Application of cmcax5 gene in improving chilling tolerance of melon

Abstract

The application discloses application of a CmCAX5 gene in improving cold resistance of melon. After overexpression of the CmCAX5 gene in the melon, the cold resistance of melon seedlings is enhanced, and after silencing of the CmCAX5 gene, the cold resistance of the melon seedlings is reduced, which indicates that the gene can positively regulate the cold resistance of the melon seedlings in the seedling stage, is an important candidate gene in genetic improvement of the cold resistance of the melon, and has certain application value for cultivation of the cold-resistant melon variety.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to application of a CmCAX5 gene in improving cold tolerance of muskmelon. Background Art

[0002] Melon is an important economic crop, occupying a crucial position in global fruit production and consumption. Its nutritious, sweet, and delicious flavor make it a popular choice. Originating in tropical and subtropical regions, melons are thermophilic and heat-tolerant. Their optimum growth temperature for seedlings is 28-32°C, making them extremely cold-resistant. Currently, melon cultivation in my country primarily relies on a two-pronged planting system: early spring planting and late autumn planting. Early spring production in northern China is particularly susceptible to low temperatures, which slows the growth of melon seedlings, delays fruit set, and delays market launch, even impacting melon yield and quality. Currently, it's common for both greenhouse and open-field melons to be released simultaneously in spring and autumn, severely impacting the profitability of spring greenhouse cultivation. Currently, there is a lack of commercial melon varieties with strong cold tolerance on the Chinese market. Popular varieties such as Yangjiao Mi, Lubao, Huanghe Mi, Xizhou Mi, and Yugu are not highly cold-tolerant, making spring greenhouse production of melons often subject to significant risks.

[0003] Because melon cold tolerance is a quantitative trait regulated by multiple genes, and melon genetic transformation has problems such as low efficiency and long cycle, only a few melon cold tolerance genes have been located and discovered. 2+ As a second messenger, CAX (Ca) plays an important regulatory role in plant responses to various stresses. 2 / H + Antiporter) protein family that uses the H+ concentration across the membrane to mediate Ca 2+ transport, which is important for increasing bioavailable Ca 2+ At present, there are no reports on the regulation of cold tolerance by CAX family genes in melon.

[0004] The CmCAX5 gene, involved in the present invention, is a member of the CAX family. The CmCAX5 gene significantly up-regulated expression in cold-tolerant melon varieties (ZTG00581, ZTG00509, and ZTG01037) during early cold-induced responses, demonstrating rapid response to low temperatures. Transient overexpression and VIGS silencing experiments demonstrated that the CmCAX5 gene can positively regulate cold tolerance in melon seedlings. Therefore, the CmCAX5 gene has broad application prospects in genetically improving cold tolerance in melons. Summary of the Invention

[0005] The object of the present invention is to provide an application of the CmCAX5 gene in improving the cold tolerance of melon.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0007] The CmCAX5 gene used in the present invention has a CDS sequence as shown in SEQ ID NO.1, or is a derivative gene having equivalent functions by substitution, deletion and / or addition of one or more nucleotides of the nucleotide sequence as shown in SEQ ID NO.1.

[0008] The protein encoded by the above CmCAX5 gene is selected from:

[0009] (1) The amino acid sequence is shown in SEQ ID NO. 2;

[0010] (2) a protein derived from (1) which is obtained by substituting, deleting or adding one or more (e.g., 1-30; preferably 1-20; more preferably 1-10; such as 5, 3) amino acid residues of the amino acid sequence of SEQ ID NO. 2 and has the function of the protein of (1); or

[0011] (3) A protein derived from (1) that has 80% (preferably more than 90%, such as 95%, 98%, 99% or higher) homology with the protein sequence defined in (1) and has the function of the protein of (1).

[0012] That is to say, the functions of the genes protected by the present invention include not only the above-mentioned CmCAX5 gene, but also the functions of homologous genes with high homology to SEQID NO.1 (such as higher than 80%; better than 90%; better than 95%; better than 98%) in improving plant cold tolerance.

[0013] The nucleotide sequence of SEQ ID NO. 1, which is 1374 bp, is the CDS sequence, and the gene encodes a protein of 457 amino acids, the sequence of which is shown in SEQ ID NO. 2.

[0014] First, by analyzing the cold-induced expression level of the CmCAX5 gene in three cold-tolerant melon materials, ZTG00581, ZTG00509, and ZTG01037, the present invention found that CmCAX5 was significantly upregulated in the early stage of cold induction and responded quickly to low temperatures.

[0015] Secondly, the CmCAX5 gene was transiently overexpressed in the cold-sensitive melon material ZTG01056 by cotyledon injection, generating overexpressing plants. These CmCAX5-overexpressing plants (CmCAX5-OE) and negative control plants (CK) were then subjected to a 4°C cold treatment. Phenotypic differences in cold tolerance between the CmCAX5-overexpressing plants (CmCAX5-OE) and the negative control plants (CK) before and after the cold treatment were compared, confirming that CmCAX5 positively regulates cold tolerance in melon seedlings. Furthermore, the reliability of the phenotypic data was confirmed by extracting total RNA from leaves, reverse-transcribing cDNA, and analyzing CmCAX5 gene expression in CmCAX5-OE and CK plants using real-time fluorescence quantitative analysis.

[0016] Finally, the CmCAX5 gene was silenced in the cold-tolerant melon variety ZTG00969 using VIGS, resulting in a silenced plant (TRSV-CmCAX5). The negative control (TRSV) and the silenced plant (TRSV-CmCAX5) were subjected to a 4°C cold treatment. Phenotypic changes before and after the cold treatment were compared, and changes in leaf reactive oxygen species (ROS) were detected using NBT / DAB chemical staining. This confirmed that the CmCAX5 gene positively regulates cold tolerance in melon seedlings. Furthermore, real-time fluorescence quantitative analysis revealed that the expression of the CmCAX5 gene in the silenced plant was significantly reduced compared to the control plant.

[0017] Therefore, the primary purpose of the present invention is to provide the use of the aforementioned CmCAX5 gene, or a gene expression cassette, recombinant vector, recombinant microorganism, and transgenic plant cell line containing the CmCAX5 gene, for improving the cold tolerance of melon. Specifically, a CmCAX5 overexpression vector can be constructed to obtain cold-tolerant transgenic plants. The cold tolerance is manifested as follows: after cold treatment, seedlings of the CmCAX5 gene-overexpressing strain exhibit higher cold tolerance than the wild type, while seedlings of the CmCAX5 gene-silenced strain exhibit lower cold tolerance than the wild type. The cold treatment temperature is 4°C.

[0018] In practical applications, cold-tolerant plants can be obtained through genetic modification. Specifically, the CmCAX5 gene can be introduced into the target plant to obtain a transgenic plant, which has higher cold tolerance than the target plant.

[0019] Specifically, the CmEAF7 gene can be introduced into the target plant via the overexpression vector. In the method, the recombinant expression vector can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultivated into plants.

[0020] The present invention also provides a method for improving the cold tolerance of muskmelon, the method comprising:

[0021] (1) by increasing the activity of CmCAX5 protein in melon or increasing the content of CmCAX5 protein in melon;

[0022] (2) by promoting the expression of the CmCAX5 gene in melon;

[0023] Specifically, the expression of the CmCAX5 gene in melon is promoted by overexpression or superexpression.

[0024] In addition, the present invention also provides a plant breeding method, comprising:

[0025] (1) obtaining a plant with stronger cold tolerance than the target plant by increasing the activity of the CmCAX5 protein in the target plant or increasing the content of the CmCAX5 protein in the target plant;

[0026] (2) Promoting the expression of the CmCAX5 gene in target plants to obtain plants with stronger cold tolerance than the target plants;

[0027] (3) obtaining plants with weaker cold tolerance than the target plant by inhibiting or reducing the expression of the CmCAX5 gene in the target plant;

[0028] Specifically, the expression of the CmCAX5 gene in the target plant is promoted by overexpression or superexpression, and the expression of the CmCAX5 gene in the target plant is inhibited or reduced by silencing the CmCAX5 gene or knocking out CmCAX5.

[0029] The gene knockout includes knocking out the CmCAX5 using DNA homologous recombination technology, Cre / LoxP technology or CRISPR / Cas9 technology to obtain a transgenic plant line.

[0030] In the present invention, there are no particular limitations on the plants suitable for the present invention, as long as they are suitable for genetic transformation, such as various crops, flower plants, or forestry plants. Examples of such plants include (but are not limited to): dicots, monocots, woody plants, plants of the order Rosales, plants of the family Rosaceae, Prunus, peaches, cruciferous plants, Arabidopsis, and Arabidopsis thaliana.

[0031] As used herein, "plant" includes the entire plant, its parent and progeny plants, and various parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues, and organs, all of which contain the gene or nucleic acid of interest. "Plant" as used herein also includes plant cells, suspension cultures, callus, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores, each of which may contain the gene / nucleic acid of interest.

[0032] The present invention encompasses any plant cell, or any plant obtained or obtainable by any of the methods herein, as well as all plant parts and propagules thereof. Transfected cells, tissues, organs, or whole plants obtained by any of the aforementioned methods are also encompassed by this patent. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and that the progeny obtained using the methods described herein have the same characteristics.

[0033] Advantages of the present invention:

[0034] The present invention clones the melon CmCAX5 gene, constructs an overexpression vector, and then overexpresses the CmCAX5 gene in melons. The results show that the cold tolerance of melon seedlings is enhanced, while silencing the CmCAX5 gene reduces the cold tolerance of melon seedlings. This indicates that the gene can positively regulate the cold tolerance of melon seedlings, making it an important candidate gene for molecular breeding of cold tolerance in melons and having potential application value for genetic improvement of cold tolerance in melons. In practical applications, cold-tolerant melon plants can be obtained by introducing the CmCAX5 gene into target plants, providing a new method for molecular breeding of melons. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the electrophoresis diagram of PCR amplified CmCAX5 gene.

[0036] Figure 2 It is the cold-induced expression level of CmCAX5 gene in three cold-tolerant melon materials (ZTG00581, ZTG00509, and ZTG01037).

[0037] Figure 3 These are the phenotypes of CmCAX5 transient overexpression plants (CmCAX5-OE) and negative control plants (CK) in the cold-sensitive melon material ZTG01056 before and after cold treatment.

[0038] Figure 4 It is the expression level of CmCAX5 gene in CmCAX5 transient overexpression plants (CmCAX5-OE) and negative control plants (CK) in the cold-sensitive melon material ZTG01056.

[0039] Figure 5 These are the plant phenotypes of the CmCAX5 transiently silenced plants (TRSV-CmCAX5) and the negative control plants (TRSV) in the cold-tolerant melon material ZTG00969 before and after cold treatment.

[0040] Figure 6 These are the NBT / DAB staining results of the leaves of the CmCAX5 silenced plants (TRSV-CmCAX5) and the negative control plants (TRSV) in the cold-tolerant melon material ZTG00969 before and after cold treatment.

[0041] Figure 7It is the expression level of CmCAX5 gene in CmCAX5 silenced plants (TRSV-CmCAX5) and negative control plants (TRSV) in the cold-tolerant melon material ZTG00969. DETAILED DESCRIPTION

[0042] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.

[0043] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0045] As used herein, the terms "nucleic acid," "nucleic acid sequence," "nucleotide," "nucleic acid molecule," or "polynucleotide" are meant to include isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), natural types, mutant types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences in non-coding regions. These terms include a gene. "Gene" or "gene sequence" is widely used to refer to a functional DNA nucleic acid sequence. Thus, a gene may include introns and exons in a genomic sequence, and / or include coding sequences in a cDNA, and / or include cDNA and its regulatory sequences. In specific embodiments, such as with respect to isolated nucleic acid sequences, it is preferably assumed to be cDNA.

[0046] The cold-tolerant melon materials (ZTG00581, ZTG00509, ZTG01037, ZTG00969) and the cold-sensitive melon material ZTG01056 used in the present invention are all from the National Watermelon and Muskmelon Germplasm Medium-term Bank and are currently stored in Henan Agricultural University.

[0047] Example 1: Cloning of the melon CmCAX5 gene

[0048] The seeds of the cold-tolerant melon material ZTG00581 were soaked in 55°C warm water, germinated, and then sown in black culture pots, which were placed in an artificial climate incubator with 16h light / 8h darkness and day / night temperatures of 28 / 22°C. When the true leaves grew, the true leaves were extracted to obtain RNA (Code #ET101-01), which was then reverse transcribed into cDNA (Code #AUQ-01). The specific primer CmCAX5-F1

[0049] (ACGGGGGACTCTTGACCATGGTAATGGATGGATTTAGGAGTAACG, containing a vector linker), CmCAX5-R1

[0050] (AAGTTCTTCTCCTTTACTAGTTCATACACCAGGTTTTCGGGTTTTG, containing a vector linker) were designed. The CmCAX5 CDS full-length (1374bp) was amplified by PCR using the reverse-transcribed cDNA as a template, and the sequence is shown in SEQ ID NO. 1. The PCR product was electrophoresed on a 1% agarose gel, and the agarose gel electrophoresis map is shown in Figure 1 The target band was recovered using a Novizen DNA recovery and purification kit and stored at -20°C for subsequent construction of a vector.

[0051] Example 2: Cold-induced expression analysis of the CmCAX5 gene

[0052] (1) Cold treatment of the cold-tolerant melon materials (ZTG00581, ZTG00509, ZTG01037)

[0053] The seeds of the cold-tolerant melon materials (ZTG00581, ZTG00509, and ZTG01037) were soaked in 55°C warm water, germinated, and then sown in black culture pots, which were placed in an artificial climate incubator with 16h light / 8h darkness and day / night temperatures of 28 / 22°C. When they grew to three leaves and one heart, they were subjected to 4°C cold treatment, and the third true leaves were taken at 0h, 1h, 3h, 6h, 12h, and 24h, respectively. Then the samples were ground thoroughly using a low-temperature grinder and stored in a -80°C ultra-low temperature freezer.

[0054] (2) Design of the CmCAX5 gene fluorescent quantitative primer

[0055] The Q-CmCAX5-F: GTGGTGGTTCGCAGAAACTT; Q-CmCAX5-R: GAAGACCCAACCATGGTGAC) was designed by Primer5 software. Then the designed primers were respectively subjected to Blast in the Cucurbitaceae genome database, and the primers showed specificity and could be used in subsequent experiments.

[0056] (3) Fluorescent quantitative detection of CmCAX5 gene expression

[0057] The total RNA of the sample was extracted by the total RNA extraction kit (Code#ET101-01), and the reverse transcription and real-time fluorescent quantification were respectively performed by the total RNA reverse transcription and fluorescent quantification kit (Code#AUQ-01), and the primers Q-CmCAX5-F and Q-CmCAX5-R were used. The specific experimental operation was carried out according to the kit instruction manual.

[0058] The real-time fluorescent quantification results Figure 2 showed that the CmCAX5 gene in the three cold-resistant melon materials was significantly up-regulated in the early cold stress, indicating that the CmCAX5 gene rapidly responded to the cold stress and was up-regulated to enhance the cold resistance of the melon seedlings.

[0059] Example 3: Overexpression of CmCAX5 gene to improve the cold resistance of melon seedlings

[0060] (1) Construction of CmCAX5 gene overexpression vector

[0061] The pCAMBIA1302-GFP overexpression vector empty plasmid was subjected to double enzyme digestion by NcoI and SpeI restriction endonucleases, and the product was purified after enzyme digestion at 37°C for 2h. The 1371bp target fragment of the CmCAX5 gene without stop codon was subjected to homologous recombination with the linearized pCAMBIA1302-GFP vector fragment by the method of homologous recombination. The recombination product was transformed into the E. coli competent cell DH5α by the heat shock method, and after growing on the LB plate containing kanamycin for 12h, several single colonies were picked and cultured for expansion, and the positive detection was performed by using the universal primers 35s-F (ACGCACAATCCCACTATCCTTC) and 1302-R (CGTATGTTGCATCACCTTCAC) of the pCAMBIA1302-GFP vector. After the positive clone was sequenced without error, the plasmid was extracted, and further transformed into the Agrobacterium competent cell GV3101, and after growing on the LB plate containing kanamycin and rifampicin for 48h, the positive identification was performed by using 35s-F and 1302-R again. The pCAMBIA1302-CmCAX5 recombination bacterial liquid was preserved in 30% glycerol and stored at -80°C for standby use.

[0062] (2) Transient overexpression of CmCAX5 gene by injection into melon cotyledons

[0063] Seeds of the cold-sensitive melon material ZTG01056 were soaked in 55°C warm water, germinated, and sown in black pots. They were grown in a plant incubator with a 16-hour light / 8-hour dark daytime and a temperature of 28°C / 22°C. Cotyledon injection was performed when the cotyledons were flattened and true leaves had not yet grown (4-5 days after sowing).

[0064] 3-4 days in advance, the constructed pCAMBIA1302-CmCAX5 overexpression vector (CmCAX5-OE), pCAMBIA1302-GFP negative control (CK) and P19 Agrobacterium culture were streaked and activated on LB solid plates containing 100 mg / L kanamycin and 50 mg / L rifampicin. Then, single clones were picked and transferred to 5 mL of LB liquid containing 100 mg / L kanamycin and 50 mg / L rifampicin, and cultured overnight on a shaker at 28°C. Then, the culture was expanded on LB solid plates containing 100 mg / L kanamycin and 50 mg / L rifampicin at a ratio of 1:100 for bacterial liquid: water. After culturing in the dark at 28°C for 3 days, the bacteria were collected with MMA suspension (10 mM MES, 10 mMMgCl2 and 100 μM AS, 1 M KOH to adjust the pH to 5.6-6.0), and the bacterial liquid concentration was adjusted to OD 600 The overexpression and negative control resuspended cultures were then mixed with the P19 resuspended cultures at a 1:1 ratio and incubated in the dark at 28°C for 2-3 hours. After incubation, the cotyledons were injected with a 1mL syringe (without the needle) to completely fill the cotyledons with the culture solution. The cultures were then incubated in the dark at 22°C for 12-24 hours. The leaf surfaces were sprayed with water to prevent yellowing and wilting at the edges. The cultures were then transferred to an artificial climate chamber with 16 hours of light / 8 hours of darkness, a temperature of 22°C, and a humidity of 70%. After 2-3 days of incubation, the cultures were cold-treated at 4°C.

[0065] (3) Identification of the function of the CmCAX5 gene by cold treatment

[0066] CmCAX5-overexpressing (CmCAX5-OE) and negative control (CK) plants were cold-treated in a 4°C, 22,000 Lux climate incubator. Before the cold treatment, there was no significant phenotypic difference between CmCAX5-OE and CK plants. However, after 6 hours of cold treatment at 4°C, the two cotyledons of CK plants drooped significantly, while the two cotyledons of CmCAX5-OE plants remained unchanged compared to before the cold treatment. This indicates that the cold tolerance of CmCAX5-OE plants was significantly enhanced ( Figure 3 ).

[0067] (4) Determination of CmCAX5 gene expression

[0068] The cotyledons of CmCAX5 overexpression (CmCAX5-OE) and negative control (CK) plants were taken, total RNA of the samples was extracted with an RNA extraction solution, and then reverse transcription and real-time fluorescent quantitative PCR were performed, and the fluorescent quantitative primers were Q-CmCAX5-F, Q-CmCAX5-R. The specific experimental operation was carried out according to the corresponding kit instructions. The results of real-time fluorescent quantification showed that the expression of CmCAX5 overexpression plants was significantly higher than that of the negative control, indicating that CmCAX5 was overexpressed in the cotyledons of CmCAX5-OE, and the experimental results were reliable, that is, CmCAX5 gene positively regulated the cold tolerance of melon seedlings. Figure 4

[0069] Example 4 Silencing CmCAX5 gene reduces the cold tolerance of melon seedlings

[0070] (1) Construction of CmCAX5 gene VIGS vector

[0071] The TRSV2 vector and its auxiliary vector TRSV1 used in the VIGS experiment were both donated by Geng Chao of Shandong Agricultural University (Fanget al., 2021). The TRSV2 empty plasmid was purified after being digested with SnaBI for 2 h. The specific primers of CmCAX5 gene in the range of 300-500 bp were designed using NCBI online software:

[0072] CmCAX5-TRSV2-F:

[0073] TGTTTTAAATGCCTTTACGTATCCCAGTCGATGAGGTGGAT (including vector linker)

[0074] CmCAX5-TRSV2-R:

[0075] AACACACAAAACACCTACGTAATCCTGCAACATGAAGGCCA (including vector linker)

[0076] ​The above-mentioned specific primers were used to amplify a 434bp specific fragment of the CmCAX5 gene. The 434bp specific fragment of CmCAX5 was homologously recombined with the linearized TRSV2 vector fragment. The recombinant product was transferred into the Escherichia coli competent cell DH5α by the heat shock method. After growing on an LB plate containing kanamycin resistance for 12 hours, several single clones were picked for expansion culture. The TRSV2 vector universal primer TRSV-F (TGCGTCGCACTGAGGCA) and the CmCAX5 specific primer CmCAX5-TRSV2-R were used for positive detection. After the positive clones were sequenced correctly, the plasmid was extracted and further transferred into the Agrobacterium competent cell GV3101. After growing on an LB plate containing kanamycin and rifampicin resistance for 48 hours, the above-mentioned primers were used again for positive identification. The TRSV-CmCAX5 recombinant bacterial solution was stored in 30% glycerol and stored at -80°C for future use.

[0077] (2) Transient silencing of the CmCAX5 gene

[0078] On the first day, TRSV1, TRSV2 and TRSV-CmCAX5 Agrobacterium strains were spread on LB solid plates containing 100 mg / L kanamycin and 50 mg / L rifampicin at a ratio of 1:100 for bacterial solution: water for expansion culture. On the second day, the seeds of cold-resistant melon ZTG00969 were shelled, sterilized and placed in 1 / 2MS medium at 30°C for germination until the roots grew to about 1-2 cm. After the strains were cultured in the dark at 28°C for 3 days, the bacterial solution was resuspended with melon MMA suspension (a suspension of 4.43 g / L MS, 30 g / L sucrose, 1.25 mM MES and 100 μM AS), and the OD was adjusted. 600 The ratio of TRSV1 to TRSV2 and TRSV2-CmCAX5 was approximately 1.0. TRSV1 was mixed with TRSV2 and TRSV2-CmCAX5 in equal proportions and incubated in a 28°C incubator in the dark for 2-3 hours before subsequent vacuum inoculation. Melon seeds with roots 1-2 cm long were placed in 10 mL centrifuge tubes containing a resuspended bacterial suspension of TRSV1+TRSV2 or TRSV1+TRSV2-CmCAX5, respectively. A vacuum was applied at -0.9 MPa for 5 minutes to allow the bacterial suspension to penetrate the roots and cotyledons. After vacuum inoculation, the seeds were blotted dry with sterile filter paper and co-incubated at 25°C in the dark for 3-5 days (co-culture medium: 4.43 g / L MS, 30 g / L sucrose, 1.25 mM MES, 100 μM AS, and 8 g / L agar, pH 5.8). Finally, the seeds were transplanted into pots and cultured in an artificial climate chamber at 25°C with a 16-hour light (22,000 Lux) / 8-hour dark period.

[0079] (3) Identification of the function of the CmCAX5 gene by cold treatment

[0080] When the silenced plants and the control plants grew to 3-4 true leaves, they were cold-treated at 4°C. Before the cold treatment, there was no significant difference in the phenotype between the CmCAX5 silenced plants (TRSV-CmCAX5) and the negative control (TRSV). However, after 8 hours of cold treatment, the leaves of the CmCAX5 silenced plants wilted and drooped significantly, while the leaves of the negative control plants still performed well ( Figure 5 At the same time, take the second true leaf for NBT / DAB chemical staining ( Figure 6 ) and measured reactive oxygen species (ROS) levels in CmCAX5-silenced plants (TRSV-CmCAX5) and negative controls (TRSV) before and after cold treatment. The results showed that leaves of CmCAX5-silenced plants (TRSV-CmCAX5) were more severely damaged after cold treatment, accumulating more ROS than the negative control. In conclusion, silencing the CmCAX5 gene reduces cold tolerance in melon seedlings.

[0081] (4) Detection of CmCAX5 gene expression in silenced plants

[0082] The third true leaf of the CmCAX5-silenced plant (TRSV-CmCAX5) and the negative control (TRSV) was taken to extract total RNA from the samples, and then reverse transcription and real-time fluorescence quantification were performed. The fluorescence quantitative primers were Q-CmCAX5-F and Q-CmCAX5-R. The specific experimental procedures were carried out according to the instructions of the corresponding kit.

[0083] Real-time fluorescence quantitative results showed that the expression level of CmCAX5 in CmCAX5 silenced plants (TRSV-CmCAX5) was significantly lower than that in the negative control (TRSV) ( Figure 7 ), indicating that the CmCAX5 gene was successfully silenced in the CmCAX5-silenced plants. The results of this experiment are reliable, that is, the CmCAX5 gene positively regulates the cold tolerance of melon seedlings.

[0084] Sequence of SEQ ID NO.1:

[0085]

[0086] Sequence of SEQ ID NO.2:

[0087]

Claims

1. Overexpression CmCAX5 The application of the gene in improving the cold tolerance of melon is characterized in that: described CmCAX5 The CDS sequence of the gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that By building CmCAX5 Overexpression vector was used to obtain cold-tolerant transgenic plants.

3. The use according to claim 2, characterized in that The cold resistance performance is: after cold treatment, CmCAX5 The seedlings of the gene overexpression line were more cold-tolerant than those of the wild type. CmCAX5 The cold tolerance of seedlings of the gene-silenced line was lower than that of the wild type.

4. The use according to claim 3, characterized in that The temperature of the cold treatment is 4°C.

5. Contains CmCAX5 The application of a gene expression cassette, a recombinant vector, a recombinant microorganism, and a transgenic plant cell line in improving the cold tolerance of melon is characterized in that: described CmCAX5 The CDS sequence of the gene is shown in SEQ ID NO.

1.

6. A method for improving cold tolerance of melon, characterized in that: The method comprises: By increasing the activity of CmCAX5 protein in melon or increasing the content of CmCAX5 protein in melon; By promoting CmCAX5 Gene expression; The amino acid sequence of the CmCAX5 protein is shown in SEQ ID NO.

2. CmCAX5 The CDS sequence of the gene is shown in SEQ ID NO.

1.

7. The method for improving cold tolerance of melon according to claim 6, characterized in that: Promote melon CmCAX5 The gene is expressed in a manner of overexpression or overexpression.

8. A plant breeding method, characterized in that: The method comprises: (1) By increasing the activity of CmCAX5 protein in the target plant or increasing the content of CmCAX5 protein in the target plant, a plant with stronger cold tolerance than the target plant is obtained; (2) By promoting the growth of target plants CmCAX5 Gene expression is used to obtain plants with stronger cold tolerance than the target plant; (3) By inhibiting or reducing the CmCAX5 Gene expression is used to obtain plants with lower cold tolerance than the target plant; The amino acid sequence of the CmCAX5 protein is shown in SEQ ID NO.

2. CmCAX5 The CDS sequence of the gene is shown in SEQ ID NO. 1, and the target plant is melon.

9. The plant breeding method according to claim 8, characterized in that Promote the growth of target plants CmCAX5 The gene expression mode is overexpression or superexpression, which inhibits or reduces the expression of the target plant. CmCAX5 Gene expression is silenced CmCAX5 Gene.

Images