Polynucleotides for treating phenylketonuria

By optimizing the codon encoding the PAH protein and using AAV vector delivery technology, PAH protein expression was improved, solving the problem of PKU being incurable and achieving significant therapeutic effects.

CN119876192BActive Publication Date: 2025-11-07ZHEJIANG UNIV BINJIANG RES INST +2
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411746383.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2024-07-02
Filing Date
2024-11-29
Publication Date
2025-11-07
Estimated Expiration
2044-11-29

AI Technical Summary

Technical Problem

Current treatments for phenylketonuria (PKU) are incurable and primarily manage symptoms through diet. They are ineffective in increasing phenylalanine hydroxylase (PAH) activity, leading to intellectual disability and other serious medical problems.

Method used

We provide codon-optimized polynucleotides encoding PAH proteins, which bind to liver-specific promoters and introns, and deliver them to the liver using an AAV vector to increase PAH protein expression levels and achieve gene therapy.

Benefits of technology

It significantly increases PAH protein expression, corrects phenylalanine levels in the blood and brain, restores normal physiological function, and improves PKU symptoms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present disclosure provides codon-optimized polynucleotides encoding the liver enzyme phenylalanine hydroxylase, and also provides expression cassettes, vectors, viral particles, or compositions containing the disclosed polynucleotides. In addition, methods and uses of these polynucleotides, expression cassettes, vectors, viral particles, or compositions are provided, including the treatment of diseases or disorders associated with PAH.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Priority

[0002] This application claims the benefit of and priority to application number 2024108845103. Filed on July 2, 2024. The contents of these applications are incorporated herein by reference in their entirety for all purposes. TECHNICAL FIELD

[0003] The present disclosure belongs to the field of biomedicine, and in particular relates to a codon-optimized polynucleotide encoding a PAH protein, as well as an expression cassette, a vector, a viral particle and a composition comprising the polynucleotide, and use in the preparation of a gene therapy for treating a disease. BACKGROUND

[0004] Phenylketonuria (PKU) is an autosomal recessive metabolic disorder characterized by mutations in the gene for the liver enzyme phenylalanine hydroxylase (PAH), rendering the gene nonfunctional. PAH is necessary for the metabolism of the amino acid phenylalanine (Phe) to the amino acid tyrosine. When PAH activity is reduced, phenylalanine accumulates and is converted to phenylpyruvate (also known as phenylketone). If left untreated, PKU can lead to mental retardation, seizures, and other serious medical problems. Currently, there is no cure for this disease, and the standard of care is dietary management, trying to minimize foods containing large amounts of protein. SUMMARY

[0005] In one aspect, the present disclosure provides a polynucleotide encoding a liver enzyme phenylalanine hydroxylase, which is set forth in SEQ ID NO: 1 or SEQ ID NO: 5.

[0006] In another aspect, the present disclosure provides an expression cassette comprising the polynucleotide as described above.

[0007] In some embodiments, the expression cassette further comprises a promoter and / or an intron.

[0008] In some embodiments, the promoter is selected from SEQ ID NO: 2.

[0009] In some embodiments, the intron is selected from SEQ ID NO: 3.

[0010] In some embodiments, the expression cassette is set forth in SEQ ID NO: 4.

[0011] In another aspect, the present disclosure provides a vector comprising the polynucleotide or the expression cassette as described above.

[0012] In some embodiments, the vector is a viral vector.

[0013] In some embodiments, the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, or a lentivirus vector.

[0014] In another aspect, the disclosure provides an AAV particle comprising the vector and the capsid protein as previously described.

[0015] In some embodiments, the AAV is selected from serotypes 1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, rh10, or hu37.

[0016] In another aspect, the disclosure provides a composition comprising the polynucleotide, the expression cassette, the vector, or the AAV particle as previously described, and a pharmaceutically acceptable excipient.

[0017] In another aspect, the disclosure provides use of the polynucleotide, the expression cassette, the vector, the AAV particle, or the composition as previously described in the manufacture of a medicament for treating or alleviating a disease or a disorder in a subject.

[0018] In some embodiments, the disease or disorder is a liver enzyme phenylalanine hydroxylase related disease.

[0019] In some embodiments, the liver enzyme phenylalanine hydroxylase related disease is phenylketonuria (PKU).

[0020] Beneficial effects

[0021] The disclosure provides a codon-optimized polynucleotide encoding a PAH protein, which significantly improves the expression level of the PAH protein, while providing a gene expression cassette containing a liver-specific promoter and an intron, achieving a significant therapeutic effect for PAH related diseases. BRIEF DESCRIPTION OF DRAWINGS

[0022] The disclosure can be more fully understood with reference to the following drawings.

[0023] Figure 1 Codon-optimized DNA sequences encoding human PAH protein were shown to improve protein expression levels in vitro. (A) The intensity of specific protein bands was quantitatively analyzed using Image J, and the protein level expressed by codon-optimized PAH (co PAH) was significantly higher than that of wild-type PAH; (B) Vehicle was a control containing only medium, and the Western-blot results also showed that Huh7 cells had weak endogenous PAH expression. Values are expressed as mean ± SEM; p < 0.01, unpaired Student’s t-test.

[0024] Figure 2(A) PAH gene expression schematic is shown. ITR: truncated AAV2 ITR sequence, HCR1: truncated hepatic control region-1, hAAT: truncated human alpha 1 -antitrypsin promoter, Intron: human beta-globin / immunoglobulin hybrid intron, hPAH: codon-optimized human phenylalanine hydroxylase coding sequence, bGH: bovine growth hormone poly A tailing signal sequence; (B) Purity of AAV capsid proteins analyzed using SDS-PAGE; (C) Integrity analysis of the genome of AAV5-PAH after purification, 1-3 are 3 replicates.

[0025] Figure 3 (A) PAH gene expression schematic is shown. Pah enu2 Plasma levels of phenylalanine (Phe) in mice after four doses (vg / kg, n=3 / group) of vehicle or AAV5-hPAH (containing sequence SEQ ID NO: 4) via tail vein administration at different time points (1 week to 24 weeks).

[0026] Figure 4 (A) PAH gene expression schematic is shown. Pah enu2 Cortical levels of phenylalanine (A), 5-hydroxytryptophan (B), 5-hydroxyindoleacetic acid (C), kynurenine (D), tryptophan (E), and serotonin (F) in mice after 8 weeks of vehicle or AAV5-hPAH (containing sequence SEQ ID NO: 4) via tail vein administration (n=5 / group). WT, wild-type C57BL / 6. Homo: homozygous Pah enu2 Values are expressed as mean ± SEM; p < 0.05, p < 0.01, p < 0.001, p < 0.0001; Mann-Whitney U-test.

[0027] Figure 5 (A) PAH gene expression schematic is shown. Pah enu2 DNA and hPAH expression levels in the liver of mice after AAV5-hPAH via tail vein administration. Adult male Pah enu2Mice were analyzed for AAV genome (VG) DNA copies (A), hPAH mRNA levels (C), and hPAH protein levels (E) at 1 week (n=5 / dose), 8 weeks (n=5 / dose), and 26 weeks (n=3 / dose) after intravenous tail vein administration of AAV5-hPAH (containing sequence SEQ ID NO: 4) at doses of 6E12 vg / kg and 2E13 vg / kg. Adult female Pah enu2 Mice were analyzed for AAV genome (VG) DNA copies (B), hPAH mRNA levels (D), and hPAH protein levels (F) at 1 week (n=5 / dose), 8 weeks (n=5 / dose), and 26 weeks (n=3 / dose) after intravenous tail vein administration of AAV5-hPAH (containing sequence SEQ ID NO: 4) at doses of 2E13 vg / kg and 6E13 vg / kg. Values are mean ± SEM; p<0.05, p<0.01, p<0.001, p<0.0001; unpaired Student’s t-test.

[0028] Figure 6 Codon-optimized DNA sequences encoding human PAH protein were shown to improve protein expression levels in vitro. (A) Western-blot detection was performed using a chemiluminescence imaging system (Hangzhou Shenghua Science and Technology, SHST Capture Mini), and the protein expression level of codon-optimized PAH coding sequence PAHcol in HepG2 cells was significantly higher than that of wild-type PAHwt and codon-optimized PAHco2; (B) The density of the specific protein band of interest was quantitatively analyzed using SHST Analysis software, and the relative expression amount of PAH protein was corrected using GAPDH. Values are mean ± SEM; p<0.05, p<0.01, p<0.001, One-way ANOVA, Tukey’s multiple comparisonstest. DETAILED DESCRIPTION

[0029] The following description of the disclosure is merely intended to illustrate various embodiments of the disclosure. Thus, the particular modifications discussed should not be construed as limiting the scope of the disclosure. It is apparent to those skilled in the art that various equivalents, changes and modifications can be made without departing from the scope of the disclosure, and it should be understood that such equivalent embodiments are included within the present disclosure. All references cited herein, including publications, patents and patent applications, are incorporated herein by reference in their entirety.

[0030] Unless otherwise apparent to one of ordinary skill in the art, the terms "nucleotide" and "polynucleotide" are used interchangeably herein and refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double- or multi- stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases, substantially consisting of or consisting of said bases. In some embodiments, the polynucleotides described in the present disclosure comprise the sequence set forth in SEQ ID NO: 1.

[0031] The term "promoter" as used herein means a control sequence that is a region of a polynucleotide sequence at which initiation and rate of transcription of a coding sequence, e.g., a gene or transgene, is controlled. The promoter can be constitutive, inducible, repressible, or tissue-specific. In some embodiments, the promoter is used with the polynucleotides described herein to increase transcription efficiency. In some embodiments, the promoter described herein is a liver-specific promoter, and in some embodiments, the promoter described herein is a truncated human alpha 1 -antitrypsin promoter. In some embodiments, the promoter described in the present disclosure is selected from SEQ ID NO: 2.

[0032] The term "intron" as used herein means a non-coding segment of DNA. The intron of the present disclosure refers to a human beta-globulin / immunoglobulin hybrid intron, and in some embodiments, the intron described in the present disclosure is selected from SEQ ID NO: 3.

[0033] The term "vector" as used herein refers to a nucleic acid comprising, consisting essentially of, or consisting of a complete replicon or terminal inverted repeat sequences, such that it can be maintained and / or replicated when placed within a cell, for example, by a transfection, infection or transformation process. It is understood in the art that once inside a cell, the vector can be maintained and / or replicated as an extrachromosomal (episomal) element, or can integrate into the host cell chromosome. The vector can include nucleic acid derived from a retrovirus, adenovirus, herpesvirus, baculovirus, modified baculovirus, papillomavirus, AAV viral vector, lentivirus vector, adenoviral vector, alphavirus vector, and the like, preferably, the vector described herein is selected from an AAV vector, adenoviral vector, or lentivirus vector.

[0034] The term "adeno-associated virus" or "AAV" as used herein refers to a member of the class of viruses associated with that name and belonging to the Dependovirus genus of the Parvoviridae family. Adeno-associated virus is a single-stranded DNA virus that grows only in cells, with certain functions provided by a co-infected helper virus. All AAV serotypes exhibit significant homology in their terminal inverted terminal repeat (ITR) sequences repGenetically mediated very similar replication properties; and all carry three related capsid proteins. At least 13 naturally occurring AAV serotypes are known in the art, ordered serotype 1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or variant serotypes such as AAV-DJ and AAV PHP.B. AAV particles comprise, consist essentially of, or consist of three major viral proteins VP1, VP2, and VP3. In embodiments, the AAV comprises AAV capsid proteins selected from the group consisting of AAV PHP.B, AAVrh74, AAV 110, AAV 204, AAV 214, AAV 214A, AAV 214e, AAV 214e8, AAV 214e9, AAV 214el0, AAV ITB102_45, and AAV 214AB. In embodiments, AAV refers to any one of serotypes AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, or AAV13, AAVrh10, AAVhu37, or an AAV serotype isolated from human and non-human mammals, or variants thereof. In embodiments, AAV particles comprise AAV selected from the group consisting of AAV1, AAV2, AAV2G9, AAV3, AAV3a, AAV3b, AAV3-3, AAV4, AAV4-4, AAV5, AAV6, AAV6.1, AAV6.2, AAV6.1.2, AAV7, AAV7.2, AAV8, AAV9, AAV9.11, AAV9.13, AAV9.16, AAV9.24, AAV9.45, AAV9.47, AAV9.61, AAV9.68, AAV9.84, AAV9.9, AAV10, AAV11, AAV12, AAV16.3, AAV24.1, AAV27.3, AAV42.12, AAV42-1b, AAV42-2, AAV42-3a, AAV42-3b, AAV42-4, AAV42-5a, AAV42-5b, AAV42-6b, AAV42-8, AAV42-10, AAV42-11, AAV42-12, AAV42-13, AAV42-15, AAV42-aa, AAV43-1, AAV43-12, AAV43-20, AAV43-21, AAV43-23, AAV43-25, AAV43-5, AAV44.1, AAV44.2, AAV44.5, AAV223.1, AAV223.2, AAV223.4, AAV223.5, AAV223.6,AAV223.7, AAV1-7 / rh.48, AAV1-8 / rh.49, AAV2-15 / rh.62, AAV2-3 / rh.61, AAV2-4 / rh.50, AAV2-5 / rh.51, AAV3.1 / hu.6, AAV3.1 / hu.9, AAV3-9 / rh.52, AAV3-11 / rh.53, AAV4-8 / r11.64, AAV4-9 / rh.54, AAV4-19 / rh.55, AAV5-3 / rh.57, AAV5-22 / rh.58, AAV7.3 / hu.7, AAV16.8 / hu.10, AAV16.12 / hu.11, AAV29.3 / bb.1, AAV29.5 / bb.2, AAV106.1 / hu.37, AAV114.3 / hu.40, AAV127.2 / hu.41, AAV127.5 / hu.42, AAV128.3 / hu.44, AAV130.4 / hu.48, AAV145.1 / hu.53, AAV145.5 / hu.54, AAV145.6 / hu.55, AAV161.10 / hu.60, AAV161.6 / hu.61, AAV33.12 / hu.17, AAV33.4 / hu.15, AAV33.8 / hu.16, AAV52 / hu.19, AAV52.1 / hu.20, AAV58.2 / hu.25, AAV A3.3, AAV A3.4, AAV A3.5, AAV A3.7, AAV C1, AAV C2, AAV C5, AAV-DJ, AAV-DJ8, AAV F3, AAV F5, AAV H2, AAV rh.72, AAV hu.8, AAV rh.68, AAV rh.70, AAV pi.1, AAV pi.3, AAV pi.2, AAV rh.60, AAV rh.44, AAV rh.65, AAV rh.55, AAV rh.47, AAV rh.69, AAV rh.45, AAV rh.59, AAV hu.12, AAV H6, AAV LK03, AAV H-1 / hu.1, AAV H-5 / hu.3, AAV LG-10 / rh.40, AAV LG-4 / rh.38, AAV LG-9 / hu.39, AAV N721-8 / rh.43, AAV Ch.5, AAV Ch.5R1, AAV cy.2, AAV cy.3, AAV cy.4, AAV cy.5, AAV Cy.5R1, AAV Cy.5R2, AAV Cy.5R3, AAV Cy.5R4, AAV cy.6, AAV hu.1, AAV hu.2, AAV hu.3, AAV hu.4, AAV hu.5, AAV hu.6, AAV hu.7,AAVhu.9, AAVhu.10, AAVhu.11, AAVhu.13, AAVhu.15, AAVhu.16, AAVhu.17, AAVhu.18, AAVhu.20, AAVhu.21, AAVhu.22, AAVhu.23.2, AAVhu.24, AAVhu.25, AAVhu.27, AAVhu.28, AAVhu.29, AAVhu.29R, AAVhu.31, AAVhu.32, AAVhu.34, AAVhu.35, AAVhu.37, AAVhu.39, AAVhu.40, AAVhu.41, AAVhu.42, AAVhu.43, AAVhu.44, AAVhu.44R1, AAVhu.44R2, AAVhu.44R3, AAVhu.45, AAVhu.46, AAVhu.47, AAVhu.48, AAVhu.48R1, AAVhu.48R2, AAVhu.48R3, AAVhu.49, AAVhu.51, AAVhu.52, AAVhu.54, AAVhu.55, AAVhu.56, AAVhu.57, AAVhu.58, AAVhu.60, AAVhu.61, AAVhu.63, AAVhu.64, AAVhu.66, AAVhu.67, AAVhu.14 / 9, AAVhu.t 19, AAVrh.2, AAVrh.2R, AAVrh.8, AAVrh.8R, AAVrh.10, AAVrh.12, AAVrh.13, AAVrh.13R, AAVrh.14, AAVrh.17, AAVrh.18, AAVrh.19, AAVrh.20, AAVrh.21, AAVrh.22, AAVrh.23, AAVrh.24, AAVrh.25, AAVrh.31, AAVrh.32, AAVrh.33, AAVrh.34, AAVrh.35, AAVrh.36, AAVrh.37, AAVrh.37R2, AAVrh.38, AAVrh.39, AAVrh.40, AAVrh.46, AAVrh.48, AAVrh.48.1, AAVrh.48.1.2, AAVrh.48.2, AAVrh.49, AAVrh.51, AAVrh.52, AAVrh.53, AAVrh.54, AAVrh.56, AAVrh.57, AAVrh.58, AAVrh.61, AAVrh.64, AAVrh.64R1, AAVrh.64R2, AAVrh.67, AAVrh.73, AAVrh.74, AAVrh8R, AAVrh8R A586R mutant,AAVrh8R R533A mutant, AAAAAV, BAAV, goat AAV, bovine AAV, AAVhE1.1, AAVhEr1.5, AAVhER1.14, AAVhEr1.8, AAVhEr1.16, AAVhEr1.18, AAVhEr1.35, AAVhEr1.7, AAVhEr1.36, AAVhEr2.29, AAVhEr2.4, AAVhEr2.16, AAVhEr2.30, AAVhEr2.31, AAVhEr2.36, AAVhER1.23, AAVhEr3.1, AAV2.5T, AAV-PAEC, AAV-LK01, AAV-LK02, AAV-LK03, AAV-LK04, AAV-LK05, AAV-LK06, AAV-LK07, AAV-LK08, AAV-LK09, AAV-LK10, AAV-LK11, AAV-LK12, AAV-LK13, AAV-LK14, AAV-LK15, AAV-LK16, AAV-LK17, AAV-LK18, AAV-LK19, AAV-PAEC2, AAV-PAEC4, AAV-PAEC6, AAV-PAEC7, AAV-PAEC8, AAV-PAEC11, AAV-PAEC12, AAV-2-pre-miRNA-101, AAV-8h, AAV-8b, AAV-h, AAV-b, AAV SM 10-2, AAV Shuffle 100-1, AAV Shuffle 100-3, AAV Shuffle 100-7, AAV Shuffle 10-2, AAV Shuffle 10-6, AAV Shuffle 10-8, AAV Shuffle 100-2, AAV SM 10-1, AAV SM 10-8, AAV SM 100-3, AAV SM 100-10, BNP61 AAV, BNP62 AAV, BNP63 AAV, AAVrh.50, AAVrh.43, AAVrh.62, AAVrh.48, AAVhu.19, AAVhu.11, AAVhu.53, AAV4-8 / rh.64, AAVLG-9 / hu.39, AAV54.5 / hu.23, AAV54.2 / hu.22, AAV54.7 / hu.24, AAV54.1 / hu.21, AAV54.4R / hu.27, AAV46.2 / hu.28, AAV46.6 / hu.29, AAV128.1 / hu.43, true type AAV (ttAAV), UPENN AAV 10, Japanese AAV 10 serotype, AAV CBr-7.1,AAV CBr-7.10, AAV CBr-7.2, AAV CBr-7.3, AAV CBr-7.4, AAV CBr-7.5, AAV CBr-7.7, AAV CBr-7.8, AAV CBr-B7.3, AAV CBr-B7.4, AAV CBr-E1, AAV CBr-E2, AAV CBr-E3, AAV CBr-E4, AAV CBr-E5, AAV CBr-e5, AAV CBr-E6, AAV CBr-E7, AAV CBr-E8, AAV CHt-1, AAV CHt-2, AAV CHt-3, AAV CHt-6.1, AAV CHt-6.10, AAV CHt-6.5, AAV CHt-6.6, AAV CHt-6.7, AAV CHt-6.8, AAV CHt-P1, AAV CHt-P2, AAV CHt-P5, AAV CHt-P6, AAV CHt-P8, AAV CHt-P9, AAV CKd-1, AAV CKd-10, AAV CKd-2, AAV CKd-3, AAV CKd-4, AAV CKd-6, AAV CKd-7, AAV CKd-8, AAV CKd-B1, AAV CKd-B2, AAV CKd-B3, AAV CKd-B4, AAV CKd-B5, AAV CKd-B6, AAV CKd-B7, AAV CKd-B8, AAV CKd-H1, AAV CKd-H2, AAV CKd-H3, AAV CKd-H4, AAV CKd-H5, AAV CKd-H6, AAV CKd-N3, AAV CKd-N4, AAV CKd-N9, AAV CLg-F1, AAV CLg-F2, AAV CLg-F3, AAV CLg-F4, AAV CLg-F5, AAV CLg-F6, AAV CLg-F7, AAV CLg-F8, AAV CLv-1, AAV CLv1-1, AAV Clv1-10, AAV CLv1-2, AAV CLv-12, AAV CLv1-3, AAV CLv-13, AAV CLv1-4, AAV Clv1-7, AAV Clv1-8, AAV Clv1-9, AAV CLv-2, AAV CLv-3, AAV CLv-4, AAV CLv-6, AAV CLv-8, AAV CLv-D1, AAV CLv-D2, AAV CLv-D3, AAV CLv-D4, AAV CLv-D5, AAV CLv-D6, AAV CLv-D7, AAV CLv-D8, AAV CLv-E1,AAV CLv-K1, AAV CLv-K3, AAV CLv-K6, AAV CLv-L4, AAV CLv-L5, AAV CLv-L6, AAV CLv-M1, AAV CLv-M11, AAV CLv-M2, AAV CLv-M5, AAV CLv-M6, AAV CLv-M7, AAV CLv-M8, AAV CLv-M9, AAV CLv-R1, AAV CLv-R2, AAV CLv-R3, AAV CLv-R4, AAV CLv-R5, AAV CLv-R6, AAV CLv-R7, AAV CLv-R8, AAV CLv-R9, AAV CSp-1, AAV CSp-10, AAV CSp-11, AAV CSp-2, AAV CSp-3, AAV CSp-4, AAV CSp-6, AAV CSp-7, AAV CSp-8, AAV CSp-8.10, AAV CSp-8.2, AAV CSp-8.4, AAV CSp-8.5, AAV CSp-8.6, AAV CSp-8.7, AAV CSp-8.8, AAV CSp-8.9, AAV CSp-9, AAV.hu.48R3, AAV.VR-355, AAV3B, AAV4, AAV5, AAVF1 / HSC1, AAVF11 / HSC11, AAVF12 / HSC12, AAVF13 / HSC13, AAVF14 / HSC14, AAVF15 / HSC15, AAVF16 / HSC16, AAVF17 / HSC17, AAVF2 / HSC2, AAVF3 / HSC3, AAVF4 / HSC4, AAVF5 / HSC5, AAVF6 / HSC6, AAVF7 / HSC7, AAVF8 / HSC8, AAVF9 / HSC9, AAV-PHP.B (PHP.B), AAV-PHP.A (PHP.A), G2B-26, G2B-13, TH1.1-32, TH1.1-35, AAVPHP.B2, AAVPHP.B3, AAVPHP.N / PHP.B-DGT, AAVPHP.B-EST, AAVPHP.B-GGT, AAVPHP.B-ATP, AAVPHP.B-ATT-T, AAVPHP.B-DGT-T, AAVPHP.B-GGT-T, AAVPHP.B-SGS, AAVPHP.B-AQP, AAVPHP.B-QQP, AAVPHP.B-SNP (3), AAVPHP.B-SNP, AAVPHP.B-QGT, AAVPHP.B-NQT, AAVPHP.B-EGS, AAVPHP.B-SGN,AAVPHP.B-EGT, AAVPHP.B-DST, AAVPHP.B-DST, AAVPHP.B-STP, AAVPHP.B- PQP, AAVPHP.B-SQP, AAVPHP.B-QLP, AAVPHP.B-TMP, AAVPHP.B-TTP, AAVPHP.S / G2A12, AAVG2A15 / G2A3, AAVG2B4, AAVG2B5, and variants thereof.

[0035] As used herein, the term "subject" includes any human or non-human animal. The term "non-human animal" includes all vertebrates, e.g., mammals and non-mammals, e.g., non-human primates, sheep, dogs, cats, horses, cows, chickens, rats, mice, amphibians, reptiles, etc. The terms "patient" or "subject" are used interchangeably unless otherwise indicated. In the present disclosure, the preferred subject is a human.

[0036] As used herein, the term "treatment" means the administration of an effective amount of a polynucleotide, nucleic acid construct, vector, AAV particle, or pharmaceutical composition according to the present disclosure to a subject such that the subject has a reduction of at least one symptom of the disease or an improvement of the disease, e.g., a beneficial or desired clinical outcome. For purposes of the present disclosure, beneficial or desired clinical results include, but are not limited to, alleviation of one or more symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Treatment can refer to prolonging survival as compared to expected survival in the absence of treatment. Thus, one skilled in the art realizes that treatment can improve a disease state, but can not be a complete cure for the disease. As used herein, the term "treatment" includes prevention. Alternatively, treatment is "effective" if it results in a decrease in the rate of disease progression, or a halt in disease progression. "Treatment" can also mean prolonging survival as compared to expected survival in the absence of treatment. Patients in need of treatment in some embodiments include patients who have been diagnosed with a metal ion related disorder. Patients in need of treatment in some embodiments include patients who have been diagnosed with a disorder of hepatolenticular degeneration, and who can develop such a disorder due to genetic predisposition or other factors.

[0037] Examples

[0038] In order to make the persons skilled in the art have a better understanding of the present disclosure scheme, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present disclosure, rather than all the embodiments.

[0039] Example 1: Construction of AAV Plasmids

[0040] Wild type PAH sequence (SEQ ID NO: 6), codon-optimized DNA sequence 1 encoding hPAH (SEQ ID NO: 1) and codon-optimized DNA sequence 2 encoding PAH (SEQ ID NO: 9) were cloned with promoter (SEQ ID NO: 2) and intron (SEQ ID NO: 3) into AAV2 containing mutant ITR (SEQ ID NO: 7), full ITR (SEQ ID NO: 8) and kanamycin resistance gene plasmid backbone, respectively, to construct 3 plasmids: plasmid PAHwt, plasmid PAHcol and plasmid PAHco2. Then the 3 plasmid DNA were transfected into HepG2 cells, respectively, and the protein level of PAH was compared by Western-blot analysis.

[0041] Table 3. Sequence information

[0042]

[0043] Example 2: Codon-optimized DNA sequence encoding human PAH protein improves protein expression level in vitro

[0044] Huh7 cells (Meilunbio, PWE-HU045) cultured overnight in 6-well cell plates were transfected with plasmid DNA containing wild type (wt) and codon-optimized (co) human PAH (SEQ ID NO: 1) gene expression frame (1000 ng / well, n=4 / group), about 48 hours later, the cells were lysed, centrifuged at 4°C and 12000 rpm for 15 min, the supernatant was taken, the total protein concentration was determined by Biophotometer (Eppendorf), a certain volume of sample was mixed in loading buffer, denatured at 98°C for 5 min, and loaded onto a 10% polyacrylamide gel. After SDS-PAGE, transfer to nitrocellulose membrane, add 5% skim milk powder in TBST, room temperature for about 1 hour, then add anti-human PAH specific antibody (Sigma, HPA028407) and anti-GAPDH antibody (ABclonal, AC002) at 4°C overnight, wash 3 times with TBST, then add HRP-conjugated secondary antibody at room temperature for about 1 hour, wash 3 times with TBST, then the membrane is treated with UltraSignal ECL (4AW011, 4ABiotech) to complete the Western-blot analysis, the endogenous protein GAPDH of Huh7 cells is used for correction Figure 1A). The intensity of specific protein bands was quantitatively analyzed by Image J. The results showed that the protein level of codon-optimized PAH (co PAH) was significantly higher than that of wild-type PAH (wt PAH). Figure 1 B). Western-blot results also showed that Huh7 cells had weak endogenous PAH expression compared with the control group containing only medium (Vehicle).

[0045] HepG2 cells (Chinese Academy of Sciences, item number SCSP-510) cultured overnight in 6-well cell plates were transfected with plasmid DNA containing wild-type (wt) and codon-optimized (co) human PAH gene expression frames (1500 ng / well, n=3 / group) using Lipofectamine 3000, with untransfected (NT) cells serving as negative controls. About 48 hours later, the cells were lysed with RIPA buffer, centrifuged at 4°C and 12000 rpm for 15 min, and the supernatant was used to determine the total protein concentration. 10 μg of sample was mixed with loading buffer, denatured at 98°C for 5 min, and loaded onto a 4-12% NuPAGE Bis-Tris gel. After SDS-PAGE, the proteins were transferred to a PVDF membrane, 5% skim milk powder was added to TBST, and the mixture was incubated at room temperature for about 1 hour. Then, anti-PAH specific antibody (Sigma, HPA028407, diluted 1000 times) and anti-GAPDH antibody (Cell Signaling Technology, Lot: 97166, diluted 2000 times) diluted with 5% BSA in TBST buffer were added and incubated at 4°C overnight. After washing with TBST for 3 times, HRP-conjugated secondary antibody (Goat Anti-Rabbit IgG (H+L) (Jackson, Lot: 151083), Goat Anti-Mouse IgG (H+L) (Jackson, Lot: 150976)) diluted 2000 times with 5% skim milk powder in TBST was added and incubated at room temperature for about 1 hour. After washing with TBST for 3 times, the membrane was treated and Western-blot detection was performed using a chemiluminescence imaging system (Hangzhou Shenghua Technology, SHST Capture Mini) Figure 6 A), and the density of specific protein bands was quantitatively analyzed using SHST Analysis software. The relative expression of PAH protein was corrected by GAPDH Figure 6 B).

[0046] The results confirmed that the protein expression level of codon-optimized PAH coding sequence PAHco1 (SEQ ID NO: 1) in HepG2 cells was significantly higher than wild-type PAHwt (SEQ ID NO: 6) and codon-optimized PAHco2 (SEQ ID NO: 9).

[0047] Example 3: Production and identification of AAV5-PAH

[0048] After co-transfecting HEK293 cells (ATCC) with 3 plasmids (plasmid 1 is an ITR and hPAH expression frame containing plasmid, plasmid 2 is an AAV plasmid of Rep2Cap5, and plasmid 3 is a pHelper helper plasmid) and PEIpro (Polyplus) reagent for 3 days, the cells were harvested and lysed, and the cell DNA was removed by Benzonase treatment, and then the AAV5-hPAH was purified by gradient iodixanol ultracentrifugation or affinity column chromatography, the AAV genome DNA titer was analyzed by ddPCR and universal ITR primer probe, and the purity of AAV capsid protein was analyzed by SDS-PAGE (Figure 3). Figure 2 B). The purified AAV5-hPAH was denatured and then loaded onto an alkaline denaturing gel to analyze the integrity of the genome (Figure 3). Figure 2 C).

[0049] The results show that high-purity and complete genome DNA-containing recombinant AAV5-hPAH can be produced by transfecting HEK293 cells with three plasmids.

[0050] Example 4: Intravenous administration of AAV5-hPAH Pah enu2 Mice can restore Phe levels in blood and correct phenotype

[0051] Adult (about 10 weeks old) C57BL / 6- pah enu2 / enu2 (also known as Pah enu2 The level of phenylalanine (Phe) in the blood of mice (also known as Pah enu2 The un-administered PKU model mice were used as controls, and the WT was an un-administered normal C57BL / 6 mouse control, and all animals were given normal feed containing 0.94-0.97%. The detection method was liquid chromatography-mass spectrometry (LC-MS), Pah enu2Plasma phenylalanine (Phe) levels in mice after four doses (vg / kg, n=3 / group) of vehicle or AAV5-hPAH (containing sequence SEQ ID NO: 4) via tail vein at different time points (1 week to 24 weeks). Results show that in male Pah enu2 Phe levels in plasma were reduced to normal levels in mice treated with AAV5-hPAH at doses of 6E12 vg / kg or above Figure 3 A). In female Pah enu2 In mice, AAV5-hPAH treatment at a dose of 2E12 vg / kg reduced Phe levels in plasma relative to untreated animals, at a dose of 6E12 vg / kg significantly reduced Phe levels in plasma, and at doses of 6E13 vg / kg or above reduced Phe levels in plasma to normal levels Figure 3 B).

[0052] Adult (approximately 10 weeks old) C57BL / 6-pah enu2 / enu2 (also known as Pah enu2 ) mice were administered four doses (vg / kg) of vehicle or AAV5-hPAH (containing sequence SEQ ID NO: 4) via tail vein, and coat color changes were observed before administration, 8 weeks, 16 weeks, and 24 weeks after administration. In male Pah enu2 mice, coat color returned to normal levels after 24 weeks of treatment with AAV5-hPAH at a dose of 6E12 vg / kg or above, and in female Pah enu2 mice, coat color returned to normal levels after 24 weeks of treatment with AAV5-hPAH at a dose of 2E13 vg / kg or above Figure 3 C).

[0053] Example 5: Pah enu2 Neurotransmitter levels in the cerebral cortex of mice returned to normal after treatment with AAV5-hPAH

[0054] Adult male and female Pah enu2The mice were administered with solvent or AAV5-hPAH (containing sequence SEQ ID NO: 4) via tail vein for 8 weeks, and then the cerebral cortex was taken for liquid chromatography-mass spectrometry detection of phenylalanine (A), 5-hydroxytryptophan (B), 5-hydroxyindoleacetic acid (C), kynurenine (D), tryptophan (E) and serotonin (F) levels. After the animals were dissected, the cerebral cortex was quickly frozen in liquid nitrogen and stored at -80°C. When analyzed, the cerebral cortex sample was homogenized, then 0.05 g was mixed with 0.5 mL of 70% methanol, vortexed at 2500 rpm for 3 min, then centrifuged at 4°C and 12000 rpm for 10 min, 0.3 mL of supernatant was transferred to a centrifuge tube, placed at -20°C for 30 min, then centrifuged at 4°C and 12000 rpm for 10 min, and finally 0.2 mL of supernatant was analyzed by AB Sciex QTRAP 6500 liquid chromatography-tandem mass spectrometry (LC-MS / MS) (http: / / www.metware.cn / ).

[0055] The results show that the adult Pah enu2 After the mice were administered with AAV5-hPAH via intravenous single dose for 8 weeks, the phenylalanine and neurotransmitters in the cerebral cortex were restored to normal levels, thereby achieving significant efficacy.

[0056] Example 6: AAV5-hPAH was administered via tail vein Pah enu2 Expression levels of target DNA and hPAH in the liver of mice after administration of AAV5-hPAH via tail vein

[0057] Adult male Pah enu2 The mice were administered with AAV5-hPAH (containing sequence SEQ ID NO: 4) at doses of 6E12 vg / kg and 2E13 vg / kg via tail vein, and then qPCR analysis of target AAV genome DNA copies, analysis of target gene hPAH mRNA levels, and Western-blot analysis of target protein hPAH were performed at 1 week (n=5 / dose), 8 weeks (n=5 / dose) and 26 weeks (n=3 / dose) after administration.

[0058] Adult female Pah enu2Mice were subjected to qPCR analysis of AAV genome DNA copies, analysis of hPAH mRNA levels, and Western-blot analysis of hPAH protein at week 1 (n=5 / dose), week 8 (n=5 / dose), and week 26 (n=3 / dose) after tail vein administration of AAV5-hPAH (containing sequence SEQ ID NO: 4) at doses of 2E13 vg / kg and 6E13 vg / kg.

[0059] After the animals were dissected, liver tissues were quickly frozen in liquid nitrogen and stored at -80°C. For analysis of the target DNA, genomic DNA was extracted using a TIANamp Genomic DNA kit (TIANGEN, 4992254), and the DNA concentration was determined using a NanoDrop spectrophotometer 2000 (Thermo Fisher Scientific). Then, 100 ng of DNA was used for qPCR reactions using a CFX Opus 384 Real-Time PCR system (Bio-Rad). The primers used were hPAHco-F: TAAGGTTCTGCGGCTGTTT, hPAHco-R: GGTGGGTGAAGAACTCATACTC, and the probe was hPAHco-P: TGAACCTGACCCACATTGAGAGCC. Linearized plasmid DNA containing SEQ ID NO: 4 was used as a standard for analysis and calculation of the copy number of the target DNA in liver samples.

[0060] RT-qPCR was used for analysis of the mRNA levels of the target gene hPAH. Total RNA was extracted from liver samples using TRIzol reagent (Thermo Fisher Scientific, 15596026), and DNA was removed by DNase I digestion. Reverse transcription was performed using a PrimeScript™ RT Reagent Kit (TaKaRa, RR037B), and quantitative PCR reactions and analysis were performed using a SYBR Green PCR Master Mix (Vazyme, Q711-02) on a Bio-RAD CFX 384 Real-Time PCR system. The specific reaction conditions were as follows: denaturation at 95°C for 5 min, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. GAPDH in mice was used as an internal control for correction, and the relative expression level of hPAH was calculated using 2 (-△△Ct) Method.

[0061] The analysis of the protein of interest hPAH was performed using Western-blot method. Each mg of liver sample after quick freezing in liquid nitrogen was added with 7 μL of lysis buffer (1X Cocktail, 50 mM Tris-HCl, 0.5% Triton-X100, 150 mM KCl and 1 mM EDTA), after grinding, it was placed on ice for 30 min, then centrifuged at 4°C and 12000 rpm for 30 min, and the supernatant was used for Western-blot analysis. The total protein concentration was determined by Biophotometer (Eppendorf), and a certain volume of sample was mixed with loading buffer and placed at 98°C for 5 min, and then loaded onto a 10% polyacrylamide gel (10 ug / well). After SDS-PAGE, the gel was transferred to a nitrocellulose membrane, 5% skim milk powder in TBST was added, and the membrane was placed at room temperature for about 1 hour, then anti-human PAH specific antibody (Sigma, HPA028407) and anti-GAPDH antibody (ABclonal, AC002) were added and incubated at 4°C overnight, after washing with TBST for 3 times, HRP-conjugated secondary antibody was added and incubated at room temperature for about 1 hour, after washing with TBST for 3 times, the membrane was treated with UltraSignal ECL (4AW011, 4A Biotech), and the Western-blot analysis was completed. The GAPDH protein of the mouse was used as an endogenous reference protein for the correction of the protein of interest.

[0062] AAV5-hPAH containing a liver cell-specific promoter (containing sequence SEQ ID NO: 4) was administered to adult Pah enu2 The mice showed high levels of expression of the target gene hPAH in the liver after treatment, and the protein expression level could last for at least 24 weeks, and the Phe level in the blood and the neurotransmitter level in the cerebral cortex could be restored to normal, and the fur color of the treated animals also returned to normal, which fully proved that the liver-targeted AAV5-hPAH one-time administration achieved significant therapeutic effect in Pah enu2 The mice showed high levels of expression of the target gene hPAH in the liver after treatment, and the protein expression level could last for at least 24 weeks, and the Phe level in the blood and the neurotransmitter level in the cerebral cortex could be restored to normal, and the fur color of the treated animals also returned to normal, which fully proved that the liver-targeted AAV5-hPAH one-time administration achieved significant therapeutic effect in Pah Figure 5 ).

[0063] incorporated by reference

[0064] The entire contents of each patent and scientific document referred to herein are incorporated by reference herein for all purposes.

[0065] equivalents

[0066] The present disclosure can be embodied in other specific ways without departing from the spirit or essential characteristics thereof. Therefore, the above embodiments are merely illustrative, and not restrictive of the application described herein. The scope of the disclosure is therefore indicated by the appended claims, rather than by the description above, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

1. A polynucleotide encoding a liver enzyme phenylalanine hydroxylase, the polynucleotide set forth as SEQ ID NO: 1 or SEQ ID NO:

5.

2. An expression cassette comprising a polynucleotide as set forth in SEQ ID NO:

1.

3. The expression cassette of claim 2, further comprising a promoter and / or an intron.

4. The expression cassette of claim 2, the promoter selected from SEQ ID NO:

2.

5. The expression cassette of claim 2, the intron selected from SEQ ID NO:

3.

6. The expression cassette of any one of claims 2 to 5, the expression cassette set forth as SEQ ID NO:

4.

7. A vector comprising the polynucleotide of claim 1 or the expression cassette of any one of claims 2 to 6.

8. The vector of claim 7, wherein the vector is a viral vector.

9. The vector of claim 8, wherein the viral vector is an adeno-associated virus (AAV) vector, an adenovirus vector, or a lentivirus vector.

10. An AAV particle comprising the vector of any one of claims 7 to 9 and a capsid protein.

11. The AAV particle of claim 10, wherein the AAV is selected from serotypes 1, 2, 3, 3B, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, rh10, or hu37.

12. A composition comprising the polynucleotide of claim 1, the expression cassette of any one of claims 2 to 6, the vector of any one of claims 7 to 9, or the AAV particle of claim 10 or 11, and a pharmaceutically acceptable excipient.

13. Use of the polynucleotide of claim 1, the expression cassette of any one of claims 2 to 6, the vector of any one of claims 7 to 9, the AAV particle of claim 10 or 11, or the composition of claim 12, in the manufacture of a medicament for treating or alleviating phenylketonuria in a subject.

Citation Information

Patent Citations

  • Chimeric promoter for enhancing gene expression

    CN118064436A

  • Bidirectional dual promoter expression vectors and uses thereof

    TW202400796A