Cloning and application of major gene QT12 resistant to field natural high temperature in rice quality and yield

Abstract

The invention relates to application of a QT12 gene in rice in synergistically improving the quality and yield of rice in a natural high-temperature environment of a field. According to map-based cloning, it is found that a high-expression-quantity allele of the QT12 gene at a high temperature destroys the steady state of endosperm storage substances, and the rice quality heat resistance is negatively regulated and controlled. Large-scale field high-temperature tests show that no-function or weak-function QT12 not only endows rice grains with higher heat resistance in quality characters such as low chalkiness, high storage protein and low amylose, but also remarkably improves the maturing rate and the plot yield. G / A variation of QT12 in indica rice and 6bp insertion and deletion variation between indica rice and japonica rice explains the hereditary basis of heat resistance difference in indica rice and between indica rice and japonica rice, so that A variation in indica rice has lower expression quantity and higher heat resistance relative to G, or deletion 6bp in indica rice has lower expression quantity and higher heat resistance relative to insertion 6bp in japonica rice; the method has important significance for breaking the breeding bottleneck of contradiction between crop resistance and growth and between yield and quality.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding, and in particular relates to the cloning and application of a major gene QT12 for rice quality and yield tolerance to natural high temperature in the field. Background Art

[0002] Global warming seriously threatens global agricultural production and poses a major threat to global food security. Every 1°C rise in global average temperature will reduce the average yield of major crops by 3.1–7.4%, posing a major threat to global food security. In addition, global food security is not only related to output, but also closely related to quality. Rice determines human nutrition, market value and farmers' income, especially in Southeast Asia and Africa where high temperatures occur frequently and are highly dependent on grains. High temperatures will deteriorate the appearance, milling, cooking and eating of grains, as well as the nutritional quality of grains. These problems highlight the need for sustainable agriculture that improves the quality and yield of rice under high temperatures by improving the ability of crops to withstand high temperatures.

[0003] Rice has changed from pursuing high yields to now paying more attention to appearance and taste quality while pursuing high yields. Rice quality includes appearance, nutrition, cooking, taste, grinding and sensory characteristics, which are important indicators for measuring the economic value and edible value of rice. Its quality directly determines the market price of rice and consumers' willingness to buy, greatly affecting farmers' income. Chalkiness is the most intuitive trait of rice appearance quality, and it is also the most direct and sensitive indicator of rice quality deterioration caused by high temperature. It directly affects rice appearance quality, cooking and taste quality, nutritional quality and whole polished rice rate / yield, and is a major issue that determines the market value of rice in rice-producing areas around the world and the composition of human food consumption. At the same time, due to the complex composition of quality traits and the great influence of other factors, the pace of rice quality improvement has been greatly restricted.

[0004] Innovation of high-quality rice worldwide faces great challenges brought by frequent high temperatures, which is manifested in the low proportion of high-quality rice worldwide and weak market competitiveness, due to the low heat tolerance of most modern high-quality rice varieties for rice quality. If rice does not have a sufficiently attractive price, farmers' enthusiasm will be suppressed and rice production will decline accordingly. In order to improve the heat tolerance of crops, it is crucial to identify germplasm resources that are stably heat-resistant in a variety of natural high-temperature environments. Traditional methods for identifying heat-resistant phenotypes and potential QTLs or genes usually focus on identifying yield traits such as seedling survival rate or fruiting rate in the reproductive stage in controlled environments such as greenhouses, which cannot accurately simulate the natural high temperature in the field environment, and often lead to the failure of the successful identification of truly heat-resistant germplasm. Therefore, there are still few germplasms and QTLs with true heat tolerance and suitable for breeding purposes. Therefore, it is necessary to identify true heat-resistant germplasm under high field temperatures, clone QTLs for true heat tolerance, and elucidate the potential mechanisms to overcome the challenges of developing breeding for crops resistant to natural high temperatures. Summary of the invention

[0005] The present invention isolated and cloned a major QTL gene for improving rice quality and yield under high temperature environment in the field from high-quality rice varieties Chenghui 448 and OM1723 under natural field high temperature environment conditions for many years. QT12 , providing new genetic resources for synergistically improving rice yield and quality breeding under the background of global warming.

[0006] The object of the present invention is to provide a method for QT12 The application of genes or proteins encoded by them in improving rice quality (chalky appearance quality, storage material content, taste quality, etc.) and yield under high temperature environment in multiple fields for many years and at multiple locations.

[0007] The present invention analyzed the rice quality of the F2 genetic population of rice Chenghui 448 and OM1723 under high temperature in the field and found that the gene had a great effect on the chalkiness rate. QT12 Fine positioning to a 14-kb chromosome segment, the segment contains 1 ORF. Through further genotype and expression analysis, it was determined to be a reliable candidate gene. It has only 1 full-length cDNA, the full sequence of the gene in rice Chenghui 448 is shown in SEQ ID NO.1, the full sequence of the gene in rice OM1723 is shown in SEQ ID NO.2, and the full sequence of the gene in japonica rice ZH11 is shown in SEQ ID NO.3, including promoter, 5'UTR, CDS, intron, 3'UTR, its CDS sequence is shown in SEQ ID NO.4, and the encoded protein is shown in SEQ ID NO.5.

[0008] The protection scope of the present invention includes:

[0009] Rice QT12 Application of a gene or its encoded protein in regulating rice quality (chalkiness appearance quality and storage material content, etc.) and yield under natural high temperature, wherein the QT12 The sequences of the gene in Chenghui 448, OM1723 and ZH11 are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively, the CDS sequence is shown in SEQ ID NO.4, and the protein sequence is shown in SEQ ID NO.5.

[0010] The above-mentioned applications are specifically:

[0011] Knock out, inhibit or reduce QT12The expression, function or activity of the gene or its encoded protein is used to improve the heat tolerance of rice under high temperature in the field, that is, to better maintain the steady-state balance of the content of storage substances such as rice storage protein and amylose, low chalkiness (good appearance quality) and higher rice taste value under high temperature, while at the same time increasing the fruit setting rate, the number of filled grains and the yield.

[0012] Improve rice QT12 The heat resistance of rice under high temperature in the field can be reduced by changing the expression level of the gene or the expression level or activity of the protein it encodes, that is, the quality of rice deteriorates under high temperature, such as reduced storage protein of rice, increased amylose, increased chalkiness (poor appearance quality) and decreased taste value of rice, while the fruit set rate, number of filled grains and yield are reduced.

[0013] The substance for inhibiting the expression or function of QT12 protein in rice is a CRISPR / Cas9 vector with a knockout target sequence of the polynucleotide shown in SEQ ID NO.6, and the rice with improved quality and heat resistance under high temperature in the field after editing by the CRISPR / Cas9 system has the following polynucleotide:

[0014] ①AATGGCGATGGCCCTGCTCAGAGG

[0015] ②AATGGCGATGGCCCTGCCTAGAGG

[0016] AATGGCGATGGCCCTCCAGAGG

[0017] ③AATGGCGATGGCCCTGCCGCAGAGG

[0018] AATGGCGATGGCCCTGCTCAGAGG

[0019] Utilize the included QT12 Any molecular marker designed by the two major allelic functional variants G / A, including CAPS and KASP, can be used for molecular marker-assisted breeding or gene editing technology to convert low-expressing rice QT12 Allele QT12 A (High-quality variety Chenghui 448) Import / replace high expression QT12 Allele QT12 G (the main high-quality variety Huazhan) to improve the heat tolerance of rice under high temperature in the field, that is, to better maintain the steady-state balance of storage substances such as rice storage protein and amylose, low chalkiness (good appearance quality) and higher rice taste value under high temperature, while increasing the fruit setting rate, number of filled grains and yield. QT12The allele is the genomic fragment shown in SEQ ID NO.1. Produced by molecular marker-assisted selection QT12 Huazhan Import System A The genome fragment containing the allele is shown as SEQ ID NO.1.

[0020] Using Indica-Japonica intercropping QT12 Any molecular marker designed with two major 6-bp InDel variants, including CAPS, KASP, and InDel, can be used for marker-assisted breeding or gene editing to convert low-expressing genes in indica rice. QT12 I Allele introduction / replacement in japonica rice ( QT12 J ) to improve the heat tolerance of japonica rice under high temperature in the field, that is, to better maintain the steady-state balance of storage substances such as rice storage protein and amylose, low chalkiness (good appearance quality) and higher rice taste value under high temperature, while increasing the fruit set rate, number of filled grains and yield.

[0021] Utilize the included QT12 Any molecular marker designed by the two major allelic functional variants G / A, including CAPS and KASP, can be used for molecular marker-assisted breeding or gene editing technology to express high levels of rice QT12 Allele QT12 G (High-quality variety OM1723) Import / replace low expression QT12 Allele QT12 A (High-quality variety Chenghui 448) or introduce substances that increase the expression of QT12-encoded proteins in rice into rice to reduce the heat resistance of rice under high field temperatures, that is, the rice storage protein is reduced, the amylose is increased, the chalkiness is increased (poor appearance quality), and the taste value of rice is reduced under high temperature, and the quality of rice deteriorates, while the fruit setting rate, the number of filled grains, and the yield are reduced. QT12 The alleles are the genomic fragments shown in SEQ ID NO.2 and SEQ ID NO.3, the substance is a nucleic acid molecule encoding QT12 protein or its expression frame, a recombinant vector, or a recombinant microorganism, and the nucleic acid molecule encoding QT12 protein is shown in SEQ ID NO.4. QT12 Chenghui 448 import system NIL OM It contains a genomic fragment having an allele as shown in SEQ ID NO.2.

[0022] Using Indica-Japonica intercropping QT12Any molecular marker designed by two major 6-bp InDel variants, including CAPS, KASP and InDel, can be used for molecular marker-assisted breeding or gene editing to express high expression in japonica rice (ZH11). QT12 Allele QT12 J Imported indica rice (Sanhuangzhan-2; QT12 I ) to reduce the heat resistance of rice under high temperature in the field, that is, the rice storage protein is reduced, the amylose is increased, the chalkiness is increased (poor appearance quality) and the rice taste value is reduced under high temperature, and the quality deteriorates, while the fruit setting rate, the number of filled grains and the yield are reduced. QT12 The allele is the genomic fragment shown in SEQ ID NO.3.

[0023] Specifically, the present invention provides any of the following applications: A) Use of rice QT12 protein, a nucleic acid molecule encoding the protein, or an expression cassette, a recombinant vector, a transgenic cell line or a recombinant bacterium containing the nucleic acid molecule in regulating the heat resistance of rice quality and yield or in preparing a product for regulating the heat resistance of rice quality and yield; B) Use of an agent that reduces the functional activity of QT12 protein in cultivating high-quality and high-yield heat-resistant rice germplasm or preparing a high-quality and high-yield heat-resistant rice germplasm product; The amino acid sequence of the QT12 protein is shown in SEQ ID NO.5.

[0024] Furthermore, rice quality includes chalky appearance quality, storage material content, and taste quality, wherein chalky appearance quality includes chalkiness rate and chalkiness degree; storage material includes storage protein and amylose; the nucleotide sequence encoding the QT12 protein is shown in SEQ ID NO.4.

[0025] The present invention provides a method for enhancing rice quality and yield under high temperature and / or cultivating quality and yield heat-resistant rice germplasm, wherein the heat resistance of rice quality and yield is improved by knocking out, inhibiting or reducing the expression, function or activity of the QT12 gene or its encoded protein in rice, that is, the obtained rice better maintains a steady-state balance of rice storage protein and amylose content, low chalkiness and higher rice taste value under high temperature, while the fruit setting rate, the number of filled grains and the yield are increased, and the protein sequence encoded by the QT12 gene is shown in SEQ ID NO.5.

[0026] Furthermore, the substance that inhibits the expression amount or function of QT12 protein in rice is a CRISPR / Cas9 vector, and the target sequence targeted by the CRISPR / Cas9 vector is the polynucleotide site shown in SEQ ID NO.6.

[0027] The present invention provides a SNP molecular marker related to rice quality and yield heat resistance that can distinguish between indica rice and between indica and japonica rice. The SNP molecular marker is located at -1455 upstream of a QT12 gene promoter (corresponding to base 3718373 on rice chromosome 12, with a reference genome version of MSU version 7.0), and has an A / G polymorphism, specifically, an A / G variation exists at position 2372 of the sequence shown in SEQ ID NO.3. When the SNP site is A, the rice is identified as indica rice, and exhibits a lower quality heat damage index, that is, higher quality heat resistance, and a lower QT12 expression level.

[0028] The invention provides an indel molecular marker capable of distinguishing indica and japonica rice and associated with rice quality and yield heat resistance. The indel molecular marker is specifically the presence or absence of a 6bp deletion at positions 2828-2833 of the sequence shown in SEQ ID NO.3 (corresponding to bases 3718829-3718834 on chromosome 12 of rice, with a reference genome version of MSU version 7.0). When the result is -6bp, the rice is identified as indica rice.

[0029] The present invention provides a molecular marker combination related to the QT12 expression level and the heat resistance of rice quality and yield. The molecular marker combination is the SNP defined above and the indel defined above. The rice germplasm is further divided into three haplotypes according to the SNP and indel results, namely, Hap1: G / + 6bp, Hap3: G / -6bp, and Hap7: A / -6bp. Among them, haplotype Hap7 has the lowest QT12 expression level, Hap3 is in the middle, and the expression level of QT12 in Hap1 is the highest. The lower the QT12 expression level, the higher the quality and heat resistance.

[0030] The present invention provides an application of any of the above-mentioned molecular markers or a combination thereof in identifying or assisting in identifying indica and japonica rice and / or cultivating quality and yield heat-resistant rice germplasm, wherein rice with a SNP result of A and / or an indel result of -6bp is identified as indica rice, and rice with an indel result of +6bp is identified as japonica rice, and rice with A, -6bp, and A / -6bp is selected according to the SNP and / or indel results for coordinated cultivation of quality and yield heat-resistant rice germplasm.

[0031] The present invention provides a method for identifying and assisting in identifying indica and japonica rice, and uses any of the above-mentioned molecular markers or a combination thereof to detect rice, and identifies rice with a SNP result of A and / or an indel result of -6bp as indica rice, and identifies rice with an indel result of +6bp as japonica rice.

[0032] The present invention provides a method for cultivating high-quality and high-yield heat-resistant rice germplasm, which comprises detecting rice using any of the above-mentioned molecular markers or a combination thereof, and selecting rice with A, -6bp, and A / -6bp according to SNP and / or indel results for coordinated cultivation of high-quality and high-yield heat-resistant rice germplasm.

[0033] Beneficial effects: The present invention cloned a major gene in rice that negatively regulates rice quality and yield heat resistance under high temperature, providing a new gene resource for high-quality and high-yield breeding of rice and other cereal crops. Due to its highly conservative characteristics, it also provides a genetic basis for breeding and research on heat resistance in other crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0035] Figure 1 It is a technical flow chart of the present invention.

[0036] Figure 2 For the present invention QT12 Initial positioning of the rice quality traits of chalkiness in Chenghui 448 and OM1723 at six different natural field temperatures during the grain filling period. The sowing time was adjusted according to the heading period of the two parents to keep the heading and filling time consistent. b, Grain width of Chenghui 448 and OM1723 at different field temperatures. c, QTL gene for high temperature tolerance of rice chalkiness appearance quality was identified using RICE 6K chip technology QT12 The area inside the ellipse is QT12 d, using the co-segregation criteria to identify candidate QT12 Site, i.e. QT12 Two homozygous genotypes can significantly distinguish the two extreme chalky phenotypes, where A (yellow), B (grey) and H (brown) represent QT12 High-value homozygous, low-value homozygous, and heterozygous genotypes of the locus.

[0037] Figure 3 For the present invention QT12 Determination of candidate genes. a. Comparison of the chalky phenotype and genotype of 57 recombinant plants screened from a large population of 4310 F3 plants. QT12 Fine positioning and cloning are performed. Phenotypic analysis is performed on the progeny of each recombinant strain to infer QT12 b, genotype of the parents QT12c, Two kinds of endosperm in two NILs at 5-DAF (5 days after flowering) at different temperatures QT12 Expression level of allele. d, Hap in rice micro-core collection CH ( QT12 A ) and Hap OM ( QT12 G ) Quality heat damage index of the two haplotypes and in 5-DAF endosperm QT12 The rice chalkiness under high temperature minus the rice chalkiness under normal temperature is defined as the rice quality heat damage index. The lower the quality heat damage index, the stronger the heat resistance of the quality.

[0038] Figure 4 Different from the present invention QT12 Expression and heat tolerance analysis of genotypes in micro-core collections. a, 5-DAF endosperm of heat-tolerant (R) and sensitive (S) varieties identified from multi-year field high temperature trials QT12 b, QT12 Distribution of G / A variation in 533 mini-core accessions. QT12 A and QT12 G They are resistant haplotype and sensitive haplotype respectively. c, indica rice QT12 A and QT12 G The heat damage index of quality and the 5-DAF endosperm QT12 Expression level.

[0039] Figure 5 For the present invention QT12 Haplotype analysis and indica-japonica differentiation analysis. a, 4726 rice core germplasms QT12 Haplotype analysis. Green letters indicate haplotypes between Chenghui448 and OM1723 QT12 Functional G / A SNP variation in the promoter. QT12 G He Chenghui 448 QT12 A The haplotypes are marked with circles. The ratios behind the corresponding haplotypes are the number of indica and japonica rice varieties. b, QT12 Natural variation between typical indica rice Sanhuangzhan-2 (SHZ) / OM1723 (OM) / Chenghui448 (CH) / Huazhan (HZ) and japonica rice ZH11. The variants in the box are QT12 Representative variation of G / A. c, QT12The distribution of 6-bp InDels in indica, japonica, Aus, and Intermediate. +6bp and -6bp indicate the presence or absence of 6-bp variants, respectively. d, Distribution of 6-bp InDels in indica and japonica at different temperatures QT12 Transient dual luciferase reporter gene assay of the promoter. e, QT12 Expression levels in three haplotypes determined by the 6-bp InDel and the functional variant G / A.

[0040] Figure 6 For the present invention QT12 Quality phenotypes of transgenic complementary lines under different field temperatures. a, QT12 Chalky appearance quality phenotype of transgenic complementary lines under different field temperatures in Wuhan in 2022. b, QT12 Chalky appearance quality phenotype of transgenic complementary families under different field temperatures in Wuhan in 2023. c, QT12 The contents of various storage substances in transgenic complementary lines at different field temperatures. d, QT12 The ratio of the contents of various storage substances in transgenic complementary lines under different field temperatures.

[0041] Figure 7 For the present invention QT12 Quality phenotypes of transgenic knockout lines under different field temperatures. a, QT12 Chalky appearance quality phenotype of transgenic knockout lines under different field temperatures in Wuhan in 2022. b, QT12 Chalky appearance quality phenotype of transgenic knockout families under different field temperatures in Wuhan in 2023. c, QT12 The contents of various storage substances in transgenic knockout lines at different field temperatures. d, QT12 Ratios of the contents of various storage substances in transgenic knockout lines at different field temperatures.

[0042] Figure 8 The japonica rice variety ZH11 has a QT12 J Alleles complemented to the indica rice variety SHZ ( QT12 I ) of the complementary family. a, Different field temperatures QT12 J Rice chalky appearance quality phenotype of complementary families. b, under different field temperatures QT12 J The contents of various storage substances in rice of complementary families. c, under different field temperatures QT12 J Ratio of storage protein to amylose content in rice of complemented families.

[0043] Fig. 9For the present invention QT12 Quality phenotypes of two NIL materials under different field temperatures. a, QT12 The chalky appearance quality phenotypes of two NIL materials at different field temperatures in Wuhan in 2022. b, QT12 The contents of various storage substances of two NIL materials at different field temperatures. c, QT12 The ratio of the contents of various storage substances in the two NIL materials at different field temperatures.

[0044] Fig.10 For the present invention QT12 Subcellular structure observation of the endosperm of two NIL materials at different field temperatures. a, Scanning electron microscopy observation of mature endosperm of two NILs under natural high temperature and room temperature conditions. b, Transmission electron microscopy observation of NIL CH and NIL OM Subcellular structure of 10-DAF endosperm cells. PBI and PBII indicate protein bodies I and II, respectively; SG indicates starch granules. Scale bar, 2 µm. The size and area of ​​protein bodies and starch granules were statistically analyzed in a field of view of 875 µm. 2 c, d, NIL CH and NIL OM The number and area of ​​starch granules (c) and protein bodies (d) in the abdominal part of 10-DAF endosperm (per 875 µm 2 ). e, the ratio of the number and area of ​​protein bodies to starch granules. f, the degree of maintenance of the ratio of protein bodies to starch granules. The degree of maintenance refers to the ratio of the number or area of ​​protein bodies to starch granules at high temperature compared to the ratio at room temperature.

[0045] Fig.11 Under natural high temperature and normal temperature conditions QT12 Plant type and quality traits of Huazhan introgression lines. a, Plant type and rice chalky appearance quality phenotype of Huazhan introgression lines under natural high temperature and normal temperature conditions. b, Contents of various storage substances of Huazhan introgression lines under natural high temperature and normal temperature conditions. c, Ratio of the contents of various storage substances of Huazhan introgression lines under natural high temperature and normal temperature conditions.

[0046] Fig.12 For the present invention QT12 Yield and eating quality phenotypes of different genetic materials under high temperature in the field. QT12 NIL (a), complemented transgenic lines (b), knockout lines (c) and QT12 J The fruit setting rate, yield per plant and rice taste value of the complementary family (d) under different field temperature conditions.

[0047] Fig.13 For the present invention QT12Effects of high temperature on other yield traits of rice in the field. a. Two QT12 Haplotypes in 533 rice micro-core accessions and indica rice subpopulations. b, Other yield traits and chalky phenotypes of two NILs under high field temperature. c–e, Under natural high field temperature QT12 Complementation family (c), CRISPR family (d) and QT12 J Thousand-grain weight, number of grains per plant and number of spikelets per plant of the complementary family (e).

[0048] Fig.14 For the present invention QT12 The phenotypes of various yield traits of different genetic materials under normal temperature in the field in Wuhan. QT12 Complementation transgenic lines (a), knockout lines (b) and QT12 J The complementary family (c) showed fruit setting rate, number of filled grains per plant, number of flowers per plant and 1000-grain weight under normal field temperature.

[0049] Fig.15 For two excellent varieties QT12 Large-scale field high temperature experiment of NIL and introgression lines of rice. a, Maximum temperature during flowering and grain filling stages of rice in Wuhan, Hangzhou and Changsha from 2000 to 2024. b–h, QT12 Plot yield (5 m2), fruit setting rate, number of grains per plant, yield per plant, chalkiness rate and chalkiness of NILs (b–e) and Huazhan introductory lines (f–h) under natural high temperature conditions in Wuhan, Hangzhou and Changsha in 2024. The genetic materials in each city are based on large-scale field trials, using a randomized block design, with 3–4 plots replicated per family, each plot area of ​​about 5 m2, and 12×15=180 plants.

[0050] Fig.16 For the present invention QT12 Large-scale field trials of different transgenic genetic materials at high temperatures. a–g, QT12 Plot yield (5 m2), fruit setting rate, number of grains per plant, yield per plant, chalkiness rate and chalkiness degree of the complemented families (b–d) and CRISPR knockout families (e–g) under natural high temperature conditions in Wuhan, Hangzhou and Changsha in 2024.

[0051] Fig.17 For the present invention QT12 Grain width of different genetic materials under high temperature environment in Wuhan in 2024.

[0052] Fig.18 For the present invention QT12 Plant height and growth period of different genetic materials under normal temperature in Wuhan in 2024. QT12Plant height and heading date of near-isogenic lines (g, h), Huazhan introgression lines (i, j), transgenic complementation lines (k), and transgenic CRISPR knockout lines (l).

[0053] Fig.19 For the present invention QT12 In wild-type 448 and QT12 mRNA and protein expression levels at different temperatures in complementation families. DETAILED DESCRIPTION

[0054] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0055] The parents used in the present invention are rice Chenghui 448 and OM1723, both of which belong to rice micro-core germplasm resources and have the same grain width.

[0056] Example 1 Natural high temperature treatment in the field during the rice filling period

[0057] In order to make each rice genetic material be treated with natural high temperature and normal temperature during the grain filling period, we planted each genetic material in batches during the sowing period, and adjusted the planting time according to the length of the heading period of each material. Generally, we sowed once every half a month to try to ensure that the heading and early grain filling period were in the high temperature period of Wuhan field. For materials with a long heading period (>95 days), such as genetic materials with Chenghui 448 or OM1723 as the background, they were usually sown in mid-to-late April; for materials with a short heading period (<80 days), they were sown around mid-May. Different sowing dates will cause genetic materials with different growth periods to start heading and grain filling in mid-to-late July or early August. During this period, Wuhan often experiences extreme high temperatures exceeding 35°C, and this record has lasted for more than 60 years. For the normal temperature treatment experiment, all materials were sown in mid-to-late June, so that short heading period materials usually start heading and grain filling in mid-to-early September, while long growth period materials start heading and grain filling in mid-to-late September. During this period, the average temperature in Wuhan was relatively low and normal (about 30°C). The dynamic temperature data were automatically recorded every 5 minutes from June to October at Huazhong Agricultural University and from February to May at the Lingshui Nanfan Base using a USB temperature and humidity recorder (USB-TH). The early grain filling period is the most sensitive period for rice endosperm, so the daily average temperature of each material in the early grain filling period from 6 to 12 days after flowering was calculated, from 9 am to 7 pm. When OM1723, NIL OM When the rice chalkiness rate of sensitive materials such as ZH11 or ZH11 increased significantly, it indicated that these materials had been treated with high temperature during the grain filling period. On the contrary, when all sensitive wild-type materials still maintained a low grain chalkiness rate, it indicated that they were filling at normal temperature.

[0058] Example 2: Quality and yield assessment of rice at natural temperature in the field

[0059] Before examining the appearance quality traits of rice such as chalkiness, the harvested mature seeds were fully dried or sun-dried and stored at room temperature for at least three months. Rice chalkiness, including belly white, heart white and back white, is generally detected by visual inspection. The mature and dry seeds were threshed and shelled into brown rice. 100 whole rice grains were randomly selected, and the percentage of rice grains with chalkiness was counted and expressed as the grain chalkiness rate (GCR). The chalky rice was laid flat and the percentage of the projected area of ​​the chalky part to the projected area of ​​the whole rice was visually measured and expressed as the rice chalkiness area (GCA). The chalkiness degree (GCD) is the product of the grain chalkiness rate and the chalkiness area. All chalkiness traits are expressed as percentages. Chalkiness in rice will reduce the appearance, milling, cooking and eating quality of rice and the yield of whole polished rice. Therefore, the increase of chalkiness is the most direct indicator of rice quality, and high temperature can easily cause sensitive changes in chalkiness. Therefore, lower rice chalkiness under high temperature indicates that the rice quality has stronger resistance to high temperature.

[0060] The total protein content of brown rice grains and the amylose content of polished rice flour were measured using an XDS near-infrared fast content analyzer (FOSS) and near-infrared reflectance spectroscopy. The milled rice was ground into flour, and the total starch content was measured using conventional chemical methods. The amylopectin content is equal to the total starch content minus the amylose content. The total storage material content is approximately equal to the total starch content plus the total protein content. The ratio between different storage materials can better understand the balance and imbalance of storage material content at different temperatures. The taste value of cooked rice was measured by a STA1B device (Satake, Japan). Briefly, 30 g of whole polished rice was weighed, washed and soaked in water according to the ratio (1:1.4 for indica rice and 1:1.35 for japonica rice) for 30 minutes, then boiled for 40 minutes, kept warm for 10 minutes, and cooled in a cooler for 20 minutes. 7 g of rice was taken to test its taste value, twice positive and reverse, for a total of 6 replicates. The score ranges from 0 to 100, indicating the comprehensive value of taste quality. Yuzhenxiang (YZX) is a famous Chinese variety of high-quality grain and high grain taste value, and has very similar excellent qualities to the well-known KDML105 variety consumed worldwide. We set the grain taste value of YZX to 90 as the calibration standard, measured the taste value at the same time as the experimental samples, and finally calibrated and standardized the taste value of each sample. The higher the value, the higher the taste quality.

[0061] For the investigation of different yield traits, the individual plants were threshed after harvesting, and the number of filled grains, empty grains and yield were manually counted at the individual plant level, and other traits were further calculated based on these three traits. Number of Yinghua = number of filled grains + number of empty grains; fruit setting rate = number of filled grains / number of Yinghua; thousand-grain weight = yield per plant / number of filled grains × 1000. Wuhan, Hangzhou and Changsha are the three major cities in the rice-producing area of ​​the Yangtze River Basin in China, and extreme high temperatures often occur, especially in the summer of 2024. The data on plot yield and other yield and quality traits of all genetic materials in each city are based on large-scale field trials, using a randomized block design, with 3-4 plots repeated for each family, and an area of ​​about 5 square meters for each plot, with about 12×15=180 individual plants.

[0062] Example 3: Rice appearance quality traits chalky heat-resistant genes QT12 Discovery Using RapMap method QT12 For rapid positioning and cloning, the process is as follows Figure 1 As shown, the details are as follows: 1) QT12 Initial gene location: Through natural temperature treatment in many places over many years, we identified a high temperature quality heat-resistant parent Chenghui 448 (CH) and a high temperature sensitive parent OM1723 (OM). Since the grain width of the two parents is the same, the effect of grain width on chalky quality is ruled out ( Figure 2a, b). The rice Chenghui 448 was crossed with OM1723 to obtain F1, and then self-pollinated to produce F2 genetic segregation population. The rice chalky phenotype of this population under natural field high temperature environment was investigated. According to the BSA method, extreme high and low pools were constructed. Ten full seeds were selected from each plant in the extreme pool, and the high and low pools were mixed and germinated separately. Two weeks later, an equal amount of leaves from each plant were ground with liquid nitrogen and sent to China Seed Group (Wuhan) for RICE6K SNP chip detection ( Figure 2 c); The RiceVarMap database (http: / / ricevarmap.ncpgr.cn / ) was used to search for the "Variation ID" of the InDel polymorphic variation, and then the InDel markers were designed using the "Design Primer by Variation ID" function. InDel differences with 3–8 bp deletions and PCR fragments of approximately 100–200 bp were preferred. Template DNA of Hui448 and OM1723 was amplified using all designed primers / markers and detected by 4% PAGE gel electrophoresis. The primers that were screened to be polymorphic between the parents were L12W1, L12W2, L12W3, L12W4, and L12W5, and these primers were used to identify the genotypes of each individual plant in the population.

[0063] Based on the analysis of the genotypes and phenotypes of individual plants using the L12W1 and L12W2 markers ( Figure 2 d) The homozygous genotype in this region can separate the two extreme chalky phenotypes under high temperature, and the difference in chalkiness rate reaches an extremely significant level, indicating that this site belongs to single-factor Mendelian inheritance and can be used for the next step of fine positioning and map-based cloning.

[0064] 2) QT12 Gene fine mapping: To further reduce QT12 The F2 plants that were all heterozygous in the initial positioning sections were developed into a large F3 population of 4310 plants, and the recombinant plants were selected from them.

[0065] First, the Indel markers L12W1 and L12W2 (Table 1) were used for screening, and 57 recombinant plants were screened from 4310 plants. These plants were tested for their offspring to confirm the phenotype of the previous generation: families with separated traits indicated that the phenotype of the previous generation was heterozygous, and the offspring traits that did not separate and were high-value traits indicated that the phenotype of the previous generation was homozygous from OM1723, and low values ​​indicated that the phenotype of the previous generation was homozygous from Chenghui 448. Then, the 5 developed InDel markers (L12W1, L12W7, L12W8, L12W9, L12W10 and L12W2) were used to analyze these 57 recombinant plants. Therefore, QT12It was finally located between L12W7 and L12W8, which corresponds to a physical range of about 14 kb on the genome sequence of Nipponbare. This segment contains only one candidate gene. Through genotyping and expression analysis, a reliable candidate gene was identified, called QT12 Gene( Figure 3 a).

[0066] Table 1 Primers used for map-based cloning and gene function verification in the present invention

[0067] In the rice Chenghui 448 and OM1723 genomes, the full sequences of the gene are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, including the promoter, 5'UTR, CDS, introns and 3'UTR, the CDS sequence is shown in SEQ ID NO.4, and the encoded protein is shown in SEQ ID NO.5.

[0068] Embodiment 4: QT12 Candidate gene analysis Chenghui 448 and OM1723 QT12 Sequencing of the target segment revealed nine polymorphic variations between the two varieties within the 3-kb promoter and CDS range, all of which occurred in the promoter upstream of the translation start site. These variations included three types of mutations: substitution, insertion, and deletion ( Figure 3 b). qRT-PCR in 5-DAF endosperm under natural field temperature showed that there was a significant difference between the two NILs. QT12 There was no significant difference in gene expression. However, under natural high temperature environment, NIL OM middle QT12 The expression of NIL CH middle QT12 The expression level remained basically unchanged ( Figure 3 c), indicating that high temperature can induce NIL OM middle QT12 The expression of QT12 Haplotype is dominant genotype.

[0069] right QT12 The two haplotypes were analyzed and found that in 533 micro-core accessions, Hap CH Compared to Hap OM The quality heat damage index is the difference between the chalkiness of 533 germplasm materials at high temperature and normal temperature, that is, the degree of increase in the chalkiness of the grains at high temperature. The lower the quality heat damage index, the better the heat resistance. CH Haploid varieties have higher quality and heat tolerance ( Figure 3 d). Using 5-DAF endosperm expression data from 119 core collections, we found that Hap CH There is a lower QT12 Expression level ( Figure 3 d) with NIL CH These results suggest that the resistant haplotype may have lower expression at high temperatures. QT12 , resulting in higher quality heat resistance.

[0070] Example 5: Parents QT12 Natural variation analysis After years of natural high temperatures in Wuhan fields, the resistant (R) and sensitive (S) varieties were identified. The endosperm samples were taken at different field temperatures for RNA-Seq analysis. It was found that the resistant varieties under high temperature QT12 The expression level of was significantly lower than that of sensitive varieties, but there was no significant difference at normal temperature ( Figure 4 a). Further analysis revealed that QT12 The G / A SNP variation on the promoter is almost exclusively found in indica rice ( Figure 4 b) In the indica rice variety, it contains QT12 A The varieties have lower quality heat damage index and lower QT12 Expression level ( Figure 4 c) Indications QT12 A The results above show that the higher heat tolerance of indica rice can explain the genetic basis of heat tolerance differences. QT12 The G / A variation in the promoter that only exists in indica rice may lead to lower expression levels under high temperature QT12 , thereby enhancing heat tolerance and explaining the differences in heat tolerance within indica rice.

[0071] Example 6: 533 core germplasm resources QT12 Haplotype analysis use QT12 The seven representative variants on QT12 It is divided into 7 haplotypes, among which Chenghui 448 belongs to Hap7 and OM1723 belongs to Hap3 ( Figure 5 a). The distribution analysis of each haplotype in the indica and japonica subpopulations revealed that QT12 With obvious indica-japonica differentiation ( Figure 5 a). In addition, QT12 There is a 6-bp InDel (CGCCGC) in the 5' UTR region, which can basically distinguish indica rice (-6bp) from japonica rice (+6bp) ( Figure 5 b, c). In order to further compare the QT12We used dual luciferase reporter gene assay to find that at 25°C and 37°C, the QT12 The promoter activity of japonica rice is significantly higher than that of indica rice. QT12 J The activity was significantly enhanced, but the indica promoter QT12 I There was no significant change in activity ( Figure 5 d). The present invention was previously identified QT12 The functional variation G / A is only found in indica rice ( Figure 4 b), so this functional variation G / A that only exists in indica rice and the 6-bp InDel variation between indica and japonica can be combined to form three major haplotypes Hap1, Hap3 and Hap7 ( Figure 5 a, b). These three haplotypes can clearly distinguish the endosperm of 119 core collections. QT12 The expression levels of QT12 A The haplotype with the lowest QT12 Expression level, indica QT12 G The expression level was in the middle, while in japonica rice QT12 G The highest expression level ( Figure 5 e), explaining the differences in heat tolerance within indica rice and the genetic basis for indica rice to be more heat tolerant than japonica rice.

[0072] Example 7: Rice QT12 Application of genes in regulating heat tolerance of rice quality (chalkiness, storage material content, taste quality, etc.) 1) OM1723 sensitive genotype QT12 G Complementation to the resistant parent Chenghui 448 reduces grain quality PCR-specific primer QT12-flag (Table 1) with restriction endonuclease KpnI and EcoRI linker was designed to amplify the OM1723 QT12 The amplified sequence contained the sequence shown in SEQ ID NO.2, that is, TATGACATGATTACGAATTC was added to the 5' end of SEQ ID NO.2, and GGTACCCGGGGATCCTCTAG was added to the 3' end. The Gibson ligation method (Gibson et al., 2009, Nat. Methods 6:343–345) was used to connect to pCAMBIA 1301 to obtain the recombinant vector pCAMBIA 1301-QT12 OM1723 .

[0073] The correctly cloned plasmid was introduced into Chenghui 448 by Agrobacterium-mediated indica rice genetic transformation system by transgenic method. After induction, subculture, infection, co-cultivation, selection of callus with hygromycin resistance, differentiation, rooting, seedling hardening and transplantation, transgenic rice plantlets were obtained. Transgenic complementation positive single plants were detected by QT12-F / 1301-flag-R (Table 1), and agarose gel electrophoresis was used to detect that the positive single plants had bands.

[0074] The heat tolerance of rice quality of transgenic positive lines was investigated compared with that of wild-type line Chenghui 448. QT12 -Com and wild type Chenghui 448 both showed a low chalkiness rate, while under natural high temperature conditions QT12- The chalkiness rate of the Com family was significantly higher than that of Chenghui 448 ( Figure 6 a, b), showing poor grain quality. At the same time, compared with normal temperature conditions, high temperature QT12 -Com significantly reduced the storage protein content and increased the amylose content, resulting in a significant decrease in the ratio of storage protein to amylose or starch content, leading to an imbalance in storage materials and thus the formation of grain chalkiness ( Figure 6 c, d). In contrast, Chenghui 448 maintained a relatively balanced state of storage material content and exhibited a low chalkiness phenotype ( Figure 6 These results suggest that QT12 The allele can significantly reduce the heat resistance of rice quality by disrupting the balance of storage substances in the endosperm tissue.

[0075] 2) CRISPR knockout of sensitive parent OM1723 ( QT12 G ) after synergistically improving grain quality (the knockout target is the sequence shown in SEQ ID NO.6) Using U3 plasmid as template, amplification was performed using QT12-U3 forward primer and U3 reverse primer; using U3 plasmid as template, amplification was performed using QT12-U3 reverse primer and U3 forward primer; the above two amplification products were recovered and mixed in equal amounts, and the mixture was used as template for amplification using U3 primer. After the products were recovered, they were introduced into pCXUN-CAS9 Plasmid (first cut with KpnI) (refer to CN201610639854.3), obtained pCXUN-CAS9 - QT12-U3 knockout vector.

[0076] Using transgenic methods, the correctly cloned pCXUN-CAS9-The QT12-U3 knockout vector was introduced into OM1723 through the Agrobacterium-mediated indica rice genetic transformation system. After induction, subculture, infection, co-cultivation, selection of callus with hygromycin resistance, differentiation, rooting, seedling training and transplanting, transgenic rice plantlets were obtained. QT12 -CR (Table 1) was used to detect the transgenic plants obtained, and QT12-U3-SEQ (Table 1) was used to sequence and confirm the positive plants with successful knockout.

[0077] The rice quality of CRISPR transgenic positive plants was investigated compared with that of wild-type OM1723 rice under high temperature in the field. QT12 -CR and sensitive wild type OM1723 showed lower chalkiness rate, while under natural high temperature conditions QT12 -CR family can still maintain a low chalkiness rate, which is reflected in better grain quality ( Figure 7 a, b). Compared with normal temperature, QT12 -CR family has almost no change in total protein and amylose / starch content under high temperature, which better maintains the balance of endosperm tissue storage substances, thus maintaining lower grain chalkiness and better quality ( Figure 7 c, d), which indicates QT12 Mutation or low expression of can confer high temperature tolerance to rice by better balancing the content of storage substances, thereby obtaining better rice quality under high temperatures.

[0078] 3) QT12 Verification of heat tolerance differentiation between indica and japonica rice: ZH11 japonica rice genotype QT12 J Complemented to the indica rice variety Sanhuangzhan-2 (SHZ; QT12 I ) will reduce the grain quality: PCR specific primer QT12-flag (Table 1) with restriction endonuclease KpnI and EcoRI linker was designed to amplify the gene of japonica rice ZH11. QT12 The amplified sequence contained the sequence shown in SEQ ID NO.3, that is, TATGACATGATTACGAATTC was added to the 5' end of SEQ ID NO.3, and GGTACCCGGGGATCCTCTAG was added to the 3' end. The Gibson ligation method (Gibson et al., 2009, Nat. Methods 6:343–345) was used to connect to pCAMBIA 1301 to obtain the recombinant vector pCAMBIA 1301-QT12 ZH11 .

[0079] The correctly cloned plasmid was introduced into the indica rice SHZ by the transgenic method through the Agrobacterium-mediated indica rice genetic transformation system. After induction, subculture, infection, co-cultivation, screening of callus with hygromycin resistance, differentiation, rooting, seedling hardening and transplanting, transgenic rice plantlets were obtained. The transgenic complementation positive individual plants were detected by QT12-F / 1301-flag-R (Table 1), and the positive individual plants were detected by agarose gel electrophoresis.

[0080] The heat tolerance of rice grain quality of transgenic positive lines was investigated compared with that of wild-type line SHZ. QT12 It shows obvious differentiation between indica and japonica. QT12 The effect of indica-japonica differentiation on the heat tolerance differentiation of indica and japonica rice QT12 J Genetic material of genotype complementation to indica rice SHZ QT12 J -Com were planted under different field temperature conditions. Under normal temperature, both the complementation positive family and the wild type SHZ had a low chalkiness phenotype ( Fig.10 a), while under high temperature in the field, the storage protein content of the complementary positive family decreased significantly, and the amylose content increased significantly, resulting in a significant decrease in the ratio of protein to amylose, breaking the balance of storage substances, resulting in increased chalkiness and poor quality ( Figure 8 ). The wild-type SHZ can maintain a certain balance between storage protein and amylose, thus showing better quality ( Figure 8 These results indicate that QT12 J Genotype can reduce the quality heat tolerance of indica rice, while QT12 The differentiation between indica and japonica may explain the genetic basis of why indica rice is more resistant to high temperatures than japonica rice.

[0081] 4) Constructing and verifying the near-isogenic line (NIL) in the 448 background QT12 Effects of two alleles on heat tolerance of quality Chenghui 448 was used as the donor parent and OM1723 as the recurrent parent. Backcrossing was performed more than 4 times (each backcross was supplemented with MAS, and a single plant with heterozygous markers of L12W7 and L12W8 and the same plant type as Chenghui 448 was selected as the male parent), and then self-segregated to screen out pure and NIL CH With NIL OM .

[0082] NIL OM and NIL CH Showing similar plant type, but NIL CH The rice showed lower chalkiness, lower amylose content and higher protein content under high temperature ( Fig. 9). Compared with room temperature, NIL CH The chalkiness of rice is kept relatively low by maintaining a balance between protein and amylose / starch ratio at high temperatures. OM This is manifested by a lower ratio of protein to amylose / starch content, and the balance is disrupted, thus leading to chalkiness.

[0083] 5) Verification of NIL cytology by electron microscopy QT12 Effects of two alleles on the development of endosperm storage materials under high temperature To evaluate the high temperature QT12 The effects on grain storage materials were investigated by scanning electron microscopy (SEM) to observe the starch structure of storage materials in the mature endosperm of the two NILs. OM The chalky endosperm of the high temperature kernels is filled with loosely packed spherical storage starch granules with large voids, whereas the NIL CH Under the same high temperature conditions, non-chalky kernels are composed of densely and regularly stacked polyhedral crystal storage grain structures. CH and NIL OM The chalky endosperm structure of Pyricularia australis and NIL under high temperature CH The performance is consistent, showing a dense crystal structure ( Fig.10 a). In order to further analyze the QT12 To investigate the subcellular causes of changes in the structure of endosperm storage materials in grains, we used transmission electron microscopy (TEM) to compare NIL CH and NIL OM Ultrastructure of 10-DAF endosperm cells under different temperature conditions. Compared with normal temperature, the number and area of ​​starch granules in the two NILs did not change significantly under high temperature, while the number and area of ​​protein bodies I and II in the two NILs decreased, but the heat-resistant family NIL CH The reduction of the two proteins in the sensitive family was much lower than that in the NIL OM , leading to resistant NIL CH The ratio of protein bodies to starch granules in terms of area and number is maintained at a higher level, which better maintains the steady-state balance of these two storage substances ( Fig.10 b–f). These subcellular evidences further support the conclusions on the relationship between storage material content and chalkiness: the balance and imbalance between storage protein and starch content under high temperature lead to high temperature resistance and sensitivity phenotypes, respectively.

[0084] 6) Construct Huazhan import system verification QT12 The breeding potential of resistant genotypes in improving heat tolerance of major high-quality varieties To evaluate QT12To investigate the breeding potential of the gene in improving rice quality, we selected the most common restorer line currently widely used in high-yield hybrid rice breeding in China, the superior variety Huazhan ( QT12 The allele is a genotype that is sensitive to high temperature in rice quality QT12 G ) as the object of improvement. With Chenghui 448 as the donor parent and Huazhan as the recurrent parent, backcrossing was performed for more than 4 times (MAS was used for each backcrossing, and a single plant with the same plant type as Huazhan was selected as the male parent), and then self-pollination was performed to screen out Huazhan. A With Huazhan G ( Fig.11 ). Under natural high temperature conditions, Huazhan A ( QT12 A ) has a higher G ( QT12 G ) Lower chalkiness and amylose content and higher protein content, resulting in better rice appearance and eating quality ( Fig.11 ). Huazhan A / G Heterozygous families and Huazhan G There were no significant differences in the quality traits among homozygous families ( Fig.11 ),show QT12 G is a dominant allele. Taken together, these results suggest that QT12 It has great potential to improve the quality of high-quality rice varieties under high temperatures.

[0085] Example 8: Large-scale field trials over many years and in many locations verify rice QT12 Application of genes in synergistically improving rice quality (chalky appearance quality, storage material content, taste quality, etc.) and yield and heat tolerance Among 533 core accessions and indica rice subgroup accessions, QT12 A The fruiting rate of the haplotype was significantly higher than QT12 G ( Fig.13 a). Therefore, QT12 The yield traits and taste quality of the genetic materials were investigated at different temperatures. The rice taste value represents the evaluation of the taste of cooked rice. The rice taste value of Yuzhenxiang (YZX), a famous high-quality rice variety in China with a high taste value, was set to 90 and used as the calibration standard. The taste value of each experimental sample was obtained through conversion and standardization.

[0086] There was no significant difference in chalkiness rate, fruit set rate and yield per plant between the two NILs at normal temperature in Wuhan in the summer of 2023. However, at high temperature, NILCH The fruit setting rate and yield per plant were significantly higher (+18.1%) than NIL OM , but the grain chalkiness rate was significantly lower than that of NIL OM In addition, under both temperature conditions, NIL CH The rice taste value of NIL is always higher than that of OM , and NIL at high temperature OM Taste value decreased significantly ( Fig.12 a, 13b). QT12 Complementary family QT12 -Com was significantly lower in fruit setting rate, yield per plant and rice taste value than the wild type Chenghui 448 (high resistance), the chalkiness rate was significantly increased, and the yield per plant was reduced by 40.7% ( Fig.12 b, 13c). In the CRISPR family QT12 -CR, the fruit set rate, grain number and thousand-grain weight increased significantly, resulting in a significant increase in grain yield per plant by 1.7 times. At the same time, the chalkiness rate of rice was significantly reduced, and the taste value of cooked rice was also significantly improved ( Fig.12 c, 13d). At the same time, the complementary materials after the japonica rice genotype was complemented to the indica rice SHZ QT12 J -Com positive families showed a significant decrease in fruit setting rate and yield under high temperature, and the rice taste value further decreased ( Fig.12 d, 13e). However, at normal temperature, various QT12 There were no significant changes in yield traits of the transgenic lines ( Fig.14 ).

[0087] To further evaluate QT12 The effect on rice quality and yield is as follows: QT12 Various genetic materials were tested in large-scale field trials in three major cities (Wuhan, Hangzhou and Changsha) in three provinces in the Yangtze River Basin of China (each genetic material family was planted in 3 or 4 plots, each plot was about 5 square meters, 12×15=180 plants). The Yangtze River Basin is the main rice producing area in my country. Extreme high temperatures have continuously broken records in the past 20 years, especially in the summer of 2024 ( Fig.15 a). Through the investigation of various yield traits, we found that under high temperature conditions in the field, the yield of NIL OM In contrast, NIL CH The fruit setting rates of the rice varieties increased by 50.6%, 55.8% and 14.6% respectively, and the yield per plant increased by 62.4%, 74.2% and 34.9% respectively ( Fig.15 bd). At the same time, large-scale field trials have shown that NIL OM In contrast, NIL CH The plot yield (4×5 m 2 or 3×5 m2 ) increased by 67.4%, 68.1% and 40.6% respectively ( Fig.15 c). Further investigation of rice quality phenotypes revealed that NIL CH The chalkiness rate and chalkiness of rice were significantly lower than those of NIL OM ( Fig.15 d, e). In addition, we further evaluated QT12 Genes play a role in improving the quality of Huazhan, a Chinese premium variety G ) in terms of yield and heat tolerance. QT12 A From Chenghui 448, Huazhan was introduced to generate an import system A Large-scale field trials in Wuhan, Hangzhou and Changsha have shown that G In comparison, Huazhan A The results showed that the seed setting rate was significantly increased by 13.6%, 32.5% and 10.9%, the yield per plant was increased by 46.9%, 80.8% and 28.0%, and the yield per plot was increased by 49.1%, 77.9% and 31.2% respectively. Fig.15 f, g). At the same time, we found Huazhan A The chalkiness rate and chalkiness of the seeds are also much lower than Huazhan G ( Fig.15 g, h). These multiple large-scale field trials further demonstrated QT12 A Effects of high temperatures on grain yield and quality.

[0088] In addition, we will conduct a pilot program in three major cities in the summer of 2024. QT12 The two main transgenic materials of the same high temperature treatment were subjected to large-scale field trials and phenotypic investigations. Compared with the wild type Chenghui 448 (high resistance), QT12 The fruit setting rate of the complementary families under high temperature was significantly reduced by 30.23%, 31.5% and 23.0%, and the yield per plant decreased by 52.6%, 50.0% and 44.1%, respectively. Fig.16 a–c). At the same time, compared with Chenghui 448 (high resistance), QT12 The yield of the complementary families under high temperature decreased significantly by 49.7%, 52.1% and 40.3% respectively ( Fig.15 b). Further investigation of grain quality showed that the chalkiness rate and chalkiness of grains in the complementary families were significantly increased ( Fig.16c, d). In contrast, the fruiting rate of the CRISPR knockout family was significantly increased by 37.6%, 43.5%, and 24.6% compared with the sensitive family OM1723, resulting in a significant increase in the yield per plant by 88.2%, 67.9%, and 60.5%, respectively ( Fig.16 e, f). At the same time, in the three major cities of Wuhan, Hangzhou and Changsha, the cell yield of CRISPR families increased by 92.5%, 64.1% and 54.7% respectively ( Fig.16 e), showing strong resistance to high temperatures. Further investigation of rice quality revealed that the CRISPR lineage showed lower grain chalkiness and chalkiness, showing better rice quality ( Fig.16 f, g). It is worth noting that all QT12 Other agronomic traits (grain width, plant height, growth period, etc.) of the relevant genetic materials did not change significantly ( Fig.17 , 18). These results suggest that low expression or non-functional QT12 It can simultaneously improve the heat resistance of rice quality and yield under natural field high temperature environment, which is of great significance for synergistically improving rice quality and yield under high temperature, and is conducive to breaking the breeding bottleneck of crop stress and growth, yield and quality contradictions.

[0089] Example 9: High temperature QT12 Effects on mRNA and protein expression levels exist Figure 3 c, high temperature can significantly upregulate NIL OM middle QT12 To further verify the effect of high temperature on the expression of QT12 mRNA and protein levels, we used QT12-Com transgenic families to perform qPCR and immunoblotting experiments of QT12-Flag fusion protein and found that high temperature can significantly induce QT12 -Com in QT12 G mRNA and protein expression levels, while the heat-resistant wild type QT12 A There was no significant change in the mRNA level of Fig.19 These results further prove that high temperature can induce QT12 G The protein level of QT12 in the sensitive haplotype, thereby negatively regulating the heat tolerance of rice grains.

[0090] The above results show that QT12 The gene is a negative regulator of heat tolerance in rice quality and yield, which proves that this gene can be used to improve rice varieties through genetic transformation and molecular marker-assisted breeding, including but not limited to the use of QT12 Improving heat tolerance in rice quality and yield.

[0091] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Application, any of the following: A) Use of rice QT12 protein, a nucleic acid molecule encoding the protein, or an expression cassette, a recombinant vector, a transgenic cell line or a recombinant bacterium containing the nucleic acid molecule in regulating the heat resistance of rice quality and yield or in preparing a product for regulating the heat resistance of rice quality and yield; B) Use of an agent that reduces the functional activity of QT12 protein in cultivating high-quality and high-yield heat-resistant rice germplasm or preparing a high-quality and high-yield heat-resistant rice germplasm product; The amino acid sequence of the QT12 protein is shown in SEQ ID NO.

5.

2. The use according to claim 1, characterized in that: Rice quality includes chalky appearance quality, storage material content, and taste quality, wherein chalky appearance quality includes chalkiness rate and chalkiness degree; storage material includes storage protein and amylose; the nucleotide sequence encoding the QT12 protein is shown in SEQ ID NO.

4.

3. A method for enhancing rice quality and yield under high temperature and / or cultivating quality and yield heat-resistant rice germplasm, characterized in that: The heat resistance of rice quality and yield is improved by knocking out, inhibiting or reducing the expression, function or activity of the QT12 gene or its encoded protein in rice, that is, the obtained rice better maintains the steady-state balance of rice storage protein and amylose content, low chalkiness and higher rice taste value under high temperature, while the fruit setting rate, number of filled grains and yield are increased. The protein sequence encoded by the QT12 gene is shown in SEQ ID NO.

5.

4. The method according to claim 3, characterized in that The substance that inhibits the expression amount or function of QT12 protein in rice is a CRISPR / Cas9 vector, and the target sequence targeted by the CRISPR / Cas9 vector is the polynucleotide site shown in SEQ ID NO.

6.

5. A SNP molecular marker that can distinguish the quality and yield heat tolerance of indica rice and indica and japonica rice, characterized in that: The SNP molecular marker is located at -1455 upstream of the QT12 gene promoter, and there is an A / G polymorphism, specifically, there is an A / G variation at position 2372 of the sequence shown in SEQ ID NO.3, wherein, when the SNP site is A, the rice is identified as indica rice, and exhibits a lower QT12 expression level and a lower quality heat damage index under high temperature, that is, higher quality heat tolerance.

6. An indel molecular marker related to heat tolerance capable of distinguishing the quality and yield of indica and japonica rice, characterized in that: The indel is a 6 bp deletion that exists or does not exist at positions 2828-2833 of the sequence shown in SEQ ID NO.

3. When the result is -6 bp, it is identified as indica rice.

7. A molecular marker combination related to QT12 expression and rice quality and yield heat tolerance, characterized in that: The molecular marker combination includes the SNP defined in claim 5 and the indel defined in claim 6, and the rice germplasm is further divided into three haplotypes according to the SNP and indel results, Hap1: G / + 6bp, Hap3: G / -6bp, Hap7: A / -6bp, among which haplotype Hap7 has the lowest QT12 expression level, Hap3 is in the middle, and the expression level of QT12 in Hap1 is the highest. The lower the QT12 expression level, the higher the quality and yield heat resistance.

8. Use of the molecular markers according to any one of claims 5 to 7 or a combination thereof in identifying or assisting in identifying indica and japonica rice and / or cultivating quality and yield heat-resistant rice germplasm, characterized in that: Rice with SNP result of A and / or indel result of -6bp was identified as indica rice, and rice with indel result of +6bp was identified as japonica rice. Rice with A, -6bp, and A / -6bp were selected according to the SNP and / or indel results for the coordinated breeding of rice germplasm with high quality and yield heat-resistant rice germplasm.

9. A method for identifying or assisting in identifying indica and japonica rice, characterized in that: Rice is detected using any molecular marker described in any one of claims 5 to 7 or a combination thereof, and rice with a SNP result of A and / or an indel result of -6 bp is identified as indica rice, and rice with an indel result of +6 bp is identified as japonica rice.

10. A method for cultivating high-quality and high-yield heat-tolerant rice germplasm, characterized in that: The rice is detected using any molecular marker described in any one of claims 5 to 7 or a combination thereof, and rice with A, -6bp, and A / -6bp is selected according to the SNP and / or indel results for coordinated breeding of quality and yield heat-resistant rice germplasm.

Images