Lipid nanoparticle and application thereof

Abstract

The invention provides a lipid nanoparticle and an application thereof. According to the method, a series of exploration is carried out on the proportion of a lipid material formula, an optimal cell culture and editing system, the proportion of Cas9mRNA: sgRNA of an editing system and Cas9mRNA design optimization, and a system suitable for transfection and editing of the human hematopoietic stem cells is found out. The problem that the existing transfection reagent in the market cannot effectively transfect the primary cells can be completely solved, the editing efficiency in the primary cells is remarkably improved, and a good treatment effect can be obtained in vivo.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to lipid nanoparticles and applications thereof. Background Art

[0002] As we all know, there are two major technical obstacles in the process of mRNA delivery into cells: (1) membrane barriers caused by electrostatic repulsion; (2) enzymatic degradation during delivery. Therefore, special modification or packaging delivery systems are required to achieve intracellular expression of mRNA, change the intracellular biodistribution, cell targeting and uptake mechanism of mRNA, promote the delivery of mRNA, and exert the post-translational effects of mRNA. To make up for the shortcomings of viral vectors, non-viral delivery systems have attracted more and more attention due to their low toxicity, potential for targeted delivery, long-term stability, high DNA / mRNA loading capacity, controllable chemical structure, low immunogenicity, and easy large-scale preparation. LNP (Lipid Nanoparticle) is considered to be the most promising non-viral vector for exogenous mRNA delivery.

[0003] Hematopoietic stem cells have specific receptors and markers on their surface. In order to achieve efficient transfection, LNP needs to be able to specifically recognize and bind to these receptors or markers. However, due to the low and complex expression levels of receptors and markers on the surface of hematopoietic stem cells, the targeting of LNP has become a problem. Therefore, how to effectively transfect human hematopoietic stem cells and significantly improve the editing efficiency in primary cells is an urgent problem to be solved in this field. Summary of the invention

[0004] To make up for the deficiencies of the prior art, the present invention provides a lipid nanoparticle and application thereof.

[0005] To achieve the above purpose, the present invention adopts the following technical solutions

[0006] The first aspect of the present invention provides a LNP-mRNA delivery system, which includes an LNP carrier loaded with one or more mRNAs, and the ratio of the LNP to the mRNA is (4-10):1.

[0007] Furthermore, the ratio of LNP to mRNA is (8-10):1.

[0008] Furthermore, the ratio of LNP to mRNA is 8:1.

[0009] Furthermore, the concentration of the oil phase in the LNP is 4-12 mM.

[0010] Furthermore, the concentration of the oil phase in the LNP is 6 mM.

[0011] Furthermore, the mRNA is Cas9 mRNA.

[0012] Furthermore, the LNP-mRNA delivery system also includes sgRNA.

[0013] Furthermore, the ratio of mRNA to sgRNA is (1-4):(1-3).

[0014] Furthermore, the ratio of mRNA to sgRNA was 1:2.

[0015] Furthermore, the LNP comprises ionizable amino lipids, PEG lipids, phospholipids and cholesterol.

[0016] Furthermore, the ionizable amino lipid is selected from ALC0315.

[0017] Further, the PEG lipid is selected from ALC0159 (DMG-PEG2000).

[0018] Furthermore, the phospholipid is selected from DSPC.

[0019] A second aspect of the present invention provides the use of GlutaMAX in preparing a product for improving protein translation in cells.

[0020] Furthermore, the cells are selected from hematopoietic stem cells.

[0021] Furthermore, the hematopoietic stem cells are human hematopoietic stem cells.

[0022] Furthermore, the increasing protein translation in the cells is to increase the translation of Cas9 mRNA in the cells after LNP transfection.

[0023] Furthermore, the product also includes cell culture medium.

[0024] Furthermore, the cell culture medium is selected from IMDM culture medium.

[0025] Furthermore, the IMDM culture medium also includes FBS, BSA, double antibody, SCF, interleukin, β-mercaptoethanol, and sodium pyruvate.

[0026] Furthermore, the interleukin is selected from IL-3.

[0027] A third aspect of the present invention provides a culture medium capable of improving protein translation in cells, wherein the culture medium comprises GlutaMAX.

[0028] Furthermore, the cells are selected from hematopoietic stem cells.

[0029] Furthermore, the hematopoietic stem cells are human hematopoietic stem cells.

[0030] Furthermore, the increasing protein translation in the cells is to increase the translation of Cas9 mRNA in the cells after LNP transfection.

[0031] Furthermore, the culture medium is a cell culture medium.

[0032] Furthermore, the cell culture medium is selected from IMDM culture medium.

[0033] Furthermore, the IMDM culture medium also includes FBS, BSA, double antibody, SCF, interleukin, β-mercaptoethanol, and sodium pyruvate.

[0034] Furthermore, the interleukin is selected from IL-3.

[0035] The fourth aspect of the present invention provides the use of the LNP-mRNA delivery system described in the first aspect of the present invention in transfecting and editing human hematopoietic stem cells.

[0036] The fifth aspect of the present invention provides use of the LNP-mRNA delivery system described in the first aspect of the present invention in preparing a pharmaceutical composition for treating a disease.

[0037] Furthermore, the disease is selected from sickle cell anemia.

[0038] Furthermore, the mobilization method of the pharmaceutical composition is a continuous mobilization method.

[0039] Furthermore, the mobilizing agents used in the continuous mobilization method are G-CSF and AMD3100, and the Primegene brand is the best for G-CSF.

[0040] Furthermore, the injection method of the pharmaceutical composition is subcutaneous injection.

[0041] Furthermore, the subcutaneous injection is a subcutaneous injection in the neck.

[0042] Furthermore, the pharmaceutical composition also includes pharmaceutically acceptable excipients.

[0043] Advantages and beneficial effects of the present invention:

[0044] This application conducts a series of explorations on the ratio of lipid material formula, optimal cell culture and editing system, editing system Cas9 mRNA:sgRNA ratio, and Cas9 mRNA design optimization, and explores a system suitable for transfection and editing of human hematopoietic stem cells. While saving costs, this application can completely replace the problem that the existing transfection reagents on the market cannot effectively transfect primary cells, achieve a significant improvement in the editing efficiency in primary cells, and thus obtain a good therapeutic effect in vivo. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Conventional synthetic LNP and transfection reagent RNAiMax can efficiently transfect K562 cells, but cannot transfect human hematopoietic stem cell CD34 + Cell map;

[0046] Figure 2 is the effect of LNP formulation on particle size, PDI and surface potential of LNP-mRNA;

[0047] Figure 3 Is the LNP-EGFP mRNA formulation effective for CD34 + Effect diagram of cell transfection efficiency and activity;

[0048] Figure 4 LNP-encapsulated mRNA can stably and effectively transfect human hematopoietic stem cells CD34 + Cell map;

[0049] Figure 5 Human hematopoietic stem cell CD34 + Diagram of optimal LNP oil phase concentration for cell transfection;

[0050] Figure 6 This is a diagram of the editing strategy for the sgRNA HBG targeted site;

[0051] Figure 7 It is a picture of cells edited with different ratios of LNP-encapsulated Cas9 mRNA and sgRNA (1×NLS Cas9mRNA);

[0052] Figure 8 It is GlutaMAX TM Figure 1: The additive significantly improves protein translation in human hematopoietic stem cell editing in vitro (1×NLS Cas9 mRNA);

[0053] Fig. 9 It is the bar graph and original peak graph of editing efficiency detection after LNP encapsulated Cas9 mRNA and sgRNA with different nuclear entry signals edited cells;

[0054] Fig.10 This is the CFU clone formation imaging and editing efficiency diagram of LNP-encapsulated Cas9 mRNA and sgRNA edited cells after being inoculated on solid culture medium;

[0055] Fig.11 HBG mRNA, HbF and CD235a were detected after LNP encapsulated 3×NLS Cas9 mRNA / sgRNA edited cells + CD71 + Group diagram;

[0056] Fig.12 This is a graph showing the positive rate of mouse hematopoietic stem cell LSK in peripheral blood of mice after GROβ+AMD3100 injection at different time points;

[0057] Fig.13 This is a graph showing the positive rate of mouse hematopoietic stem cell LSK in peripheral blood of mice after G-CSF+AMD3100 injection at different time points;

[0058] Fig.14 This is a diagram exploring the delivery efficiency of mouse hematopoietic stem cells at subcutaneous injection sites of different mobilizing agents;

[0059] Fig.15 This is a graph showing the editing efficiency of different mouse bone marrow populations 1 week after LNP-3×NLS Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice in vivo;

[0060] Fig.16 This is a graph showing the activated globin content in the peripheral blood of humanized sickle cell anemia mice detected by high performance liquid chromatography 2 weeks after LNP-3×NLS Cas9 mRNA / sgRNA was injected into the mice;

[0061] Fig.17 This is a graph showing the positive rate of peripheral blood globin-expressing cells and mRNA content detected by flow cytometry and qPCR at different time points after LNP-3×NLS Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice in vivo;

[0062] Fig.18 This is a graph showing the detection of peripheral blood routine indicators of red blood cell count (RBC), hematocrit (HCT), and hemoglobin content (HGB) in mice with humanized sickle cell anemia after LNP-3×NLS Cas9 mRNA / sgRNA was injected into the mice at the end of treatment;

[0063] Fig.19 This is a picture of the peripheral blood cell morphology, reticulocytes and sickle cells detected in mice at the end of treatment after LNP-3×NLS Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice in vivo;

[0064] Fig. 20 This is a graph of the detection of hepatitis-related factors alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB) in the peripheral blood of mice and survival analysis at the end of treatment after LNP-3×NLS Cas9 mRNA / sgRNA injection of humanized sickle cell anemia. DETAILED DESCRIPTION

[0065] The definitions of some terms used in this specification are provided below. Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0066] The present invention provides an LNP-mRNA delivery system, which comprises an LNP carrier loaded with one or more mRNAs, and the ratio of the LNP to the mRNA is (4-10):1.

[0067] In some embodiments, the LNP comprises ionizable amino lipids, PEG lipids, phospholipids, cholesterol.

[0068] In some embodiments, ionizable amino lipids refer to a class of lipid molecules containing an amino group (-NH2 or -NR2, R is an alkyl group) and can be ionized under specific conditions, including but not limited to ALC0315 and SM-102.

[0069] In a specific embodiment, the ionizable amino lipid is selected from ALC0315.

[0070] In some embodiments, PEG lipids (PEGylated lipids) are lipid molecules modified with polyethylene glycol (PEG). The PEG lipids are selected from ALC0159 (DMG-PEG2000).

[0071] In some embodiments, phospholipids are lipids containing phosphoric acid and are the main components of biological membranes. The phospholipids include glycerophospholipids, sphingomyelin, and other phospholipids.

[0072] Among them, glycerophospholipids include phosphatidylcholine (phosphatidylcholine), cephalin (phosphatidylethanolamine), serine phospholipids (phosphatidylserine), inositol phospholipids (phosphatidylinositol), and phosphatidylglycerol.

[0073] In a preferred embodiment, the phospholipid is selected from glycerophospholipids, the glycerophospholipid is selected from phosphatidylcholine (phosphatidylcholine), and the phosphatidylcholine (phosphatidylcholine) is selected from DSPC (distearoylphosphatidylcholine).

[0074] The present invention provides the use of GlutaMAX in preparing a product for improving protein translation in cells.

[0075] In some embodiments, the product can be a culture medium. The culture medium is any culture medium suitable for hematopoietic stem cells, including but not limited to IMDM culture medium, RPMI-1640 culture medium, DMEM / F-12 culture medium, Culture medium, StemSpan TM SFEM medium.

[0076] In a specific embodiment, the culture medium is selected from IMDM medium.

[0077] In some embodiments, the culture medium further comprises other factors, including but not limited to FBS, BSA, double antibody, SCF, interleukin, β-mercaptoethanol, sodium pyruvate, erythropoietin (EPO), granulocyte stimulating factor (G-CSF), and megakaryocyte stimulating factor (M-CSF).

[0078] The present invention provides the use of the LNP-mRNA delivery system or the lipid nanoparticles in preparing a pharmaceutical composition for treating a disease.

[0079] The pharmaceutical composition also includes pharmaceutically acceptable excipients.

[0080] In some embodiments, a pharmaceutically acceptable excipient is used to refer to a material that is compatible with a recipient, preferably a mammal, more preferably a human, and is suitable for delivering an active agent to a target site without terminating the activity of the agent. Toxicity or side effects (if any) associated with the pharmaceutically acceptable excipient are preferably commensurate with a reasonable risk / benefit ratio for the intended use of the active agent.

[0081] Pharmaceutically acceptable excipients include, but are not limited to, diluents, adhesives, surfactants, wetting agents, adsorption carriers, lubricants, fillers, and disintegrants. These excipients are used to help the stability of the formulation or to help improve the activity or its biological effectiveness or to produce an acceptable taste or smell in the case of oral administration. The preparations that can be used in this medicine can be in the form of the original compound itself or optionally in the form of a pharmaceutically acceptable salt thereof. The pharmaceutical composition thus prepared can be administered in any appropriate manner known to those skilled in the art as needed.

[0082] Among them, the diluent includes but is not limited to lactose, sodium chloride, glucose, urea, starch, and water.

[0083] Binders include, but are not limited to, starch, pregelatinized starch, dextrin, maltodextrin, sucrose, gum arabic, gelatin, methylcellulose, carboxymethylcellulose, ethylcellulose, polyvinyl alcohol, polyethylene glycol, polyvinylpyrrolidone, alginic acid and alginates, xanthan gum, hydroxypropyl cellulose and hydroxypropyl methylcellulose.

[0084] Surfactants include, but are not limited to, polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearic acid monoglyceride, and cetyl alcohol.

[0085] Humectants include, but are not limited to, glycerin.

[0086] Adsorption carriers include, but are not limited to, bentonite, silica gel, kaolin, and bentonite.

[0087] Lubricants include, but are not limited to, zinc stearate, glyceryl monostearate, polyethylene glycol, talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, hydrogenated vegetable oil, sodium stearyl fumarate, polyoxyethylene monostearate, monolauric sucrose ester, sodium lauryl sulfate, magnesium lauryl sulfate, and magnesium dodecyl sulfate.

[0088] Fillers include, but are not limited to, mannitol (granular or powdered), xylitol, sorbitol, maltose, erythrose, microcrystalline cellulose, polymeric sugars, coupling sugars, glucose, lactose, sucrose, dextrin, starch, sodium alginate, laminarin powder, agar powder, calcium carbonate, and sodium bicarbonate.

[0089] Disintegrants include, but are not limited to, cross-linked vinyl pyrrolidone, sodium carboxymethyl starch, low-substituted hydroxypropyl methyl, cross-linked sodium carboxymethyl cellulose, and soybean polysaccharides.

[0090] The invention will be further described below in conjunction with specific examples. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the invention. The main features of the invention may be used in a variety of embodiments without departing from the scope of the invention.

[0091] Example 1 Study on the formulation and preparation process of LNP carrier

[0092] 1. Experimental Materials and Methods

[0093] 1) Experimental Materials

[0094] Lipid material formula: ALC0315 (medkoo, 556006), ALC0159 (medkoo, 556014), DSPC (Avanti, 850365), Cholesterol (Echelon Biosciences, L-6012); Quant-iT TM RNA reagent (Thermo Fisher, R11490), Triton TM X-100 solution (Sigma-Aldrich, 93443); citric acid (C6H8O7·H2O), sodium citrate (C6H5Na3O7·2H2O), DEPC water; sterile enzyme-free ultrapure water, anhydrous ethanol, PBS buffer; syringe with spiral mouth (Xinhua), 1.5ml, 15ml, 50ml sterile enzyme-free tubes, ultrafiltration tubes (Merck, UFC903024), high-speed centrifuge, microplate reader, Malvern dynamic light scattering instrument.

[0095] 2) Experimental methods

[0096] Lipid ethanol solution was prepared according to the molar ratio of ALC0315: DSPC: Chol: ALC0159 (DMG-PEG2000) of 50:10:38.5:1.5. After the concentration of mRNA was measured, it was diluted to the required concentration using pH = 4 sodium citrate solution according to the lipid concentration. The LNP preparation device was built using a syringe pump, T-junction and connecting pipes. The ethanol solution of lipid molecules and the mRNA aqueous solution were mixed in a certain proportion to obtain LNP-mRNA. The collected solution was diluted 50 times with PBS. After ultrafiltration purification, the particle size, uniformity and ζ potential of LNP-mRNA were measured using a dynamic light scattering instrument. Quant-iT TM Triton for RNA detection TM The amount of nucleic acid in the X-100 solution before and after demulsification was calculated based on the difference in the amount of nucleic acid to obtain the drug loading capacity and encapsulation efficiency.

[0097] Figure 1 :Effects of LNPs encapsulating EGFP-mRNA on human myeloid leukemia K562 cells and human hematopoietic stem cells CD34 + The cells were transfected and divided into the following groups: K562 cells were untreated negative control group (Control), LNP-EGFP mRNA transfection group (LNP), RNA transfection reagent RNAiMAX positive control group (RNAiMAX); CD34 + There were negative control group (Control) without cell treatment, LNP-EGFP mRNA transfection group (LNP), and RNA transfection reagent RNAiMAX positive control group (RNAiMAX).

[0098] The cells were gently pipetted and the cell suspensions were collected using 1640 medium containing 1% double antibody and 10% FBS (K562 cells); IMDM medium containing 30% FBS, 10% BSA, 1% double antibody, SCF, IL-3, β-mercaptoethanol, and sodium pyruvate (CD34 + Cells). Centrifuge at 800 rpm for 5 min at room temperature (K562), and at 800 g for 10 min at room temperature (CD34 + cells), and 0.5×10 6 cells / 24-well plate. RNAiMAX, an RNA transfection reagent, was used as a control transfection experiment. For the LNP transfection group, LNPs with mRNA encapsulation were directly added, and the transfection amount reached 1 μg. The EGFP positive rate and cell viability of the cells were detected by flow cytometry.

[0099] LNP synthesis with different relative ratios of cationic lipid and mRNA

[0100] Figure 2 : The synthesis process is shown in 1) and 2). Four types of LNPs were synthesized according to the relative mass ratio of cationic lipid to mRNA of 4:1-10:1, and the particle potential, particle size and PDI were physically characterized and detected using a Malvern particle sizer.

[0101] Figure 3 :CD34 + The cells were not treated with negative control group, LNP-EGFP mRNA transfection group (4 kinds of LNPs were synthesized according to the relative mass ratio of cationic lipid to mRNA of 4:1-10:1 to transfect CD34 + After the cells were transfected, the Figure 1 The transfection dose was 1 μg, and the EGFP positive rate and cell viability were detected by flow cytometry at 48 h.

[0102] Figure 4 :CD34 + Cells were untreated in negative control group, LNP-EGFP mRNA transfection group (different dose groups 1, 2, 4, 8 μg) transfected with CD34 + After the cells were transfected, the Figure 1 The samples were collected at different time points (48, 72, and 96 h) and the EGFP positive rate and cell viability were detected by flow cytometry.

[0103] Figure 5 After the ratio of cationic lipid to mRNA was determined to be 8:1, the total lipid concentration in the ethanol phase was configured to 12mM, 8mM, 6mM, and 4mM, respectively, and mixed with the aqueous phase to prepare different LNPs (different dose groups of 2 and 4μg) for transfection of CD34 + After the cells were transfected, the Figure 1 The green fluorescence intensity of the cells was observed under a fluorescence microscope after 48 hours.

[0104] Figure 7 :LNPs were synthesized at different Cas9 mRNA:sgRNA ratios. The synthesis process is shown in Figure 7 Four kinds of LNPs were synthesized according to the ratio of 1×NLS Cas9mRNA (synthesized by Yunzhou Biotechnology Co., Ltd.): sgRNA (synthesized by Sythgo, sgRNA sequence: CUUGUCAAGGCUAUUGGUCA (SEQ ID NO: 1)) Cas9 mRNA and sgRNA of 4:1, 3:1, 2:1, 1:2, and 1:3, respectively. The particle potential, particle size, and PDI were physically characterized and detected using a Malvern particle sizer. CD34 was transfected at a dose of 4 μg +Cells and K562 cells were transfected in the same manner. Figure 1 The supernatant was discarded after centrifugation at 800 g for 10 min at room temperature, and DNA was extracted using a DNA extraction kit (Quanshijin, EE181-01). After PCR amplification, agarose electrophoresis was performed, and the bands were cut and sent for Sanger first-generation sequencing to detect gene editing.

[0105] Editing system Cas9 mRNA: sgRNA ratio, Cas9 mRNA nuclear entry signal design, and exploration of the optimal editing system

[0106] Figure 8 :GlutaMAX TM No added group (0mM), GlutaMAX TM Add low dose group (1mM), GlutaMAX TM Add medium dose group (2mM), GlutaMAX TM A high dose group (4 mM) was added.

[0107] LNP-1×NLS Cas9 mRNA / sgRNA transfected cells were transfected with CD34 at a dose of 4 μg + Cells, culture medium system see Figure 1 The culture system used in the experiment was supplemented with different concentrations of GlutaMAX. TM , 72 h after transfection, the cell lysate was collected and processed to extract proteins for Western blotting experiments, Cas9 protein reagent (Cell Signaling Technology, 14697), GAPDH antibody (Proteintech, 20536-1-AP).

[0108] Fig. 9 :CD34 + The cells were untreated in the negative control group, LNP-1×NLS Cas9 mRNA / sgRNA transfection group, and LNP-3×NLS Cas9 mRNA / sgRNA transfection group. Based on the Cas9 mRNA with one nuclear entry signal (NLS), a Cas9 mRNA with three NLSs was designed (synthesized by Yunzhou Biotechnology). LNP was synthesized at a ratio of 1:2 for Cas9 mRNA:sgRNA, and transfected into CD34 at a dose of 4 μg. + Cells were induced to differentiate into the erythroid lineage 72 h after transfection (3 dpt). Cells were centrifuged at 800 g for 10 min at room temperature at different time points (ED d4-ED d8), and the supernatant was discarded. DNA was extracted using a DNA extraction kit (Quanshijin, EE181-01). After PCR amplification, agarose electrophoresis was performed, and the bands were cut out and sent for Sanger first-generation sequencing to detect gene editing.

[0109] Fig.10 :CD34 + CD34 T cells were collected from the untreated negative control group, LNP-1×NLS Cas9 mRNA / sgRNA transfection group, and LNP-3×NLS Cas9 mRNA / sgRNA transfection group 72 hours after transfection. + After 15 days of inoculation of cells in solid culture medium (stemcell, H4434), the cells were photographed under a microscope and CFU colonies were collected to extract DNA for detection of gene editing. DNA was extracted using a DNA extraction kit (Quanshijin, EE181-01), agarose electrophoresis was performed after PCR amplification, and the bands were cut and sent for Sanger first-generation sequencing to detect gene editing.

[0110] Fig.11 :CD34 + Cells were collected and washed in PBS on the 4th day after erythroid differentiation induction in the untreated negative control group and LNP-3×NLS Cas9 mRNA / sgRNA transfection group after transfection, and the total RNA content was isolated using the manufacturer's protocol (Full-Form Gold, ER601-01-V2). Reverse transcription was performed using M-MLV reverse transcriptase (Promega, Madison, Wisconsin, USA). The expression levels of GAPDH, HBB, and HBG were analyzed using real-time quantitative PCR. All real-time PCR reactions were performed using the Biorad real-time PCR detection system. The quality of the product was confirmed by melting curve analysis. The following expression primers were used: forward (F) primer CATTGCCCTCAACGACCACT (SEQ ID NO: 2) and reverse (R) primer GGTGGTCCAGGGGTCTTACT (SEQ ID NO: 3) for GAPDH, F primer GCCCTGGCCCACAAGTATC (SEQ ID NO: 4) and R primer GCCCTTCATAATATCCCCCAGTT (SEQ ID NO: 5) for HBB, and F primer GGTGACCGTTTTTGGCAATCC (SEQ ID NO: 6) and R primer GTATCTGGAGGACAGGGCAC (SEQ ID NO: 7) for HBG. The HBG mRNA percentage refers to the HBG mRNA abundance expressed relative to the sum of the abundance of γ-globin and β-globin transcripts ([HBG / (HBB+HBG]*100)).

[0111] To determine the expression of HbF in cells, the cells were fixed, permeabilized and stained using an intracellular staining kit (InsideStain Kit, Miltenyi Biotec) and anti-HbF-Fitc antibody (Miltenyi Biotec) according to the manufacturer's instructions, and then detected by flow cytometry.

[0112] To detect the erythroid differentiation ability of cells, Brilliant Violet 421 TM After incubating the cells with anti-human CD71 Antibody (Biolegend, 334121) and APC anti-human CD235ab Antibody (Biolegend, 306608), the cells were washed with PBS and then tested on the assay machine.

[0113] 2. Experimental results

[0114] 1) Ratio of lipid material formula

[0115] First, when LNP synthesis was performed according to the conventional description in the literature, the obtained particles were the same as the common transfection reagent RNAiMAX (negative control) on the market, which could efficiently transfect K562 cells, but could not effectively transfect human hematopoietic stem cells in vitro ( Figure 1 ).

[0116] The influence of the relative ratio of cationic lipids to mRNA (4:1-10:1) on the physical and chemical properties of LNP-mRNA was further investigated. First, the prepared nanoparticles had a small particle size and good uniformity. The particle size was kept at about 100nm and the PDI was good (≤0.3 is appropriate). In addition, as the proportion of cationic lipids increased, the potential gradually increased ( Figure 2 ). In human hematopoietic stem cells CD34 + Studies have shown that a low or high ratio of cationic lipids will significantly affect the transfection positive rate. When the ratio of the two is 8:1 or 10:1, the transfection efficiency is the best and does not affect the cell viability ( Figure 3 ).

[0117] The above results show that cationic lipids have a great influence on the transfection of LNP into human hematopoietic stem cells and are the key components in the lipid formulation. When optimizing the lipid formulation, it is necessary to comprehensively consider the type, ratio and absolute concentration of cationic lipids. When the ratio of cationic lipid: EGFP mRNA is 8:1, the particle size is stable (about 100nm), the PDI is the smallest, that is, the particle size is uniform, and the transfection efficiency is good. Therefore, this ratio will be selected for subsequent experiments.

[0118] The results of continuous detection up to 96h showed that the transfection efficiency gradually increased with time and finally maintained at a high transfection efficiency of 98% ( Figure 4 ), cell activity assay showed that the liposomes did not affect the normal growth of cells.

[0119] 2) Optimal concentration of oil phase for transfection of hematopoietic stem cells

[0120] When synthesizing LNP, it is divided into an ethanol phase (dissolving lipid materials, referred to as the oil phase) and an aqueous phase (dissolving mRNA, referred to as the aqueous phase). This application study found that on the basis of the optimal ratio of LNP formula that can transfect human hematopoietic stem cells, only by adjusting the oil phase concentration, the lipid transfection of human hematopoietic stem cells and the strong expression of EGFP fluorescent protein can be further enhanced. For human hematopoietic stem cells, when LNP is synthesized, the best effect is to keep the oil phase concentration at 6mM ( Figure 5 ).

[0121] 3) Editing system Cas9 mRNA: sgRNA ratio, Cas9 mRNA nuclear entry signal design, and exploration of the optimal editing system. At present, gene regulatory elements are used as targets to reactivate γ-globin (HBG) expression to treat thalassemia and sickle anemia. They are not affected by mutation sites and have a wide range of uses, which has become a trend in the past two years. BCL11A protein negatively regulates the expression of HbF protein. This application targets the BCL11A binding site in the promoter region of the HBG gene for gene editing to achieve activation of γ-globin expression. In 1×NLS Cas9 mRNA

[0122] (Cas9-Nucleoplasmin NLS), two additional nuclear import signals were added, namely 3×NLS Cas9mRNA (Myc NLS-Cas9-SV40 NLS-Nucleoplasmin NLS), and the editing strategy sgRNA HBG targeting site was shown in Figure 6 .

[0123] The above-mentioned LNP basic formula was used to encapsulate the editing system. In view of the fact that primary cells are difficult to transfect and edit, this application synthesized LNP-Cas9 mRNA:sgRNA-HBG=4:1, 3:1, 2:1, 1:2, 1:3. After in vitro transfection of cells, the editing efficiency was detected at 48 hours. The results showed that for human hematopoietic stem cells, the editing efficiency was highest when the ratio was 1:2, indicating that for human hematopoietic stem cells, there is an optimal ratio for the content of the two RNAs, and too much or too little will significantly affect the editing efficiency of primary cells. In addition, when the ratio was 1:2, the efficient editing of K562 cells reached 80%, and that of CD34 cells was 1:2. + Cell editing reached 8%, further indicating that the difficulty of transfection and editing of primary cells is much greater than that of transfection and editing of cell lines ( Figure 7 ).

[0124] To further improve editing efficiency, this study found that adding GlutaMAX to the culture medium TM The additive can significantly improve the translation of Cas9 mRNA in human hematopoietic stem cells after LNP transfection. Subsequent experiments use this culture medium system for the next step of the experiment ( Figure 8 ).

[0125] It is known that Cas9 mRNA is translated and imported into the nucleus for editing. Based on Cas9 mRNA with one nuclear import signal (NLS), this application designs a nuclear import signal with three NLSs. After encapsulation with LNP, 4 μg of transfected cells are used to edit human hematopoietic stem cells. The results show that 3×NLS Cas9 mRNA achieves the highest editing effect ( Fig. 9 ), and the in vitro transfection system of the present application can achieve up to 70% editing with only a low dose of 4 μg, which is a lower dose than existing studies. For primary cells such as human hematopoietic stem cells, the design of nuclear entry signals (type selection and quantity) is crucial.

[0126] After 72 hours of LNP-1×NLS Cas9 mRNA / sgRNA and LNP-3×NLS Cas9 mRNA / sgRNA transfection, cells were inoculated into solid culture medium, and photographed under a microscope 15 days later to detect editing efficiency. The results showed that compared with untransfected cells, LNP-1×NLS Cas9 mRNA / sgRNA and LNP-3×NLS Cas9 mRNA / sgRNA transfection had no significant effect on progenitor cell colony formation. At the same time, LNP-3×NLS Cas9 mRNA / sgRNA transfection cells had higher colony editing efficiency ( Fig.10 ). Since the editing strategy of this application is to activate the expression of γ-globin, the CD34 + The cells were induced to differentiate into erythroid cells and the results showed that the cells were phenotypically different from those without CD34 + Compared with the cells, the expression of HBG mRNA in the transfected cells increased significantly on Day 4 after induction. The expression of globin HbF detected by flow cytometry on Day 4, Day 8, and Day 11 was significantly higher than that in the untreated group. + CD71 + There was no significant effect on the population positive rate between the two groups, indicating that the optimized editing system in this application is effective in editing primary cell CD34 + cells, without affecting the normal erythroid differentiation ability of the cells ( Fig.11 ).

[0127] In summary, this application has explored a mature system for in vitro transfection and editing of human hematopoietic stem cells. From the adjustment of each parameter process, it has been successfully achieved that basic LNP can be used at low doses to achieve efficient transfection and editing of human hematopoietic stem cells without connecting any antibodies, and significantly improve globin expression. Compared with other studies, it saves costs and is easier to synthesize.

[0128] Example 2 Study on factors affecting in vivo delivery

[0129] 1. Experimental Methods

[0130] Fig.12 :After dissolving and injecting mice (subcutaneously) according to the reagent instructions, 50 μL of blood was collected from the tail vein at different time points and incubated with mouse antibody PerCP Cy5 anti-Mouse Lin - , BV510 anti-Mouse Ckit, PE-Cy7 anti-MouseSca1, to detect the positive rate of mouse hematopoietic stem cells mobilization from the bone marrow to the peripheral blood.

[0131] Fig.13 :After dissolving and injecting mice (subcutaneously) according to the reagent instructions, 50 μL of blood was collected from the tail vein at different time points and incubated with mouse antibody PerCP Cy5 anti-mouse Lin - , BV510 anti-mouse Ckit, PE-Cy7 anti-mouseSca1, to detect the positive rate of mouse hematopoietic stem cells mobilization from the bone marrow to the peripheral blood (all antibodies are from Biolegend).

[0132] Fig.14 : PBS injection control group, LNP-EGFP mRNA injection group (mobilization injection in different sites).

[0133] After synthesizing LNP-EGFP mRNA according to the optimal formula, it was injected into mice through the tail vein. After 24 hours, the mouse bone marrow cells were obtained and incubated with mouse antibody BV605 anti-mouse Lin - , BV421 anti-mouse Ckit, PE-Cy7 anti-mouse Sca1, PE anti-mouse CD135, APC anti-mouse CD34, flow cytometry detection of the positive rate of EGFP mRNA expression in different mouse hematopoietic stem cell populations LSK, LT-LSK, and ST-LSK (all antibodies are from Biolegend).

[0134] Fig.15 : Disease mice untreated group, disease mice LNP treated group

[0135] After LNP-Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice, bone marrow cells were obtained from mice 1 week after tail vein injection and incubated with mouse antibody BV605 anti-mouse Lin - , BV421anti-mouse Ckit, PE-Cy7 anti-mouse Sca1 (antibodies are from Biolegend). After different populations of mouse hematopoietic stem cells were sorted by flow cytometry, DNA was extracted using a DNA extraction kit (Quanshijin, EE181-01), PCR amplification was performed by agarose electrophoresis, and the bands were cut and sent for Sanger first-generation sequencing to detect gene editing.

[0136] Figure 16-Figure 17 : Healthy control group, disease mouse untreated group, disease mouse LNP treated group

[0137] After LNP-Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice, peripheral blood was collected from mice at 2 weeks, 10 weeks, and 12 weeks after tail vein injection. Ultrapure water was added and repeatedly frozen and thawed to obtain protein supernatant, and then high-performance liquid chromatography (HPLC) was used to detect whether the γ-globin chain was activated; after extracting mRNA from peripheral blood of mice, qPCR was performed, and the detailed operation was the same as Fig.11 method.

[0138] Figure 18-Figure 20 : After LNP-Cas9 mRNA / sgRNA was injected into humanized sickle cell anemia mice in the healthy control group, the disease mouse untreated group, and the disease mouse LNP treated group, peripheral blood was collected from the mice 16 weeks after tail vein injection, and RBC, HGT, and HGB indicators were detected by routine blood testing instruments; ALT, AST, and ALB were detected by biochemical instruments; blood smears were subjected to Giemsa, new methylene blue staining, and sickle type experiment, and then observed and photographed under a microscope; finally, a survival curve was made according to the death of mice.

[0139] 2. Experimental results

[0140] 1) Exploration of different mobilization drug combinations and drug injection methods in mice

[0141] After synthesizing LNP according to the above optimal formula, we first hope to mobilize hematopoietic stem cells in the bone marrow into the peripheral blood by using a mobilizing agent, which will be more conducive to combining with LNP injected into the tail vein, thereby improving the delivery efficiency.

[0142] ① Exploration of different mobilization agent combinations to mobilize mouse bone marrow hematopoietic stem cells into peripheral blood: divided into rapid mobilization method (GROβ+AMD3100 combination) and continuous mobilization method (G-CSF+AMD3100 combination, in which G-CSF contains 2 different brands). The results showed that the continuous mobilization method was significantly more effective than the rapid mobilization method in mobilizing mouse hematopoietic stem cells LSK into peripheral blood. In addition, in the continuous mobilization method, the effects of different brands of G-CSF were also very different. The continuous mobilization method (G-CSF-Primegene+AMD3100) combination will be used for the next experiment ( Figure 12-13 ).

[0143] ②Exploration of the effect of different mobilization sites on the delivery efficiency of mouse hematopoietic stem cells: Based on the above exploration, the optimal mobilization agent combination was confirmed. On this basis, the drug delivery efficiency was also very different at different mobilization sites (subcutaneous injection of the neck, subcutaneous injection of the abdomen): The expression of EGFP mRNA in mouse hematopoietic stem cells (long-term hematopoietic stem cells and short-term hematopoietic stem cells) injected subcutaneously in the neck was significantly higher than that injected subcutaneously in the abdomen ( Fig.14 ).

[0144] In summary, this application is the first to explore different hematopoietic stem cell mobilization methods and different administration methods to develop a set of optimal combination methodologies for the efficiency of LNP delivery to hematopoietic stem cells in vivo. Then, using this scheme and the LNP encapsulation editing system, humanized disease mice were treated in vivo and achieved significant results.

[0145] 2) In vivo treatment of humanized sickle cell anemia

[0146] One week after low-dose, single-injection transfection of mouse HSPCs, the bone marrow LSK editing efficiency was as high as 20%, globin expression was significantly increased, the ratio of peripheral blood globin-positive cells increased, the proportion of abnormal morphological red blood cells such as sickle-shaped decreased, the abnormal increase in reticulocytes was significantly reduced, and the phenotypes such as blood routine were successfully corrected. The biochemical indicators ALT and AST showed that there was no abnormal increase in the treatment group, that is, no obvious in vivo toxicity was caused in the mice. In addition, the survival time of the diseased mice was significantly prolonged. During the treatment period, there was no death of mice in the treatment group compared with the untreated group ( Figure 15-20 ).

[0147] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. A LNP-mRNA delivery system, characterized in that: The LNP-mRNA delivery system comprises an LNP carrier loaded with one or more mRNAs, wherein the ratio of the LNP to the mRNA is (4-10):1; preferably, the ratio of the LNP to the mRNA is (8-10):1; Preferably, the ratio of LNP to mRNA is 8:

1.

2. The LNP-mRNA delivery system according to claim 1, characterized in that The concentration of the oil phase in the LNP is 4-12 mM; Preferably, the concentration of the oil phase in the LNP is 6 mM; Preferably, the mRNA is Cas9 mRNA; Preferably, the LNP-mRNA delivery system further comprises sgRNA; Preferably, the ratio of mRNA to sgRNA is (1-4): (1-3); Preferably, the ratio of mRNA to sgRNA is 1:

2.

3. The LNP-mRNA delivery system according to claim 1, characterized in that The LNP includes ionizable amino lipids, PEG lipids, phospholipids, and cholesterol; Preferably, the ionizable amino lipid is selected from ALC0315; Preferably, the PEG lipid is selected from ALC0159; Preferably, the phospholipids are selected from DSPC.

4. Application of GlutaMAX in the preparation of products that enhance protein translation in cells; Preferably, the cells are selected from hematopoietic stem cells; Preferably, the hematopoietic stem cells are human hematopoietic stem cells; Preferably, the increasing protein translation in the cell is increasing the translation of Cas9 mRNA in the cell after LNP transfection.

5. The use according to claim 4, characterized in that: The product further comprises a cell culture medium; preferably, the cell culture medium is selected from IMDM culture medium; Preferably, the IMDM culture medium further comprises FBS, BSA, double antibody, SCF, interleukin, β-mercaptoethanol, and sodium pyruvate; Preferably, the interleukin is selected from IL-3.

6. A culture medium capable of increasing protein translation in cells, characterized in that The culture medium includes GlutaMAX; Preferably, the cells are selected from hematopoietic stem cells; Preferably, the hematopoietic stem cells are human hematopoietic stem cells.

7. The culture medium according to claim 6, characterized in that The improving protein translation in the cell is to improve the translation of Cas9 mRNA in the cell after LNP transfection; Preferably, the culture medium is a cell culture medium; Preferably, the cell culture medium is selected from IMDM medium; Preferably, the IMDM culture medium further comprises FBS, BSA, double antibody, SCF, interleukin, β-mercaptoethanol, and sodium pyruvate; Preferably, the interleukin is selected from IL-3.

8. Use of the LNP-mRNA delivery system according to any one of claims 1 to 3 in transfecting and editing human hematopoietic stem cells.

9. Use of the LNP-mRNA delivery system according to any one of claims 1 to 3 in preparing a pharmaceutical composition for treating a disease.

10. The use according to claim 9, characterized in that: The disease is selected from sickle cell anemia; Preferably, the mobilization method of the pharmaceutical composition is a continuous mobilization method; Preferably, the mobilizing agents used in the continuous mobilization method are G-CSF and AMD3100; Preferably, the pharmaceutical composition is injected subcutaneously; Preferably, the subcutaneous injection is a subcutaneous injection in the neck; Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

Images