A method for increasing the content of tanshinone in salvia miltiorrhiza plants, a gene editing vector and a gene editing transformant

Abstract

The present application belongs to the technical field of genetic engineering, and relates to a method for increasing the content of tanshinone in Salvia miltiorrhiza plants, a gene editing vector and a gene editing transformant. Through sequence analysis of the exons of the GPPS gene of Salvia miltiorrhiza and targeted knockout of the exons of the GPPS gene of Salvia miltiorrhiza based on the CRISPR / Cas9 system, the synthesis pathway metabolic flow of tanshinone can be reduced to branch to monoterpenes and some secondary metabolites other than tanshinone, the expression of the key enzyme gene of tanshinone synthesis is positively regulated, the biosynthesis of tanshinone in Salvia miltiorrhiza plants is improved, and the growth and development of the plants are not harmed. The Salvia miltiorrhiza plant material with high tanshinone content obtained by the technical scheme of the present application has important significance for the gene editing breeding of Salvia miltiorrhiza and the production of rare natural secondary metabolites, and provides a train of thought for the breeding and improvement of Salvia miltiorrhiza.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and relates to a method for increasing the content of tanshinone in Salvia miltiorrhiza plants, a gene editing vector and a gene editing transformant. BACKGROUND

[0002] Salvia miltiorrhiza Bunge is a well-known and precious traditional Chinese medicine, which has been proved to be effective in treating cardiovascular diseases, and the plant has also been developed into various preparations, such as the famous compound Danshen dripping pills, which are widely used in many countries. Salvia miltiorrhiza mainly contains two types of bioactive compounds, namely tanshinone and phenolic acid. As a kind of diterpenoid, tanshinone mainly includes cryptotanshinone (CPT), tanshinone IIA (Tan IIA), dihydrotanshinone (DHT) and tanshinone I (Tan I), which are derived from the universal five-carbon precursor isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP), which are synthesized in two independent pathways, one is the 2-C-methyl-erythritol 4-phosphate (MEP) pathway located in chloroplast, and the other is the malonyl-CoA (MVA) pathway located in cytoplasm. In cytoplasm, IPP and DMAPP are sequentially catalyzed by GPPS and FPPS to generate FPP, and FPP further generates sterols, sesquiterpenes and other triterpenoids; GPPS synthase in Salvia miltiorrhiza plays an important role in the synthesis of terpenoids. In plastid, IPP and DMAPP are catalyzed by GPPS to generate GPP, and GPP further synthesizes monoterpenes and some diterpenoids. Through the study of SmGPPS and its regulation mechanism, theoretical basis and technical support can be provided for increasing the yield of tanshinone and breeding high-yield Salvia miltiorrhiza varieties.

[0003] Due to the strong market demand, but the biosynthesis of tanshinone faces many challenges, combined with the scarcity of Salvia miltiorrhiza resources, the content of tanshinone in natural wild Salvia miltiorrhiza is not high. Therefore, it is urgent to develop a Salvia miltiorrhiza plant with high content of tanshinone, which will be an important attempt to cultivate high-yield and high-quality Salvia miltiorrhiza varieties. SUMMARY

[0004] The technical problem to be solved by the present application is to overcome the shortcomings of the existing plant genetic engineering technology, and to further study the synthesis and regulation of plant secondary metabolites in Salvia miltiorrhiza. The present application provides a method for increasing the content of tanshinone in Salvia miltiorrhiza plants by knocking out the GPPS gene of Salvia miltiorrhiza.

[0005] The technical scheme adopted by the present application is as follows:

[0006] A method for increasing the content of tanshinone in Salvia miltiorrhiza plants, which inhibits or destroys the expression of GPPS gene in Salvia miltiorrhiza.

[0007] The synthesis of tanshinone in Salvia miltiorrhiza plants is a complex multi-step process, multiple metabolic pathways share the same precursor, metabolic intermediates participate in the synthesis of multiple end products, and part of the function is unknown, which leads to the limited yield of target metabolite tanshinone. The present application can greatly improve the yield of tanshinone by gene editing technology, especially knocking out the key gene SmGPPS in the competitive metabolic pathway, which can reduce the dispersion of resources.

[0008] As preferred, all or part of the core sequence of the Salvia miltiorrhiza GPPS gene is knocked out by CRISPR / Cas9 technology.

[0009] As preferred, the target point of the CRISPR / Cas9 technology knocking out the Salvia miltiorrhiza GPPS gene is located within the 1-300bp region downstream of the start codon of the Salvia miltiorrhiza GPPS gene, and the nucleotide sequence of the region is shown in SEQ ID NO. 1.

[0010] As preferred, the target point of the CRISPR / Cas9 technology knocking out the Salvia miltiorrhiza GPPS gene is: 5'-TGTGTAAAAGATGTTCACGG-3' (shown in SEQ ID NO. 2) and 5'-TGAAGATCCACGAATCCATG-3' (shown in SEQ ID NO. 3).

[0011] As preferred, first, the Salvia miltiorrhiza GPPS gene exon sequence is analyzed, and two sgRNAs are designed near the 300bp region downstream of the start codon by CRISPR-P v2.0 webpage (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and a CRISPR / Cas9 gene editing vector containing the target sequence of the two sgRNAs is constructed. Then the vector is introduced into the edited Salvia miltiorrhiza leaves by Agrobacterium, and the differentiated regenerated plants are induced. The Cas9 positive plants are screened, and the homozygous edited plants are further obtained by cloning and sequencing the genome near the target point.

[0012] After knocking out the core sequence of the Salvia miltiorrhiza GPPS gene by the above method, the growth phenotype of the Salvia miltiorrhiza plant has no obvious change, and it is found that the content of cryptotanshinone (CPT) and tanshinone IIA (Tan IIA) is significantly improved by liquid chromatography-high throughput triple quadrupole mass spectrometry (TQ-Absolute) measurement.

[0013] As preferred, the starting vector for constructing the CRISPR / Cas9 gene editing vector is pCAMBIA-1300.

[0014] As preferred, it specifically includes the following steps:

[0015] S1. Culturing Salvia miltiorrhiza sterile seedlings;

[0016] S2. Designing two sgRNA molecules complementary to the target gene to guide Cas9 protein to target specific gene sites;

[0017] S3. Constructing a gene editing vector by combining the target sequence of sgRNA and the expression vector of Cas9 protein for genetic transformation of plant cells;

[0018] S4. Introducing the constructed gene editing vector into plant cells by Agrobacterium-mediated genetic transformation method to produce transgenic Salvia miltiorrhiza plants;

[0019] S5. Extracting genomic DNA from T0 generation plant seedlings and performing positive detection by PCR method to screen out successfully transformed plants;

[0020] S6. Using high-fidelity DNA polymerase to perform PCR amplification on the target genomic region, which should contain the gene fragment of the editing region and have a moderate length; the PCR product needs to be recovered and purified by a purification step to ensure that the target DNA fragment is of correct size and single band; the purified target DNA fragment is subjected to Sanger sequencing to determine the efficiency of nuclease cleavage. Through the sequencing results, it can be determined whether there is editing and the type of editing;

[0021] S7. Culturing the edited positive Salvia miltiorrhiza plants for more than 6 months, and taking Salvia miltiorrhiza roots for determination of tanshinone (tanshinone IIA, cryptotanshinone, dihydrotanshinone and tanshinone I) content.

[0022] By implementing the above technical solutions, the present application has the following advantages:

[0023] The present application uses gene editing technology to knockout Salvia miltiorrhiza GPPS gene to obtain edited Salvia miltiorrhiza plant phenotypes that have no obvious difference from wild type, but the tanshinone content is significantly improved, thereby realizing the further verification of the function of the target gene and the breeding application of the metabolic product. BRIEF DESCRIPTION OF DRAWINGS

[0024] Other features, objects and advantages of the present application will become more apparent from the following detailed description of non-limiting embodiments, with reference to the accompanying drawings:

[0025] Figure 1 Sequencing peak chart for Salvia miltiorrhiza GPPS gene editing;

[0026] Figure 2 Tanshinone (tanshinone IIA, cryptotanshinone, dihydrotanshinone and tanshinone I) content determination results of Salvia miltiorrhiza GPPS gene editing positive seedlings. DETAILED DESCRIPTION

[0027] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings. The described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0028] The experimental methods not specified in the following embodiments are generally carried out according to the conventional conditions, for example, the conditions described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or the conditions recommended by the manufacturer; and the materials, reagents, instruments and the like used, if not specifically stated, are commercially available. For example, the Agrobacterium tumefaciens EHA105 involved in the present embodiment is purchased from Shanghai Weidi Biotechnology Co., Ltd., with the product number AC1013, and the plasmid pCAMBIA-1300 can be obtained through public commercial channels, such as from Addgene Company, with the product number 44183.

[0029] The present embodiment relates to the obtaining of Salvia miltiorrhiza GPPS gene knockout positive plants, specifically comprising the following steps:

[0030] Step one, culture of Salvia miltiorrhiza sterile seedlings

[0031] The Salvia miltiorrhiza seeds are soaked in 0.1% mercuric chloride solution for 10 min, washed with sterile water for 3-4 times, the surface water is absorbed, the seeds are evenly distributed on 1 / 2MS solid medium, and cultured at 22°C with 16h / 8h (light / dark) light for 3 weeks to obtain Salvia miltiorrhiza sterile seedlings;

[0032] Step two, sgRNA design

[0033] The Salvia miltiorrhiza GPPS gene sequence is copied to the sgRNA design website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The base sequence of the selected homologous region is input, and the correct species and Cas9 protein are selected. The sgRNA sequence information generated by the website includes sgRNA sequence, PAM, specificity score, cutting efficiency score, and potential off-target specific information. The editing target sequence corresponding to sgRNA is selected as sgRNA1, TGTGTAAAAGATGTTCACGG, and sgRNA2, TGAAGATCCACGAATCCATG.

[0034] Step three, gene editing vector construction

[0035]

[0036] Step four, stable genetic transformation and regeneration of Salvia miltiorrhiza plants

[0037] The constructed vector was introduced into the EHA105 Agrobacterium strain and the strain was activated. The leaves of Salvia miltiorrhiza were subjected to micro-wound treatment, and then immersed with Agrobacterium for infection to introduce the exogenous gene into the plant cells. The infected plant tissues were subjected to co-culture, followed by degerming treatment to remove the Agrobacterium. The medium containing a selection agent was used to screen the callus containing the exogenous gene, and then the differentiation and regeneration of the plants were promoted.

[0038] Step five, extraction of genomic DNA at the seedling stage of regenerated Salvia miltiorrhiza plants, KOD enzyme PCR amplification, and observation of the band size to further screen the successfully transformed Salvia miltiorrhiza plants.

[0039] Table 1 PCR primer design

[0040] Primer name Primer sequence (5'-3') F1 atcggcctggacatcggcaccaac R1 cgtagccgttcttgctctggtcgaagaaaatc

[0041] Table 2 KOD enzyme PCR amplification reaction system

[0042] dNTPs 5 μL 10 x buffer 5 μL Mg 2+ ]] 2 μL Forward Primer 1 μL Reverse Primer 1 1 μL Salvia miltiorrhiza genomic DNA 1 μL KOD plus 1 μL ddH2O 34 μL

[0043] Step six, identification of positive Salvia miltiorrhiza GPPS gene editing knockout plants.

[0044] Specific primers were designed at 200-300 bp downstream of each target site, and a high-fidelity polymerase was used to amplify the fragments containing the target sequence. After gel recovery and purification of the PCR products, Sanger sequencing was performed, and the sequencing results were analyzed using software. The PCR product sequencing results were compared with the wild-type sequence to determine the specific gene mutation type, including single or multiple base pair deletion, substitution, and insertion.

[0045] Table 3 PCR primer design

[0046] Primer name Primer sequence (5'-3') F2 ATGAGCCTTCTTGTTAATCCAC R2 CGACATGGTGTGGATCATCTCCACC

[0047] Step seven, identification of target traits of positive Salvia miltiorrhiza GPPS plants

[0048] The Salvia miltiorrhiza GPPS gene-positive edited Salvia miltiorrhiza plants were transplanted into culture pots with a 1:1 mixture of nutrient soil and vermiculite, and cultured at 22°C with 16h / 8h (light / dark) light for 8 months. Wild-type and Salvia miltiorrhiza GPPS gene knockout positive Salvia miltiorrhiza plant roots were taken, vacuum freeze-dried, and ground. Dan shen ketones were extracted with anhydrous methanol, and the content of dan shen ketones (dan shen ketone IIA, cryptotanshinone, dihydrotanshinone, and dan shen ketone I) was measured by liquid chromatography-high throughput triple quadrupole mass spectrometry (TQ-Absolute). See Figure 2The results show that the tanshinone content of the salvia miltiorrhiza plants with the salvia miltiorrhiza GPPS gene knocked out is significantly improved, which indicates that knocking out the salvia miltiorrhiza GPPS gene reduces the metabolic flow of tanshinone to the plant monoterpenes and the diterpene compound pathways other than some tanshinones, thereby improving the tanshinone content in the salvia miltiorrhiza plants. It can be seen that the knocking out of the salvia miltiorrhiza GPPS gene can be used to improve the tanshinone content in the salvia miltiorrhiza plants.

[0049] The specific embodiments of the present application are described above. It needs to be understood that the present application is not limited to the specific embodiments described above, and various modifications or changes can be made by those skilled in the art within the scope of the claims, which does not affect the essential content of the present application.

Claims

1. A method for increasing the content of tanshinone in Salvia miltiorrhiza plants, characterized in that, Knocking out genes in Salvia miltiorrhiza GPPS B.

2. The method for increasing the content of tanshinone in Salvia miltiorrhiza plants according to claim 1, characterized in that, Knocking out salvia miltiorrhiza by CRISPR / Cas9 technology GPPS gene, the target site is located in the 1-300 bp region downstream of the start codon of salvia miltiorrhiza GPPS The nucleotide sequence of the region where the target site is located is shown in SEQ ID NO.

1.

3. The method for increasing the content of tanshinone in Salvia miltiorrhiza plants according to claim 2, characterized in that, Firstly, the Salvia miltiorrhiza GPPS gene exon sequence is analyzed, sgRNA is designed, a CRISPR / Cas9 gene editing vector containing the two sgRNAs is constructed, then the vector is introduced into Salvia miltiorrhiza leaves to be edited, differentiation regeneration is induced, and plants are regenerated, Cas9 positive plants are obtained through screening, and through cloning and sequencing of the genome near the target point, homozygous edited plants are further obtained; the target sequence of the sgRNA is shown as SEQ ID NO. 2 and SEQ ID NO.

3.

4. The method for increasing the content of tanshinone in Salvia miltiorrhiza plants according to claim 3, characterized in that, The starting vector for constructing the CRISPR / Cas9 gene editing vector is pCAMBIA-1300.

5. The method for increasing the content of tanshinone in Salvia miltiorrhiza plants according to claim 3, characterized in that, Specifically includes the following steps: S1. Cultivate Salvia miltiorrhiza sterile seedlings; S2. Design two sgRNA molecules complementary to the target gene to guide Cas9 protein to target specific gene sites; S3. Construct an expression vector containing an sgRNA expression frame and a Cas9 protein expression frame into a gene editing vector for genetic transformation of plant cells; S4. Introduce the constructed gene editing vector into plant cells using an Agrobacterium-mediated genetic transformation method to produce transgenic Salvia miltiorrhiza plants; S5. Extract genomic DNA from T0 generation plant seedlings and perform positive detection by PCR method to screen out successfully transformed plants.

Images