by corresponding restriction digestion of Dra I, EcoR V, Hpa I, Pvu II, Sma I, Ssp I, and Stu I;

[0052] Fig.15 This is a diagram of the sequencing results of the 5-HTR1 promoter of Example 6 of the present invention, wherein the box represents the linker sequence, the green represents the position of the 5-HTR1-R2 primer, and the blue and green areas represent the 5-UTR region;

[0053] Fig.16 The figure is the sequencing result of the 5-HTR2 promoter of Example 6 of the present invention, wherein the square represents the linker sequence, the green represents the position of the 5-HTR2-R2 primer, and the blue and green areas represent the 5-UTR region;

[0054] Fig.17 This is a diagram showing the sequence analysis results of the 5-HTR1 gene promoter of Example 6 of the present invention;

[0055] Fig.18 This is a diagram showing the analysis results of the 5-HTR2 gene promoter sequence in Example 6 of the present invention;

[0056] Fig.19 This is a bar graph comparing the relative luciferase activities of the pGL3-basic+PRL-TK group, 5HT1-pGL3+PRL-TK group and 5HT2-pGL3+PRL-TK group in Example 6 of the present invention, wherein *** indicates that the difference between the groups is extremely significant and statistically significant and P<0.001. DETAILED DESCRIPTION

[0057] The present invention is further described below with reference to the accompanying drawings, sequence tables and examples.

[0058] Example 1 Pt5-HTR1 cDNA sequence cloning method

[0059] The method for cloning the cDNA sequence of the swimming crab Pt5-HTR1 of the present invention

[0060] 1. The specific operations are as follows:

[0061] 1.1 Extraction of total RNA from Swimming crabs: The blue crab larvae were sampled and stored in a -80°C refrigerator. Total RNA was extracted with reagents, the concentration and purity of RNA were determined by spectrophotometer, and its integrity was checked by agarose gel electrophoresis. Then, the first strand of cDNA of Portunus trituberculatus was obtained by reverse transcription using M-MLV reverse transcriptase and Oligo dT primer.

[0062] 1.2 Acquisition of 5-HTR1 expressed sequence tag (EST) of Swimming crab trituberculatus: Specific primers were designed from the transcriptome sequencing data of Swimming crab trituberculatus, and PCR amplification was performed to obtain the cDNA core fragment of 5-HTR1. The PCR reaction system was 50 μL: 2.0 μL of cDNA template, 1.0 μL of upstream and downstream primers, PCR SuperMix 45 μL, ddH 2 O1.0μL. PCR reaction conditions are: 94℃ pre-denaturation for 2min; 94℃ denaturation for 30sec, 62℃ annealing for 30sec, 68℃ extension for 2min, 38 cycles. After PCR, 1.5% agarose gel electrophoresis was used for analysis. After gel excision and recovery, pGM-T vector was connected and transformed into high-efficiency chemical competent cells DH5α. Positive clones were selected and sent to the company for sequencing, and primers were used for bacterial liquid PCR to verify whether the fragments were correct and sequenced.

[0063] 1.3 3'RACE and 5'RACE synthesis: Based on the expressed sequence tag (EST) of 5-HTR1, PrimerPremier 6.0 software was used to design 3'RACE upstream primers and 5'RACE downstream primers. TM Kit for 3'RACE and 5'RACE synthesis. According to the manufacturer's instructions, the first round of PCR reaction was carried out with 5-HTR1-3'(5')Race-outer and 3(5')GeneRacer outer primer using the first strand of RACE cDNA as a template, and the reaction system was 25 μL. The PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃30 sec, 72℃30 sec, 5 cycles; 94℃30 sec, 70℃30 sec, 5 cycles; 94℃30 sec, 66℃30 sec, 25 cycles. Then, the second round of PCR reaction was carried out with 5-HTR1-3'(5')Race-inner and 3(5')GeneRacer inner primer using the first round of PCR product as a template, and the PCR reaction conditions were: 94℃ pre-denaturation for 2 min; 94℃30 sec, 66℃30 sec, 30 cycles. After PCR, 1.5% agarose gel electrophoresis was used for analysis. After gel excision and recovery, the pGM-T vector was connected and transformed into high-efficiency chemically competent cells DH5α. The positive clones were selected and sent to the company for sequencing. The primers were used for bacterial liquid PCR to verify whether the fragments were correct and sequenced.

[0064] 1.4 Sequencing: Full-length cDNA sequence of 5-HTR1 of Portunus trituberculatus: After removing the vector sequence, the 5-HTR1-3' and 5'RACE sequences obtained by sequencing were spliced ​​with the EST sequences using Vector NTISuite 7 software to obtain the full-length cDNA sequence of 5-HTR1, and specific primers were designed for the 5' and 3' non-coding regions for verification and sequencing.

[0065] The primer sequences are as follows:

[0066]

[0067] The results show: See Figure 1 The complete cDNA sequence representing 5-HTR1 was obtained by overlapping EST sequences and amplified fragments. The full length of the cDNA of Pt5-HTR1 of Portunus trituberculatus is 8512bp, of which the open reading frame (ORF) is 1761bp, the 5' untranslated region (UTR) is 1517bp, and the 3' untranslated region is 5234bp. The ORF encodes 586 amino acids, the predicted protein molecular weight is 63.90kDa, and the theoretical isoelectric point is 7.4. Figure 2 The deduced amino acids of Pt5-HTR1 showed similarity with 5-HTR7 from other crustacean species, and the tree topology was based on the CRD domain of 5-HTR1 and the CRD domains of other invertebrates and revealed the relationship between Pt5-HTR1 and other invertebrate 5-HTRs.

[0068] 2. Sequence Analysis

[0069] The sequences obtained by sequencing were subjected to BLAST comparison analysis ( http: / / www.ncbi.nlm.nih.gov / blast) The full-length sequence ORF was analyzed using the online ORF Finder website ( https: / / www.ncbi.nlm.nih.gov / orffinder / ) The amino acid sequence deduced from the cDNA sequence was analyzed using the ExPASy website ( http: / / www.expasy.org / tools / ) The analysis tools provided were used to analyze the primary sequence of proteins, such as physicochemical properties, hydrophilicity, etc. Signal peptide analysis was performed using the SignalP5.0 program ( http: / / www.cbs.dtu.dk / services / SignaIP / ) , the domains were analyzed using the SMART website ( http: / / smart.embl-heidelberg.de / ) Cluster X multiple sequence alignment software was used for homology analysis, and the phylogenetic tree was constructed using the neighbor-joining method (NJ) in the Mega software package. The three-dimensional structure was modeled using SWISS-MODEL software.

[0070] The results showed that the predicted protein molecular weight was 63.90 kDa, the theoretical isoelectric point was 7.45, and the peptide contained 586 amino acid residues. The 5-HTR1 protein had a conserved 5-HTR domain. SMART domain analysis predicted that Pt5-HTR7 had 7 conserved transmembrane helical regions. SignalP software analysis showed that there was no signal peptide in the sequence. The phylogenetic tree showed that the 5-HTR1 of vertebrates and invertebrates were clustered into one branch. Figure 2 , Pt5-HTR1 of Swimming crab is evolutionarily closer to that of Chinese mitten crab (Eriocheir sinensis), and is clustered with 5-HTR7 of other crustaceans. Figure 3 Homology analysis showed that the amino acid sequence identity between Pt5-HTR1 and 5-HTR7 of other species ranged from 32% to 90%, and was higher in crustaceans, at 78% to 90%. Figures 4a to 4c , using the three-dimensional structure of Homo sapiens 5-HTR1 protein as a template (PDB number: 4iar.1) to predict the Pt5-HTR1 of the swimming crab trituberculate, the predicted model is composed of 15 α helices through irregular coils, and the existing long α helices can be roughly divided into 7 segments, which just correspond to the predicted 7 transmembrane helical regions. In terms of structure, Figure 4a The three-dimensional structure of the protein predicted by the swimming crab Figure 4b The three-dimensional structure of Homo sapiens 5-HTR1 is very similar, and the overlap effect diagram is shown in Figure 4c , and is highly similar to the reported three-dimensional predicted structure of American lobster 5-HTR7 (PDB number: A0A1B3P5V7.1.A).

[0071] Example 2 Preparation of sense probes and antisense probes by in situ hybridization and their localization and distribution

[0072] In this embodiment, the Pt5-HTR1 gene is located and distributed in the cell, and the specific steps are as follows:

[0073] 1. Vector construction and in vitro transcription to prepare probes: The 5-HTR1 gene sequence of the swimming crab was analyzed using bioinformatics software. The 5-HT1 receptor gene of the swimming crab is Pt5-HTR1, and the nucleotide sequence of Pt5-HTR1 is shown in SEQ NO.1. The primer sequences were designed:

[0074] The nucleotide sequences of the forward primer and reverse primer of Pt5-HTR1 are as follows:

[0075]

[0076]

[0077] The above primers were used for amplification, and the amplified product was connected to the pSPT18 bidirectional transcription vector to construct a recombinant plasmid. After the plasmid sequencing was correct, SP6 promoter primers and T7 promoter primers were used for amplification, and in vitro transcription was performed after ethanol precipitation. Reaction conditions: 37°C, transcription for 3-4h, adding 5.0μl DNase I, 37°C, and treating for 15min. Purification: adding 1 / 10 LiCl (4M) and 2.5 times the volume of anhydrous ethanol, -20°C overnight, then centrifuging (13000g, 15min, 4°C), the precipitate was gently rinsed with 75% ethanol, centrifuged again, and 50μl DEPC-H2O was added for dissolution.

[0078] 2. Specific in situ hybridization process: Day 1: xylene dewaxing and gradient ethanol treatment until rehydration; 4% paraformaldehyde fixation at room temperature for 20 minutes; then PBS rinse 5 minutes × 2; add 3% H2O2 aqueous solution, treat at room temperature for 10 minutes, then PBS rinse 5 minutes × 2; proteinase K working solution (dissolved in T-PBS) (final concentration: 8μg / ml), treat at room temperature for 20 minutes; PBS rinse 5 minutes × 2; 4% paraformaldehyde fixation at room temperature for 10 minutes; PBS rinse 5 minutes × 2; 0.1M TEA, room temperature treatment for 10 minutes, PBS rinse 5 minutes × 2; after drying with lens paper, add Hybridization Buffer, put the slices in a wet box, and incubate at room temperature for 1 hour; preheat the hybridization solution to 95°C in a water bath, then add it to the hybridization solution according to the final concentration of RNA probe (0.1-0.2ng / μl), denature for 5 minutes, and then immediately put it on ice for 2 minutes; a certain volume of antisense RNA probe per slice in the wet box Buffer, cover with sealing film, react overnight in 55℃ hybridization buffer. (Hybridization Buffer containing sense RNA probe was added to the control slice). The next day: put the slices into preheated post-hybridization rinse buffer-I (2×SSC Buffer, 0.1% Tween-20, 50% formamide), put the dye tank into a 55℃ water bath, 30min×2; add post-hybridization rinse buffer-II (2×SSC Buffer, 0.1% Tween-20), put the dye tank into a 55℃ water bath, 20min×1; add post-hybridization rinse buffer-III (0.2×SSC Buffer, 0.1% Tween-20), adjust the water bath temperature to 60℃, 30min×2; put the slices into ISH Buffer-B1 (100mM Tris HCl, pH 7.4-7.5, 150mM NaCl), shake gently at room temperature, and rinse with PBS for 5min×2. Add in situ blocking solution ISH Buffer-B1 (containing 10% Goat Serum) and incubate at room temperature for 1 hour, shake dry, and do not rinse. Dilute Anti-Digoxigenin (Cat. No.: ab420) in the in situ blocking solution at 1 / 200 and incubate in a humidified box at 4°C overnight. Day 3: Place the slices in ISH Buffer-B1 and rinse at room temperature for 20 minutes × 3; donkey anti-mouse IgG H&L (Alexa Fluor 488) was diluted 1:500 in the in situ blocking solution, incubated at 37°C in a wet box for 30 min, and rinsed with T-PBS for 5 min × 3. DAB color development working solution was added, color was developed at room temperature for 3 min, and rinsed with T-PBS for 5 min × 3. FluorSaveTM Reagent was added to seal the slides, and the slides were photographed under an upright fluorescence microscope (×200).

[0079] 3. Analysis of experimental results: The results show that in the process of using in situ hybridization experiments, see Figure 5a According to the electrophoresis results, the in vitro transcription bands of the sense probe and antisense probe were clear and single; see Figure 5b~5d ,After hybridization, the antisense probe stained the tissue sections and showed obvious green fluorescence, ,indicating that the probe had resistance and good specificity.

[0080] Example 3 Exploration of the relationship between anxiety behavior and hunger time of swimming crabs

[0081] The purpose of this example is to prove that when hunger is used as a stress source, Swimming crabs will produce anxiety behavior. The stress source of the experiment is hunger, and the cross light-dark maze test and open field test are used to test the anxiety situation and determine the time stage of hunger anxiety formation. Then, the changes in the 5-HT concentration in the hemolymph of Swimming crabs under different hunger time stimulations are detected to verify the relationship between anxiety behavior and the 5-HT concentration in the hemolymph.

[0082] 1. Cross-maze test

[0083] 1.1 Experimental materials: The three-spotted swimming crab used in this embodiment is all taken from a certain breeding farm in Ningbo, Zhejiang Province. From the same family, a healthy, vigorous and disease-free male three-spotted swimming crab is selected for the test, with a mass of 16 ± 1g, a total of 720. All experimental crabs are temporarily raised in an aquarium, which is connected to a circulating water system and is separated and raised using a partition. During the temporary raising period, fresh clam meat is fed every day, and residues are removed after 3h. The amount of water change is 1 / 3. Water quality is tested every day during the breeding process, and the pH value is maintained between 8.0 ± 0.4, dissolved oxygen (DO) is maintained at 5.6mg / L, and the water temperature is maintained at 25.0 ± 1.0°C, and the salinity is 25 ± 1.0, with a photoperiod of 12D:12L; All experimental crabs are temporarily raised for more than one week to conduct experiments.

[0084] 1.2 Experimental equipment: infrared dot matrix camera (Hikvision), underwater cross maze (25 cm long × 25 cm wide × 10 cm high), constant temperature water bath, centrifuge (Eppendorf), pipette (Eppendorf), microplate reader (Thermo Fisher Scientific Inc), and lamp.

[0085] Among them, the light arm of the underwater cross maze is made of transparent acrylic plate, which is divided into a light arm part and a dark arm part. The light arm is illuminated by a lamp; the dark arm is covered with a layer of infrared polarizer to ensure that the dark arm can only transmit infrared light. The refractive index of visible light is more than 98%, which effectively eliminates the influence of external light on the dark arm. At the same time, it is compatible with the infrared dot matrix camera to ensure the stability and reliability of the experiment; the infrared diffuser light box and the infrared dot matrix camera are used together to effectively solve the problem that the dark environment and water ripples affect the capture of experimental objects; the difference in color under infrared light is used to identify and track individuals, and the dynamic silhouette method is used to select objects with a sampling frequency of 25 frames / second.

[0086] 1.3 Experimental steps:

[0087] The stress source of the experiment was starvation. The fasting time of the swimming crab was set to 0-12 days, with a total of 13 groups, 12 replicates in each group, and an interval of 24 hours between each group.

[0088] Before the experiment begins, the salinity of the experimental water is tested, and the experimental water is heated to keep it consistent with the aquaculture water. The oxygenation and lights are turned off to reduce the impact of all stress behaviors on the experiment.

[0089] After the implementation began, each swimming crab was carefully caught with a scoop net and placed in the rectangular area in the middle of the maze. The three crabs were separated by opaque cans with tiny holes to balance the water pressure inside and outside. The cans were removed after one minute, and the camera recorded the behavior of the three crabs for 10 minutes. After each experiment, the maze was flushed for 30 seconds to eliminate the impact on the experimental subjects below. Ethovision XT 12.0 software was used to record and analyze the total distance moved by the three crabs and the proportion of time spent in the bare arm.

[0090] After the experiment, the Noldus EthoVision XT 12.0 system was used to analyze and quantify the behavior video of the three-tuberculate swimming crab. The video recorded the proportion of time spent in the bare arm and the total distance moved in the underwater cross maze experiment. At the same time, the movement of the three-tuberculate swimming crab was visualized, and trajectory maps and heat maps were generated and analyzed to show the movement path and residence time of the three-tuberculate swimming crab.

[0091] 2. Open Field Experiment

[0092] The open field test is a test that is often used to detect whether animals have anxiety behavior. The anxiety behavior is manifested as an inability to stay idle in the central area and to move back and forth on the inner edge of the open field box, thus forming a regular movement trajectory, thereby identifying the animal's anxiety behavior.

[0093] 2.1 Experimental materials: Same as 1.1.

[0094] 2.2 Experimental equipment: infrared dot matrix camera (Hikvision), open field experimental box (30 cm long × 30 cm wide × 20 cm high), constant temperature water bath, centrifuge (Eppendorf), pipette (Eppendorf), and microplate reader (Thermo Fisher Scientific Inc).

[0095] 2.3 Experimental reagents: 5-HT (5-HT) enzyme-linked immunosorbent assay (ELISA) kit (Lianke Biotechnology).

[0096] 2.4 Experimental steps:

[0097] 2.4.1 Behavioral Experiment

[0098] The open field experiment used a cubic transparent acrylic open field box, and the camera was placed directly above the open field box. During the experiment, each group of experimental crabs was placed in the center of the bottom of the box. After 20 minutes of adaptation, the 30-minute video recording began. During the video recording, the experimenter stayed away from the experimental area. After each experiment, the inside of the box was cleaned to avoid affecting the next test. After the video recording, the video was analyzed using software to measure the moving distance and the central area residence time of each group of three-spotted swimming crabs within 30 minutes. After the experiment, samples were taken and stored.

[0099] 2.4.2 Determination of 5-HT concentration in hemolymph

[0100] After the experiment, the crabs were placed on ice for anesthesia, 0.5 mL of pre-cooled anticoagulant was pre-inhaled into a 1.5 mL EP tube, an equal amount of hemolymph was extracted from the base of the swimming feet and mixed, and then allowed to stand at 4 ° C, and then centrifuged (8000r / min, 4 ° C, 15min), and the supernatant was taken and stored at -80 ° C. A preliminary experiment was performed before the experiment, and the gradient concentration was set to determine the appropriate sample concentration and dilute the sample for the preparation of the gradient concentration standard diluent and sample diluent.

[0101] The 5-HT (5-HT) enzyme-linked immunosorbent assay (ELISA) kit was used to determine the 5-HT concentration in the hemolymph of the swimming crab trituberculatus by enzyme-linked immunosorbent competitive method. After the samples were collected, they were repeatedly frozen and thawed three times at -20℃, filtered through glass fiber and set aside. Three groups of standard wells, blank wells, and sample wells to be tested were set up. 50μl of a series of gradient concentrations of standard dilutions were added to each standard well using an ELISA plate. 40μl of sample dilutions were first added to the sample wells to be tested, and then 10μl of sample was added. 50μl of enzyme-labeled reagent was added to each well except the blank well. After adding, the plate was sealed and placed in a 37℃ water bath for 60min. After the incubation, the sealing film was removed and the liquid was discarded and dried. The washing solution diluted 30 times was filled and allowed to stand for 30s and then discarded. Repeat 5 times and then drained. When developing color, 50μl of color developer A was added first, and then 50μl of color developer B was added. The mixture was shaken and placed in a 37℃ constant temperature water bath away from light for 15min. Finally, 50 μl of stop solution was added and the absorbance was measured at a wavelength of 450 nm.

[0102] 2.5 Experimental results analysis:

[0103] 1) See Figures 6a to 6s The results of the underwater cross maze experiment showed that when hunger is used as a stress source, the three-tuberculate crab will produce anxious behavior, but as hunger continues, this behavior will be affected by many aspects and change. The movement trajectories and trajectory heat maps of the three-tuberculate crabs in different hunger time groups are distinguished according to the time stage, see Figure 6a , 6b 6e, the movement trajectory of the swimming crab showed that the swimming crab was in a state of significant anxiety due to excess energy in the body when it was full. After selecting the dark arm during the experimental period, it did not make any movement in the light arm, which was significantly different from the group that starved for one day (the group that starved for one day was used as the control group). Figure 6c , 6d , 6f, 6g-6k, as the starvation time increased, the time that the three-tuberculate crabs stayed in the bare arms gradually decreased until it was significantly different from the control group after 3 days of starvation and reached the minimum value after 4 days of starvation and remained stable for a period of time. At this time, the three-tuberculate crabs developed anxiety and were significantly different from the control group. During this period, the three-tuberculate crabs' motor ability did not change significantly. Figure 6l , 6m , 6r, while after 7 days of starvation, the three-tuberculate crabs regained their movement in the bare arms and recovered to the same level as the control group on the 8th day of starvation (no significant difference). This may be the result of energy allocation. Under extreme starvation, the three-tuberculate crabs' desire for food overcame their anxiety, and exploratory behavior became dominant. Figure 6n~6q , 6s. This behavior gradually disappeared after 9 days of starvation. The time spent in the bare arm decreased again and completely disappeared and tended to stabilize after 10 days of starvation.

[0104] 2) See Figures 7a to 7d 7g-7o are the movement trajectories and trajectory heat maps of the three-tuberculate swimming crab under starvation stress in the open field experiment. Figure 7a The open field experiment movement trajectory diagram and heat map combined show that the three-tuberculate crabs in the satiation group only swam in the peripheral area, showing an anxious state; see Figure 7e , after starvation for 1 day (control group), the activity time of the three-tuberculate crab in the central area increased, and there was a significant difference between the two; see Figure 7d , 7f , 7g~7i, the time of movement of the three-tuberculate crabs in the central area gradually decreased after 3-6 days of starvation, which was significantly different from the control group, indicating an anxious state. Figure 7g~7i It can be seen from the trajectory diagram that the three-spotted swimming crab has no movement trajectory in the central area when it is starved for 4 to 6 days, and the actual recorded movement time data in the central area is also 0. Therefore, there must be a significant difference between the three-spotted swimming crab when it is starved for 4 to 6 days and the CK group that is starved for one day. Therefore, in the open field test results of this embodiment, it is not necessary to make a comparative bar graph of the residence time of the three-spotted swimming crab in the central area when it is starved for 4 to 6 days and the CK group. Figure 7g~7i A significant difference can be observed from the CK group. Figures 7j~7s After 7 days of starvation, the movement tendency in the middle area increased and returned to normal levels on the 8th day. After 9 days of starvation, the movement tendency in the central area decreased and finally disappeared and stabilized after 10 days of starvation. The open field test and the underwater plus maze test showed the same results, proving the correctness and feasibility of the underwater plus maze.

[0105] 3) Results of 5-HT concentration in hemolymph: Figure 8 The 5-HT concentration in the hemolymph of Swimming crabs under different starvation times showed an opposite trend to the generation of anxiety, showing a trend of first increasing, then decreasing, then increasing, then decreasing, and finally stabilizing. During the period of anxiety-like generation, the 5-HT content in the hemolymph of Swimming crabs decreased significantly. With the release of the anxiety state, the 5-HT concentration increased significantly, and finally decreased to enter the anxiety state; this indicates that the generation of anxiety is affected by 5-HT and the 5-HT concentration decreases in the anxiety state. Among them, the trend of change during starvation for 4 to 6 days is relatively stable and lasts for a long time, so it can be used as a treatment parameter to allow Swimming crabs to stably enter the anxiety state.

[0106] Example 4 RT-PCR analysis of 5-HTR1 gene in different tissues of Portunus trituberculatus

[0107] The purpose of this example is to explore the tissues in which the 5-HTR1 gene expression can be detected under the anxious state and is significantly different from that in the normal swimming crab, so as to provide a basis for constructing a method for detecting whether the swimming crab has anxiety behavior.

[0108] One, experimental material: The swimming crab of the present embodiment is all taken from a certain farm in Ningbo, Zhejiang. From the same family, a healthy, vigorous and disease-free male swimming crab of the present embodiment is selected for testing, with a quality of 16 ± 1g, 720 in total. All experimental crabs are temporarily raised in an aquarium, and the aquarium is connected to a circulating water system and is raised using a partition. During the temporary raising period, fresh clam meat is fed every day, and residue is removed after 3h, and the amount of water change is 1 / 3. Water quality is detected every day during the breeding process, and the pH value is maintained between 8.0 ± 0.4, and dissolved oxygen (DO) is maintained at 5.6mg / L, and the water temperature is maintained at 25.0 ± 1.0°C, and the salinity is 25 ± 1.0, and the photoperiod is 12D:12L. All experimental crabs are temporarily raised for more than one week and tested.

[0109] 2. Experimental design: According to the anxiety formation time stage obtained from the anxiety experiment, 4 to 6 days, the middle number of 5 days was taken, and the hunger time of the anxiety group in this experiment was determined to be five days of hunger. Before the experiment, the salinity of the experimental water was tested, the experimental water was heated, and it was kept consistent with the aquaculture water. The oxygenation and lights were turned off to reduce the impact of all stress behaviors on the experiment. In order to study the effect of hunger stress on the expression of the 5-HTR1 gene, a blank control group and a starvation group were set up, each of which included three experimental crabs. Three crabs were collected from each group of the three-spotted swimming crabs in the experimental group after being starved for 5 days after being full, and their muscles, ganglia, eyestalks and gill tissues were collected, frozen in liquid nitrogen at -80℃, RNA was extracted, and then reverse transcribed to obtain cDNA. Three crabs were collected from each group of the three-spotted swimming crabs in the blank control group (CK) after being starved for 1 day after being full, and their muscles, ganglia, eyestalks and gill tissues were collected, frozen in liquid nitrogen, RNA was extracted, and then reverse transcribed to obtain cDNA.

[0110] The distribution of 5-HTR1 receptor in various tissues of P. trituberculatus was determined by quantitative RT-PCR assay using CFX384 multiplex real-time fluorescence quantitative PCR instrument (Bio-Rad, USA). Three experimental replicates and three biological replicates were performed. The primers 5-HTR1-F and 5-HTR1-R were used to amplify the 80 bp fragment of 5-HTR1 in both the experimental group and the blank control group; and P. trituberculatus GAPDH (Genebank Accession: JX268543.1) was used as an internal reference. The RT-PCR reaction system was 20 μL: SDW 8 μL, Power Green Master Mix 10μL, positive and negative primers (10uM) 0.5μL each, cDNA 1.0μL. Reaction conditions were 95℃, 1min, 95℃, 15sec, 63℃, 25sec, 40 cycles to collect fluorescence, melting point curve 55 to 95℃. The relative expression level of 5-HTR1 was calculated using the 2-ΔΔCt method;

[0111] The nucleotide sequences of primers 5-HTR1-F and 5-HTR1-R are as follows:

[0112]

[0113] All experiments were replicated at least three times independently and data are presented as mean ± standard deviation (SD). Statistical analysis of RNA expression data was performed using one-way ANOVA, and p < 0.05 was considered statistically significant.

[0114] 3. Analysis of experimental results: see Figures 9 to 13 The results showed that: RT-PCR analysis showed that Fig. 9 After 5 days of starvation, the expression of 5-HTR1 gene in muscle, eyestalk, ganglion and gill tissues of swimming crab showed a downward trend. This may be due to the adaptive physiological changes induced by stressors, which stimulated the expression of 5-HTR1 and then participated in regulating a series of behavioral manifestations such as stress, endocrine and emotional responses of animals. Figures 10 to 13 Under the condition of 5 days of starvation treatment, the expression level of 5-HTR1 gene in muscle, eyestalk and ganglion tissues was significantly different from that in the negative control group, but not in the gills; therefore, it can be concluded that by detecting the expression level of 5-HTR1 gene in any tissue of muscle, ganglion or liver of the swimming crab, it can reflect whether the swimming crab is in an anxious state, which provides a theoretical basis for the detection method of the anxiety state of the swimming crab.

[0115] Example 5 A method for detecting the anxiety state of swimming crab

[0116] The detection method of this embodiment mainly screens out the three-tuberculate swimming crabs with abnormal 5-HTR1 gene expression to avoid the phenomenon that the three-tuberculate swimming crabs at different stages become anxious and fight with each other.

[0117] The detection method of the present embodiment comprises the following steps:

[0118] S1 reverse transcription: using swimming crabs in a full state or starved for 4 to 6 days as a positive control group, or using swimming crabs starved for 1 day as a negative control group, and then using swimming crabs to be tested as a test group, extracting total RNA from any one of the muscle, ganglion, and liver tissues of the positive control and the test object, respectively, and then reversely transcribing to obtain cDNA of the positive control and the test group; the parameters of the positive control group and the negative control group are respectively selected from the parameters of the number of days of hunger in the anxious state and the non-anxious state in Example 3, wherein the number of days of hunger in the positive control group is preferably 5 days;

[0119] S2 amplification signal detection: the two groups of cDNA obtained in step S1 are amplified by RT-PCR technology, the forward primer used for amplification is 5-HTR1-F in Example 4, and the reverse primer is 5-HTR1-R in Example 4. After the amplification is completed, the fluorescence signal is collected and the relative expression level of 5-HTR1 in the positive control group or the negative control group and the group to be detected is calculated;

[0120] S3 comparative analysis: the relative expression levels of 5-HTR1 in the positive control group or negative control group and the group to be tested were analyzed for significance.

[0121] Among them, if the control group adopts a positive control group, then the three-tuberculate swimming crabs in the test group that have significant differences with the control group are in a non-anxious state, and those without significant differences are in an anxious state; if the control group adopts a negative control group, then the three-tuberculate swimming crabs in the test group that have significant differences with the control group are in a non-anxious state;

[0122] In addition, the method for detecting the anxiety state of the swimming crab of this embodiment can also be used to screen out new varieties of swimming crab with less aggressiveness, and to develop methods for improving the survival rate of swimming crab.

[0123] Example 6 Analysis of promoter activity of 5-HT1 and 5-HT2 receptor genes in Portunus trituberculatus

[0124] The purpose of this example is to obtain the promoter sequence of the 5-HT1 receptor gene (5-HTR1 gene) and compare it with the activity of the existing 5-HT2 receptor gene (5-HTR2 gene) promoter to explore whether the promoter of the 5-HTR1 gene is superior to the promoter of the 5-HTR2 gene in transcriptional activity.

[0125] 1. Cloning of promoter sequence of 5-HTR1 gene of Portunus trituberculatus

[0126] 1.1 Genomic DNA extraction

[0127] The genomic DNA was extracted using the QIAamp DNA Mini Kit (Qiagen catalog number: 51304). The specific steps are as follows:

[0128] 1) Material processing: Weigh 10-25 mg of tissue into a 1.5 ml centrifuge tube, cut into small pieces, and add 180 μl BufferATL;

[0129] 2) Enzyme treatment: Add 20 μl of Proteinase K solution, vortex to mix, and incubate in a 56°C water bath until the tissue is completely digested. Mix up and down every 20-30 minutes in the water bath;

[0130] 3) RNA degradation: add 5 μl RNase A, vortex for 15 seconds, and leave at room temperature for 5 minutes;

[0131] 4) Centrifugation and supernatant: Centrifuge (13000 rpm, 5 min), carefully pipette 80-90% of the supernatant into a 1.5 ml centrifuge tube;

[0132] 5) Add Buffer AL: Add 220 μl Buffer AL, vortex for 15 seconds, and place at 70°C for 10 minutes. The solution gradually becomes clear.

[0133] 6) Add ethanol: Add 200 μl of anhydrous ethanol and vortex for 15 seconds. Flocculent precipitation may appear at this time.

[0134] 7) Column loading and centrifugation: Transfer the mixed solution in step 5 to the QIAamp DNA Mini Spin Column, centrifuge (10,000 rpm, 30 sec), discard the filtrate, and place the Spin Column in a collection tube;

[0135] 8) First rinse: Add 500 μl AW1 to the Spin Column, centrifuge (10,000 rpm, 30 sec), and discard the filtrate;

[0136] 9) Second rinse: add 500 μl AW2 to the Spin Column, centrifuge (10,000 rpm, 30 sec), discard the filtrate, and perform step 9) twice;

[0137] 10) Idle: Centrifugation (10,000 rpm, 2 min);

[0138] 11) Elution: Move the Spin Column into a sterile 1.5 ml centrifuge tube, add 100-200 μl Buffer AE or deionized water (pH 7.0-8.5) to the center of the Spin Column, let stand at room temperature for 2-3 minutes, centrifuge (10,000 rpm, 2 minutes) to obtain genomic DNA, and store at -20°C for later use.

[0139] 1.2 Genomic DNA digestion and purification

[0140] 12) The total volume of the genomic DNA restriction enzyme reaction system is 100 μl, including 69.5 μl of sterile water, 10 μl of 10× Buffer, and 12.5 μl of genomic DNA. The above restriction enzyme reaction system is mixed with a pipette, centrifuged briefly, and incubated overnight in a 37°C water bath.

[0141] 13) Purification: Take 20 μl of the eluate in the QIAquick PCR Purification Kit (Qiagen, Catalog No.: 28104) to recover the digested genomic DNA.

[0142] 1.3 Restriction DNA and GenomeWalker adapter ligation

[0143] 14) The total volume of the adapter ligation reaction system is 8.0μl; including 4.8μl of digested genomic DNA; 1.9μl of GenomeWalker adapter (25uM); 0.8μl of 10×DNA ligase Buffer; 0.5μl of T4 DNA ligase (6U / μl); the above adapter ligation reaction system is mixed with a pipette, centrifuged briefly, and placed in a 16℃ water bath for ligation overnight. The next day, after taking the system out of the 16℃ water bath, place it in a 70℃ water bath for 10 minutes, then transfer it to a new 1.5ml centrifuge tube and add 30μl of TrisBuffer, and store it at -20℃ for later use.

[0144] 1.4 PCR amplification experiment

[0145] 15) 5-HTR1 genome walking primer design: The primer sequences are shown in the following table:

[0146]

[0147] The genomic PCR was performed using the Advantage 2 PCR Kit (Clontech Catalog No.: 639207) with the following protocol:

[0148] 16) The total volume of the first round of PCR amplification reaction system is 50 μl, including 42 μl of sterile deionized water, 5 μl of 10×Advantage 2PCR Buffer, 0.5 μl of dNTPs (10 mM), 0.5 μl of AP1 (10 uM), 0.5 μl of GSP-R1 (10 uM), 1 μl of template (product after adapter ligation), and 0.5 μl of Advantage 2Polymerase Mix. The reaction conditions are as follows: the parameters of the pre-denaturation stage are 94°C, 3 min, the parameters of the 7 cycles are 94°C, 25 sec, 72°C, 3 min, the parameters of the 32 cycles are 94°C, 25 sec, 67°C, 3 min, and the extension parameters are 67°C, 5 min, to obtain the first round of PCR products.

[0149] 17) The total volume of the second round PCR amplification reaction system is 50 μl, including 42 μl of sterile deionized water, 5 μl of 10×Advantage 2PCR Buffer, 0.5 μl of dNTPs (10 mM), 0.5 μl of AP2 (10 uM), 0.5 μl of GSP-R2 (10 uM), 1 μl of the first round PCR diluted product (diluted 50 times), and 0.5 μl of Advantage 2Polymerase Mix. The reaction conditions are as follows: the parameters of the pre-denaturation stage are 94°C, 3 min, the parameters of the 5 cycles are 94°C, 25 sec, 72°C, 3 min, the parameters of the 20 cycles are 94°C, 25 sec, 67°C, 3 min, and the extension parameters are 67°C, 5 min, to obtain the second round PCR product.

[0150] 18) Electrophoresis and sequencing

[0151] Take 10ul of the second round PCR product for electrophoresis analysis, find the single band with the largest molecular weight and perform gel excision and recovery. For the electrophoresis results, please refer to Fig.14 , connected to pLB Simple vector (Beijing Tiangen Biotechnology), transformed into high-efficiency chemical competent cells DH5α, and sent to Shanghai Biotechnology Co., Ltd. for sequencing. The sequencing results can be found in Fig.15 and SEQ ID NO:13.

[0152] 2. Cloning of promoter sequence of 5-HT2 receptor gene (5-HTR2) of Portunus trituberculatus

[0153] The method and steps are basically similar to those of “cloning the promoter sequence of the 5-HTR1 gene of Portunus trituberculatus”, except that the primer sequences for amplification are: 5-HTR2-R1: 5'CCGCCTTGAGGCATCACCACAAAGGT 3', 5-HTR2-R2: 5'CCTGGGACAAGCGTGCGTGGAT 3', and the sequencing results of the 5-HTR2 gene are obtained. For the sequencing results, please refer to Fig.16 .

[0154] 3. Analysis of promoter activity of 5-HTR1 and 5-HTR2 genes in Portunus trituberculatus

[0155] 3.1 Gene synthesis and vector construction: The customer provides plasmids 5HT1-pGL3 and 5HT2-pGL3 as the experimental group, pGL3-basic vector containing Firefly luciferase; pRL-TK plasmid locus containing Renilla luciferase as the control group; the concentration of 5HT1-pGL3 and 5HT2-pGL3 plasmids in the experimental group is prepared to be 0.100μg / μl.

[0156] 3.2 Plasmid transfection

[0157] 19) One day before transfection, cells were inoculated in a 24-well culture plate so that the cell density was 60-70% during transfection, and the culture medium was DMEM + 10% FBS;

[0158] 20) Add the plasmid to 50 μl serum-free DMEM medium (promoter + transcription factor: TK = 10:1 total plasmid concentration 4 ng / μl) and incubate at room temperature for 5 min. Add 2 μl lipo2000 transfection reagent to 50 μl serum-free DMEM medium, mix the two and incubate at room temperature for 15 min, and add serum-free DMEM medium to 500 μl.

[0159] 21) Aspirate the culture medium in the well, add 500 μl of the transfection complex prepared in the previous step, and culture at 37°C for 4-6 hours;

[0160] 22) Aspirate the culture medium, add 1 ml of complete culture medium, and culture at 37°C for 48 h;

[0161] 23) The transfection was repeated 5 times. There were three combinations of plasmid transfection, namely: pGL3-basic+PRL-TK, 5HT1-pGL3+PRL-TK, 5HT2-pGL3+PRL-TK. During transfection, the ratio of DNA: Lipofectamine 2000 was 1:1, and the cell density occupied about 60% of the culture plate.

[0162] 3.3 Dual luciferase assay

[0163] Experimental reagents: Dual luciferase reporter gene assay kit, Qiagen catalog number: R41128, the kit contains the following reagents: cell lysate, firefly luciferase buffer, firefly luciferase substrate (50×), Renilla luciferase buffer, Renilla luciferase substrate (50×);

[0164] The specific test methods are as follows:

[0165] 24) Lyse cells: Add 200 μl of cell lysis buffer to each well of a 24-well plate and incubate on ice for 5 min to fully lyse the cells;

[0166] 25) After sufficient lysis, collect the lysate, centrifuge at 10000 rpm for 5 min, and take the supernatant as the test solution;

[0167] 26) Dissolve firefly luciferase buffer and firefly luciferase substrate (50×), Renilla luciferase buffer, and Renilla luciferase substrate (50×) and bring to room temperature. Dilute to 1× working solution with the corresponding buffer and place in an ice bath for later use;

[0168] 27) Turn on the chemiluminescent immunoassay analyzer, take another 96-well plate, take 10-20 μl of the cell lysate supernatant and add it to the 96-well luminescent plate, then add 100 μl of firefly luciferase detection working solution, and shake the plate to mix;

[0169] 28) Measure the luminescence value at 350-700nm on the machine, and the detection time is 1 second;

[0170] 29) After completing the above firefly luciferase assay step, add 100 μl of Renilla luciferase assay working solution, shake the plate to mix, and measure the luminescence value at 350-700 nm on a spectrophotometer for 1 sec;

[0171] 30) When Renilla luciferase is used as an internal reference, the RLU value obtained by the firefly luciferase assay is divided by the RLU value obtained by the Renilla luciferase assay. The activation degree of the target reporter gene between different samples is compared based on the obtained ratio.

[0172] 3.4 Experimental Results Analysis

[0173] The analysis results of 5-HTR1 gene promoter sequence and 5-HTR2 gene promoter sequence can be found in Fig.17 and Fig.18 The results showed that in the 1533bp long 5-HTR1 gene promoter sequence, there were 12 CAAT-boxes, 8 TATA-boxes, one G-box, one Sp1 and one as-1. The site of Sp1 was located at -176 upstream of the translation start codon ATG. In the 1002bp long 5-HTR2 gene promoter sequence, there were 7 CAAT-boxes, 4 TATA-boxes, one E2Fb, one MYB-like sequence, one Sp1 and one as-1. In 5-HTR1, TATA 1, 2, 3, as-1 and G-box were outside 1002bp, which indicated that there were significantly more transcription factors on the 5-HTR1 gene promoter sequence than 5-HTR2.

[0174] For the comparison of relative luciferase activity, see Fig.19 The following conclusions were drawn: the fluorescence ratio of 293T cells transfected with 5HT1-pGL3+PRL-TK group was significantly higher than that of pGL3-basic+PRL-TK group; the fluorescence ratio of 293T cells transfected with 5HT2-pGL3+PRL-TK group was significantly higher than that of pGL3-basic+PRL-TK group. It can be concluded that the activity of the 5-HTR1 gene promoter of Swimming crabs in vitro is about 3 times higher than that of the 5-HTR2 gene promoter, indicating that the activity of the 5-HTR1 gene promoter of Swimming crabs in vitro is significantly stronger than that of the 5-HTR2 gene promoter, making the 5-HTR1 gene easier to transcribe and express.

[0175] The above-mentioned behavioral experiments also found that under the influence of external stimuli, such as hunger as a stress source, the swimming crab will produce anxious behavior. The 5-HTR1 receptor regulates various physiological processes by binding to 5-HT. The analysis of the differences in 5-HTR1 gene expression in different tissues of the swimming crab under hunger showed that 5-HT1 is involved in the behavioral mechanism of the swimming crab. At the same time, based on the fact that the activity of the 5-HTR1 gene promoter of the swimming crab is significantly stronger than that of the 5-HTR2 gene promoter, it will help to reveal the behavioral and physiological adaptation strategies of the swimming crab in the next step.

Claims

1. A 5-HTR1 gene, characterized in that : The 5-HTR1 gene is Pt5-HTR1, and the nucleotide sequence of Pt5-HTR1 is shown in SEQ ID NO:

1.

2. The 5-HTR1 gene according to claim 1, characterized in that :The amino acid sequence of the 5-HTR1 gene is shown in SEQ ID NO:

2.

3. A method for cloning the 5-HTR1 gene as claimed in claim 1, characterized in that : Includes the following steps: (1) Designing specific primers based on the transcriptome sequence information, using the cDNA of the swimming crab (P. trituberculatus) as a template, obtaining the expressed sequence tag (EST) of 5-HTR1 by PCR amplification, connecting the obtained EST fragment to the vector, cloning and sequencing; (2) Based on the expressed sequence tag (EST) of 5-HTR1, 5-HTR1 3'RACE upstream primer and 5'RACE downstream primer were designed, and the 3' and 5' terminal fragments were obtained by rapid amplification of cDNA ends (RACE) using the first strand of RACE cDNA as a template. The obtained 3' and 5' terminal fragments were connected to the vector, cloned and sequenced; (3) The 3' and 5' terminal fragments obtained by sequencing were spliced ​​with the EST sequence of 5-HTR1 to obtain the full-length cDNA sequence of 5-HTR1.

4. The method for cloning 5-HTR1 gene according to claim 3, characterized in that The nucleotide sequences of the upstream primer and the downstream primer of the EST sequence of 5-HTR1 are shown in SEQ ID NO:3 and SEQ ID NO:4: SEQ ID NO: 3 is 5-HTR1-EST-F: CTTGCTTTGGACGCCTACGA; SEQ ID NO:4 is 5-HTR1-EST-R:GGAGGTGAGTTGAGCTGGA.

5. The method for cloning 5-HTR1 gene according to claim 4, characterized in that : The nucleotide sequences of the 3'RACE upstream primers of 5-HTR1 are shown in SEQ ID NO:5 and SEQ ID NO:6: SEQ ID NO:5 is 5-HTR1-3'Race-F:CTATCAGGACGCAGCCAGTGCACCCAA; SEQ ID NO:6 is 5-HTR1-3'Race-R:CTGGAAGAGGAAGGGTTACTTAC; The nucleotide sequences of the 5'RACE downstream primers of 5-HTR1 are shown in SEQ ID NO:7 and SEQ ID NO:8: SEQ ID NO:7 is 5-HTR1-5'Race-F:CTTGCTTTGGACGCCTACGA; SEQ ID NO: 8 is 5-HTR1-5'Race-R: GGAGGTGAGTTGAGCTGGA.

6. The method for cloning 5-HTR1 gene according to claim 5, characterized in that The nucleotide sequences of the specific primers for the 5-HTR1 gene are shown in SEQ ID NO:9 and SEQ ID NO:10: SEQ ID NO: 9 is 5-HTR1-F: CGCCGCCTTCATCAGTTTGC; SEQ ID NO: 10 is 5-HTR1-R: GCCTGTGCCTTACGCTCCT.

7. A method for preparing a probe, characterized in that: The following steps are included: 1) Designing primers and amplifying according to the Pt5-HTR1 described in claim 1; 2) connecting the amplified product obtained in step 1) with the pSPT18 bidirectional transcription vector to construct a recombinant plasmid; 3) Sequencing the plasmid in step 2), and after sequencing is correct, amplifying using SP6 promoter primers and T7 promoter primers, and performing in vitro transcription after ethanol precipitation to obtain sense and antisense probes.

8. The method according to claim 7, characterized in that The nucleotide sequences of the primers are shown in SEQ ID NO:11 and SEQ ID NO:12: SEQ ID NO: 11 is the sequence of the forward primer: CTGAGCTTTGTGACATGTGGACTT; SEQ ID NO: 12 is the sequence of the reverse primer: GATCTTCCAGTACAGGATGAGGAT.

9. A detection method, characterized in that: The following steps are included: S1 reverse transcription: Swimming crabs in a full state or starved for 4 to 6 days were used as a positive control group, or swimming crabs starved for 1 day were used as a negative control group, and then the swimming crabs to be tested were used as the test group, and total RNA was extracted from any one of the muscle, ganglion, and liver tissues of the positive control and the test object, respectively, and then reverse transcribed to obtain cDNA of the positive control and the test group; S2 amplification signal detection: using RT-PCR technology to amplify the two groups of cDNA obtained in step S1, the forward primer used for amplification is 5-HTR1-F as described in claim 7, and the reverse primer is 5-HTR1-R as described in claim 7. After the amplification is completed, the fluorescence signal is collected and the relative expression level of 5-HTR1 in the positive control and the group to be detected is calculated; S3 comparative analysis: the relative expression levels of 5-HTR1 in the positive control group or negative control group and the group to be tested were analyzed for significance.

10. A promoter of a 5-HTR1 gene, characterized in that: The 5-HTR1 gene is Pt5-HTR1, the nucleotide sequence of Pt5-HTR1 is shown in SEQ ID NO:1, and the nucleotide sequence of the corresponding promoter is shown in SEQ ID NO:13.

Images