Method for screening targeted specific membrane protein phage

Abstract

The invention belongs to the technical field of biology, and discloses a method for screening specific membrane protein targeting bacteriophages, which can be used for quickly and effectively enriching target bacteriophages in environmental samples and specifically screening and separating out the specific membrane protein targeting bacteriophages. The bacteriophage uses a specific membrane protein as a receptor and can infect bacteria containing the specific membrane protein, so that the screening efficiency of the target bacteriophage is remarkably improved. According to the screening method, the period required by a traditional screening method is shortened, the randomness of the traditional screening method is reduced, and an effective method is provided for screening the phage targeting the specific membrane protein.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for screening phages targeting specific membrane proteins. Background Art

[0002] When isolating wild phages from the environment by traditional methods, environmental samples containing phages (soil, sewage, sludge, etc.) are usually used. After certain pretreatments (such as filtration, concentration, etc.), they are mixed with host bacteria (i.e., the target strain of phages to be screened) for co-culture. After the phages in the sample that can lyse the host bacteria are fully amplified, a single plaque (a transparent area formed by the phage lysing the bacteria on the plate) is separated from the culture medium through a double-layer semi-solid plate test. After multiple rounds of purification of a plaque, a phage strain can be obtained.

[0003] Environmental samples are mixtures of a large number of different types of phages, and the phages obtained after screening are usually random. If you want to isolate phages with specific phenotypes from the phage mixture, you need to separate single plaques from the phage mixture through a double-layer plate, and then verify the phages in the single plaques one by one. At this time, the probability of obtaining the target phage depends on the proportion of the phage in the entire mixture. Since there are many types of phages in phage mixtures such as environmental samples, when the number of target phages accounts for a small proportion (low initial proportion), or the amplification speed under culture conditions is not as fast as other phages (low proportion after amplification), it is difficult to obtain the required target phage from a limited number of plaques.

[0004] Therefore, in order to increase the probability of obtaining the target phage, a certain amount of screening pressure is usually applied during the screening process to eliminate unnecessary phages and make it easier for phages that meet the requirements to remain, so as to increase the proportion of the population and ultimately increase the probability of obtaining the target phage. Without appropriate screening pressure, the screening process will be random and inefficient.

[0005] At present, if you want to obtain a phage that targets a specific receptor on the surface of bacteria from a phage mixture, there is no good design for screening pressure. The usual method is to separate the phages and then verify them one by one. If the target phage accounts for a very low proportion, it may take a lot of verification to obtain the target phage, which is highly random and inefficient. If the target phage has a weak proliferation ability and its number after amplification is much lower than that of other phages, it is almost impossible to be screened out.

[0006] In order to screen phages targeting specific bacterial surface receptors, how to design a suitable screening pressure to increase the probability of obtaining the target phage is a technical problem that urgently needs to be solved. Summary of the invention

[0007] The purpose of the first aspect of the present invention is to provide a method for screening phages targeting target membrane proteins.

[0008] The second aspect of the present invention aims to provide a phage targeting a specific membrane protein.

[0009] The third aspect of the present invention aims to provide application of the screening method of the first aspect of the present invention in screening phages targeting specific receptors.

[0010] In order to achieve the above object, the technical solution adopted by the present invention is:

[0011] The first aspect of the present invention provides a method for screening phage targeting a target membrane protein, comprising the following steps:

[0012] Phage enrichment to obtain phage solution;

[0013] The phage solution is mixed with the host bacteria with the target membrane protein knocked out, and the solid-liquid separation is performed, and the supernatant is collected; the above steps are repeated to obtain the phage targeting the target membrane protein.

[0014] In some embodiments of the present invention, the titer of unadsorbed phages in the supernatant is determined, the phage adsorption rate is calculated, and the optimal infection multiplicity and culture time of the phage solution and the host bacteria with target membrane protein knockout are determined by the phage adsorption rate.

[0015] In some embodiments of the present invention, the phage solution is mixed with the host bacteria with the target membrane protein knocked out, the solid and liquid are separated, and the supernatant is collected; and the above steps are repeated 2 to 6 times.

[0016] In some embodiments of the present invention, the phage adsorption rate is calculated by the formula: phage adsorption rate = initial phage titer - unadsorbed phage titer) ÷ initial phage titer × 100%.

[0017] In some embodiments of the present invention, the host bacteria include at least one of Escherichia coli, Vibrio parahaemolyticus, Vibrio alginolyticus, Vibrio harveyi, Vibrio vulnificus, Vibrio erwinia, Pseudomonas aeruginosa, Shigella, Salmonella, Acinetobacter baumannii, Klebsiella pneumoniae, Stenotrophomonas maltophilia, Staphylococcus aureus, and Proteus.

[0018] In some embodiments of the present invention, when the target membrane protein is the membrane protein TolC, the multiplicity of infection of the phage solution and the host bacteria with the target membrane protein knocked out is 0.0001 to 0.1.

[0019] In some embodiments of the present invention, when the target membrane protein is the membrane protein TolC, the multiplicity of infection of the phage solution and the host bacteria with the target membrane protein knocked out is 0.001 to 0.1.

[0020] In some embodiments of the present invention, when the target membrane protein is the membrane protein TolC, the multiplicity of infection of the phage solution and the host bacteria with the target membrane protein knocked out is 0.001 to 0.01.

[0021] In some embodiments of the present invention, when the target membrane protein is membrane protein TolC, the culturing time is 1 to 20 minutes.

[0022] In some embodiments of the present invention, when the target membrane protein is membrane protein TolC, the culturing time is 5 to 20 minutes.

[0023] In some embodiments of the present invention, when the target membrane protein is membrane protein TolC, the culturing time is 5 to 15 minutes.

[0024] In some embodiments of the present invention, the phage enrichment method includes the following steps: sterilizing a sample containing phages and then mixing and culturing the sample with host bacteria to obtain a phage solution.

[0025] In some embodiments of the present invention, the culture conditions for phage enrichment are 18-38° C., 100-250 rpm, and 1-5 h.

[0026] In some embodiments of the present invention, the sample containing bacteriophages includes but is not limited to soil, sludge, and sewage.

[0027] In some embodiments of the present invention, the solid-liquid separation includes separation by centrifugation, filtration, or natural sedimentation.

[0028] In some embodiments of the present invention, the screening method further comprises a phage purification step.

[0029] In some embodiments of the present invention, the purification step includes: gradient dilution of the supernatant containing the targeted membrane protein phage after screening to obtain a dilution; and culturing the dilution in a double-layer agar plate containing the host bacteria until plaques appear on the plate; picking a single plaque and resuspending it with a buffer; repeating the above steps 2 to 3 times to obtain the purified targeted membrane protein phage.

[0030] In some embodiments of the present invention, the screening method also includes a phage identification step, including culturing the screened phage targeting the target membrane protein on a double-layer agar plate containing a host bacterium with a target membrane protein knocked out, a host bacterium with a target membrane protein not knocked out, or a host bacterium with target membrane protein expression restored (i.e., the host bacterium with a target membrane protein knocked out re-expresses the knocked-out target membrane protein through biological means) for 5 to 20 hours until plaques appear, observing the differences in the plaques on the three plates, and determining the phage titer.

[0031] The second aspect of the present invention provides a phage targeting membrane protein TolC obtained by screening using the screening method of the first aspect of the present invention.

[0032] The third aspect of the present invention provides the use of the screening method of the first aspect of the present invention in screening phages targeting specific receptors.

[0033] The beneficial effects of the present invention are:

[0034] The phage screening method provided by the present invention can quickly and effectively enrich the target phage in the environmental sample, and can specifically screen and separate the phage targeting the specific membrane protein, that is, the phage uses the specific membrane protein as a receptor and can infect the bacteria containing the specific membrane protein, thus significantly improving the screening efficiency of the target phage. The screening method shortens the cycle required by the traditional screening method, reduces the randomness of the traditional screening method, and provides an effective method for screening the phage targeting the specific membrane protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 A schematic diagram of the process of the screening method for phage targeting specific membrane proteins provided by the present invention.

[0036] Figure 2 These are plaques formed by the phages in Example 2 of the present invention on different strains; wherein A is a plaque formed by the phages on Escherichia coli MG1655, and B is a plaque formed by the phages on Escherichia coli MG1655ΔtolC. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below through specific examples.

[0038] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0039] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If no specific conditions are specified in the embodiments, the conventional conditions or the conditions recommended by the manufacturer are followed. The biological materials, reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0040] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0041] Example 1

[0042] A rapid screening method for phage targeting specific membrane proteins, the technical solution flow chart is as follows Figure 1 , the specific steps include the following:

[0043] (1) Sample processing and phage enrichment

[0044] Collect environmental samples with rich phage content such as soil, silt, and sewage, add appropriate amount of buffer to make suspension, then centrifuge at 10000g, 5min, 4℃ to take supernatant to preliminarily remove solid impurities and bacteria, and filter the obtained supernatant through 0.22μm pore size filter to sterilize and obtain sample filtrate. Take the sample filtrate and inoculate it with Escherichia coli grown to logarithmic phase into liquid LB culture medium, culture at 37℃, 200rpm for a short time to enrich the phage in the sample, centrifuge the culture at 10000g, 5min, take supernatant, filter the supernatant containing phage through 0.22μm pore size filter to sterilize and obtain phage enrichment liquid. Take Escherichia coli grown to logarithmic phase and mix with 0.5% agar concentration semi-solid LB culture medium and pour it onto solid LB plate to make double-layer agar plate. The enrichment solution was diluted in a gradient manner, and each gradient dilution solution was spotted on the above double-layer agar plate. After the spotted solution dried, it was cultured at 37°C until obvious plaques appeared on the plate, and the titer of phage in the enrichment solution was calculated.

[0045] (2) Preliminary isolation of bacteriophage

[0046] Ⅰ. Take the phage enrichment solution, mix it with the target membrane protein knockout strain of Escherichia coli grown to the logarithmic phase, at a multiplicity of infection of 0.0001-1, incubate it in liquid LB medium for 5-20 minutes, collect the incubations at different incubation times under each multiplicity of infection, centrifuge at 10000g for 5 minutes, and take the supernatant to remove the bacteria and the phages that have infect the bacteria. The phages in the supernatant are the phages that are not adsorbed by the host. Filter the supernatant with a 0.22μm pore size filter membrane for sterilization to obtain the phage adsorption solution. The adsorption solution was diluted in a gradient manner, and each gradient dilution solution was spotted on a double-layer agar plate prepared from Escherichia coli. After the spotted solution dried, it was cultured at 37°C until obvious plaques appeared on the plate. The titer of unadsorbed phages in the adsorption solution was determined, and the phage adsorption rate at different incubation times under each multiplicity of infection was calculated based on the titer, i.e. (initial phage titer - unadsorbed phage titer) ÷ initial phage titer × 100%, so as to determine the optimal multiplicity of infection and incubation time.

[0047] Ⅱ. Take the phage enrichment solution, mix it with the Escherichia coli target membrane protein knockout strain that has grown to the logarithmic phase according to the optimal infection multiplicity and incubation time determined in the above steps, and incubate it in liquid LB culture medium, so that the Escherichia coli target membrane protein knockout strain adsorbs the phage of non-target target membrane protein, while the phage targeting the target membrane protein (i.e., the target phage) is retained in the culture medium. The obtained incubation is centrifuged at 10,000g for 5 minutes, and the supernatant is taken to remove the bacteria and the non-target phage that has infected the bacteria. The supernatant containing the target phage is sterilized by filtering with a 0.22μm pore size filter membrane to obtain the first round of target phage enrichment solution. Repeat this step 3 to 6 times to obtain the final target phage enrichment solution;

[0048] (3) Isolation and purification of bacteriophage

[0049] Ⅰ. Gradient dilution of the target phage mixture, mix each gradient dilution with Escherichia coli grown to the logarithmic phase, and then mix with 0.5% agar concentration semi-solid LB medium and pour it onto a solid LB plate to make a double-layer agar plate, and culture at 37°C until obvious plaques appear on the plate. For the plate with a single plaque, pick a single plaque and fully oscillate it in SM or PBS buffer to release the phage in the solid culture medium, and then sterilize and filter it through a 0.22μm pore size filter membrane to obtain a phage solution. The obtained phage solution continues to separate single plaques according to the above method, and repeat this step 2 to 3 rounds to obtain a purified phage solution;

[0050] Ⅱ. Take the purified phage solution and spot it on the double-layer agar plates prepared by Escherichia coli and the target membrane protein knockout strain, respectively. After the spot solution dries, incubate it at 37°C until obvious plaques appear on the plates. Observe the plaques formed by the same phage on the two plates, and pick out the phages with lower transparency and smaller number on the double-layer agar plates of the target membrane protein knockout strain of Escherichia coli (i.e., target phages) for purification.

[0051] (4) Screening and identification of bacteriophages

[0052] Ⅰ. Take the phages screened above and spot them on double-layer agar plates prepared from Escherichia coli and the target membrane protein knockout strain, respectively. After the spot solution dries, incubate at 37°C until obvious plaques appear on the plates, and observe the difference in plaques on the two plates.

[0053] Ⅱ. Further confirm the phages selected above. Gradient dilution of the target phage, each gradient dilution solution is respectively spotted on a double-layer agar plate prepared from Escherichia coli, Escherichia coli target membrane protein knockout strain and Escherichia coli target membrane protein expression recovery strain, and after the spot solution dries, it is cultured at 37°C until obvious plaques appear on the plate, and the titer of the target phage produced on the three plates is measured. Among them, the Escherichia coli target membrane protein expression recovery strain is a mutant in which the Escherichia coli target membrane protein knockout strain re-expresses the knocked-out membrane protein encoding gene and restores the expression of the target membrane protein.

[0054] The above technical solution can quickly and effectively screen and separate phages targeting specific membrane proteins, that is, this type of phage uses specific membrane proteins as receptors and can infect bacteria containing specific membrane proteins.

[0055] Preferably, the Escherichia coli in the above screening method is MG1655 or other Escherichia coli strains, and the target membrane protein knockout strain is the corresponding Escherichia coli membrane protein TolC knockout strain, or other single membrane protein knockout strain, or a knockout strain of two or more membrane proteins.

[0056] Preferably, the target membrane protein knockout strain of Escherichia coli described in the above screening method re-expresses the knocked-out membrane protein encoding gene in a manner including expression on the genome and expression on a plasmid.

[0057] Example 2

[0058] Taking the screening of E. coli phages targeting the membrane protein TolC as an example, the screening method of Example 1 was used to screen E. coli phages specifically targeting the membrane protein TolC.

[0059] A total of four E. coli phages targeting membrane protein TolC were screened and named P TolC -11, P TolC -26, P TolC -28 and P TolC -32, the specific screening method is as follows:

[0060] (1) Sample processing and phage enrichment

[0061] Collect environmental samples with rich phage content such as soil, silt, and sewage, add appropriate amount of buffer to make suspension, then centrifuge at 10000g, 5min, 4℃ to take supernatant to preliminarily remove solid impurities and bacteria, and filter the obtained supernatant through a 0.22μm pore size filter membrane to sterilize and obtain sample filtrate. Take 100μL sample filtrate and 20μL Escherichia coli MG1655 grown to logarithmic phase and inoculate into 2mL liquid LB culture medium, culture at 37℃, 200rpm for 2h to enrich phages in the sample, centrifuge the culture at 10000g, 5min, take supernatant, filter the supernatant containing phages through a 0.22μm pore size filter membrane to sterilize and obtain phage enrichment solution. Take Escherichia coli MG1655 grown to logarithmic phase and mix with 0.5% agar concentration semi-solid LB culture medium and pour it onto a solid LB plate to make a double-layer agar plate. Gradient dilution of phage enrichment solution 1~10 8 Each gradient dilution was spotted on the above double-layer agar plate. After the spotted solution dried, it was cultured at 37°C until obvious plaques appeared on the plate. The titer of phage in the enriched solution was calculated.

[0062] (2) Preliminary isolation of bacteriophage

[0063] Ⅰ. Take the phage enrichment solution and mix it with 1×10 8 cfu / mL, the Escherichia coli MG1655 membrane protein TolC knockout strain MG1655ΔtolC grown to the logarithmic phase, were mixed at infection multiplicity of 0.1, 0.01 and 0.001, respectively, and incubated in liquid LB medium for 5min, 10min and 15min, respectively. The incubations at different incubation times under each infection multiplicity were collected, and the supernatant was taken after centrifugation at 10000g for 5min to remove the bacteria and the phages that have infect the bacteria. The phages in the supernatant are the phages that have not been adsorbed by Escherichia coli MG1655ΔtolC. The supernatant was sterilized by filtering with a 0.22μm pore size filter membrane to obtain the phage adsorption solution. Gradient dilution of the adsorption solution 1-10 8 times, each gradient dilution was spotted on a double-layer agar plate prepared from Escherichia coli MG1655 (same as step (1)), and after the spot solution dried, it was cultured at 37°C until obvious plaques appeared on the plate, and the titer of unadsorbed phages in the adsorption solution was determined. The phage adsorption rate at different incubation times under different multiplicity of infection was calculated based on the titer. The Escherichia coli MG1655ΔtolC was obtained by knocking out the gene tolC encoding the membrane protein TolC in Escherichia coli MG1655 using the CRISPR-Cas9 gene editing technology disclosed in the research. The nucleotide sequence of the gene tolC encoding the membrane protein TolC is shown in SEQ ID NO:1.

[0064] ATGAAGAAATTGCTCCCCATTCTTATCGGCCTGAGCCTTTCTGGGTTCAGTTCGTTGAGCCAGGCCGAGAACCTGATGCAAGTTTATCAGCAAGCACGCCTTAGTAACCCGGAATTGCGTAAGTCTGCCGCCGATCGTGATGCTGCCTTTGAAAAAATTAATGAAGCGCGCAGTCCATTACTGCCACAGCTAGGTTTAGGTGCAGATTACACCTATAGCAACGGCTACCGCGACGCGAACGGCATCAACTCTAACGCGACCAGTGCGTCCTTGCAGTTAACTCAATCCATTTTTGATATGTCGAAATGGCGTGCGTTAACGCTGCAGGAAAAAGCAGCAGGGATTCAGGACGTCACGTATCAGACCGATCAGCAAACCTTGATCCTCAACACCGCGACCGCTTATTTCAACGTGTTGAATGCTATTGACGTTCTTTCCTATACACAGGCACAAAAAGAAGCGATCTACCGTCAATTAGATCAAACCACCCAACGTTTTAACGTGGGCCTGGTAGCGATCACCGACGTGCAGAACGCCCGCGCACAGTACGATACCGTGCTGGCGAACGAAGTGACCGCACGTAATAACCTTGATAACGCGGTAGAGCAGCTGCGCCAGATCACCGGTAACTACTATCCGGAACTGGCTGCGCTGAATGTCGAAAACTTTAAAACCGACAAACCACAGCCGGTTAACGCGCTGCTGAAAGAAGCCGAAAA(SEQ ID NO: 1).

[0065] The results are shown in Table 1, which determined that the optimal infection multiplicity and incubation time for adsorption were 0.01 and 10 min, respectively. Under these conditions, the phage adsorption rate was the highest, at 55.88%.

[0066] Table 1 Phage adsorption rate under different adsorption conditions

[0067]

[0068] Ⅱ. Take the phage enrichment solution and incubate it with 1×10 8 cfu / mL of Escherichia coli MG1655ΔtolC grown to the logarithmic phase, and incubated in 3 mL of liquid LB medium, so that Escherichia coli MG1655ΔtolC adsorbs phages of non-targeted membrane protein TolC, while phages targeting membrane protein TolC (i.e., target phages) are retained in the culture medium. The obtained incubation was centrifuged at 10,000g for 5 minutes, and the supernatant was taken to remove the bacteria and non-target phages that have invaded the bacteria. The supernatant containing the target phage was sterilized by filtering with a 0.22μm pore size filter membrane to obtain the first round of target phage enrichment solution. Repeat this step 3 to 6 times to obtain the final target phage enrichment solution;

[0069] (3) Isolation and purification of bacteriophage

[0070] Ⅰ. Gradient dilution of the target phage mixture 1 to 10 4 times, 100 μL of each gradient dilution was mixed with 50 μL of Escherichia coli MG1655 grown to the logarithmic phase, and then mixed with 0.5% agar concentration semi-solid LB medium and poured onto a solid LB plate to make a double-layer agar plate, and cultured at 37°C for 6 to 16 hours until obvious plaques appeared on the plate. On the plate with single plaques, 32 single plaques were picked and placed in 1 mL SM buffer and shaken fully to release the phages in the solid culture medium to obtain a phage resuspension. The SM buffer used was formulated as follows: 200 mM NaCl, 10 mM Mg2SO4·7H2O, 50 mL Tris-HCl (pH=7.5), pure water was added and stirred to dissolve, the volume was fixed to 1000 mL, 115°C, 20 min high pressure steam sterilization was used. The above phage resuspension was sterilized and filtered through a 0.22 μm pore size filter membrane to obtain a phage solution. The obtained phage solution is further separated into single plaques according to the above method, and this step is repeated 2 to 3 rounds to obtain a purified single phage solution.

[0071] Ⅱ. Take 10 μL of the purified phage solution and spot it on a double-layer agar plate prepared with 50 μL of E. coli MG1655 or 50 μL of E. coli MG1655ΔtolC, respectively. After the spot solution dries, incubate it at 37°C for 6 to 16 hours until obvious plaques appear on the plate. Observe the plaques formed by the same phage on the two plates, and select the phage with lower transparency and smaller number on the E. coli MG1655ΔtolC double-layer agar plate (i.e., the target phage) for purification to obtain P TolC -11, P TolC -26, P TolC -28 and P TolC-32 four target phages. At the same time, a phage with no difference in transparency and quantity in the double-layer agar plates of Escherichia coli MG1655 and MG1655ΔtolC (i.e., non-target phage) was randomly selected for purification to obtain phage P1.

[0072] (4) Screening and identification of bacteriophages

[0073] Ⅰ. Take 20 μL of each of the four phage strains selected above and spot them on a double-layer agar plate prepared with 50 μL of E. coli MG1655 or 50 μL of E. coli MG1655ΔtolC. After the spot solution dries, incubate at 37°C for 6 to 16 hours until obvious plaques appear on the plate, and observe the plaque formation results.

[0074] The results are as follows Figure 2 As shown, compared with Escherichia coli MG1655, the plaques formed by the four phages on Escherichia coli MG1655ΔtolC lacking the membrane protein TolC are more blurred, indicating that the absence of the membrane protein TolC receptor affects the infection and lysis of the host by the phage.

[0075] Ⅱ. To further confirm the four phage strains selected above, the four phage strains were gradiently diluted 1 to 10 8 Times, take 10μL of each gradient dilution and spot on a double-layer agar plate prepared by 50μL E. coli MG1655, 50μL E. coli MG1655ΔtolC or 50μL E. coli MG1655ΔaraBADΔtolC / pBAD-tolC, wait for the spot liquid to dry and culture at 37℃ for 6-16h until obvious plaques appear on the plate, and calculate the titers of the four phages on the three plates. Among them, E. coli MG1655ΔaraBADΔtolC / pBAD-tolC is a strain in which E. coli MG1655ΔtolC re-expresses the tolC gene through the pBAD plasmid to restore the expression of the membrane protein TolC. The E. coli MG1655ΔaraBADΔtolC / pBAD-tolC is obtained by first knocking out the araBAD gene of E. coli MG1655 using the CRISPR-Cas9 gene editing technology disclosed in the research, then knocking out the gene tolC encoding the membrane protein TolC, and then introducing the pBAD plasmid connected to the tolC gene. The nucleotide sequence of the araBAD gene is shown in SEQ ID NO: 2; the nucleotide sequence of the tolC gene is shown in SEQ ID NO: 1; the pBAD plasmid is a plasmid publicly sold on the market.

[0076]

[0077] The results are shown in Table 2. Compared with E. coli MG1655, the titers of the four target phages in E. coli MG1655ΔtolC lacking the membrane protein TolC were significantly reduced, P TolC -11, P TolC -26, P TolC -28 and P TolC -32 were reduced by 39.13%, 27.5%, 42.30% and 40.98% respectively, while after the expression of membrane protein TolC was restored in Escherichia coli MG1655ΔtolC, the titers were equivalent to those produced in Escherichia coli MG1655, confirming that the four phages can target the membrane protein TolC, indicating that this screening method can quickly and effectively screen phages targeting specific membrane proteins.

[0078] Table 2 Titers of target phages formed on different plates

[0079]

[0080] Example 3

[0081] This example further verifies that the screening method of Example 1 can effectively enrich the target phage in the environmental sample, as follows:

[0082] Experimental group: Take the target phage P screened in Example 2 TolC -32, and the phage P1 of the non-targeted membrane protein TolC obtained by simultaneous screening in Example 2 were mixed at a ratio of 4:6 to obtain a phage mixture. The phage mixture was mixed with 1×10 8 cfu / mL of E. coli MG1655ΔtolC grown to the logarithmic phase, mixed at a multiplicity of infection of 0.01, and incubated in 3 mL of liquid LB medium for 10 min. The obtained incubation was centrifuged at 10000g for 5 min, and the supernatant was taken, and then sterilized by filtering through a 0.22 μm pore size filter membrane. This step was repeated 3 times, and the supernatant obtained after each incubation was saved;

[0083] Blank control group: Take the phage mixture described in the above experimental group in the same amount as the experimental group, and incubate in 3 mL of liquid LB medium for 10 minutes. The obtained incubation was centrifuged at 10000g for 5 minutes, and the supernatant was taken, and then filtered through a 0.22μm pore size filter membrane for sterilization. Repeat this step 3 times for a total of 3 rounds, and save the supernatant obtained after each incubation;

[0084] The supernatant was diluted 1 to 10 8Times, take 10 μL of each gradient dilution and spot it on a double-layer agar plate prepared with 50 μL E. coli MG1655 or 50 μL E. coli MG1655ΔtolC. After the spot solution dries, culture it at 37°C for 6 to 16 h until obvious plaques appear on the plate, and calculate the titer of the phage produced on the two plates.

[0085] The experimental results are shown in Tables 3 and 4. From Table 3, it can be seen that the phage titer of the blank control group was relatively stable throughout the experiment, indicating that the stability of the experimental system was good. TolC -32 in the incubation solution, the results are shown in Table 4. It can be seen that after incubation, the phage P TolC The proportion of PTolC-32 increased continuously, from the initial 43.66% to the highest 81.33%, indicating that the phage P1 of the non-targeted membrane protein TolC was continuously adsorbed and removed during this period, so the phage PTolC-32 was enriched. TolC -32 was adsorbed and removed in the last round of incubation, so its proportion was slightly reduced. In general, the screening method of the present invention can effectively enrich phages targeting target membrane proteins.

[0086] Table 3 Phage titer

[0087]

[0088] Table 4 Bacteriophage P TolC -32%

[0089]

[0090] Note: Bacteriophage P TolC The proportion of -32 in the incubation medium = (MG1655 double-layer agar plate phage titer - MG1655ΔtolC double-layer agar plate phage titer) ÷ MG1655 double-layer agar plate phage titer.

[0091] Example 4

[0092] This example further verifies that the screening method of Example 1 can improve the screening efficiency of target phages, as follows:

[0093] Conventional screening method: First, the target phage is screened using a conventional screening method, that is, the phage enrichment solution of step (1) of Example 1 is diluted by 1 to 10 4100 μL of each gradient dilution was mixed with 50 μL of E. coli MG1655 grown to the logarithmic phase, and then mixed with 0.5% agar concentration semi-solid LB medium and poured onto a solid LB plate to make a double-layer agar plate and cultured at 37°C for 6 to 16 hours until obvious plaques appeared on the plate. On the plate with single plaques, 32 single plaques were picked and placed in 1 mL SM buffer to fully oscillate to release the phages in the solid culture medium, and sterilized and filtered through a 0.22 μm pore size filter membrane to obtain a phage solution. The obtained phage solution continued to separate single plaques according to the above method, and repeated this step 2 to 3 rounds to obtain a purified phage solution.

[0094] The above conventional screening process was repeated for 3 rounds, with 32 phages screened in each round.

[0095] Take 10 μL of the purified phage solution and spot it on the double-layer agar plates prepared with E. coli MG1655 and E. coli MG1655ΔtolC, respectively. After the spot solution dries, incubate it at 37°C for 6 to 6 hours until obvious plaques appear on the plates. Observe the plaques formed by the same phage on the two plates to see whether there are phages with lower transparency and fewer numbers on the E. coli MG1655ΔtolC double-layer agar plates.

[0096] A total of 3 batches of different environmental samples were used for testing in the experiment, and the results are shown in Table 5. Compared with the screening method of the present invention, that is, the screening method described in Example 2, using the traditional screening method, when only a small amount of equal phages were picked, the plaques formed by the picked phages on the double-layer agar plates prepared from Escherichia coli MG1655 and Escherichia coli MG1655ΔtolC were indistinguishable, that is, no target phages were screened; while using the method described in Example 2, 4 and 2 target phages that met the requirements were screened out in the first and third batches of samples, respectively, indicating that the screening method of the present invention can more effectively screen phages targeting target membrane proteins.

[0097] In summary, different from traditional screening methods, the screening method involved in the present invention can quickly screen the target phage within a small amount of work.

[0098] Table 5 Screening results of different screening methods

[0099]

[0100] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A method for screening phage targeting a target membrane protein, comprising the following steps: Phage enrichment to obtain phage solution; The phage solution is mixed with the host bacteria with the target membrane protein knocked out, solid-liquid separation is performed, and the supernatant is collected; By repeating the above steps, phage targeting the target membrane protein is obtained.

2. The screening method according to claim 1, characterized in that The titer of the unadsorbed phages in the supernatant is measured, the phage adsorption rate is calculated, and the optimal infection multiplicity and culture time of the phage solution and the host bacteria with target membrane protein knockout are determined according to the phage adsorption rate.

3. The screening method according to claim 1, characterized in that The host bacteria include at least one of Escherichia coli, Vibrio parahaemolyticus, Vibrio alginolyticus, Vibrio harveyi, Vibrio vulnificus, Vibrio erwinia, Pseudomonas aeruginosa, Shigella, Salmonella, Acinetobacter baumannii, Klebsiella pneumoniae, Stenotrophomonas maltophilia, Staphylococcus aureus, and Proteus.

4. The screening method according to claim 2, characterized in that When the target membrane protein is the membrane protein TolC, the multiplicity of infection of the phage solution and the host bacteria with the target membrane protein knocked out is 0.0001 to 0.

1.

5. The screening method according to claim 4, characterized in that When the target membrane protein is membrane protein TolC, the culturing time is 1 to 20 minutes.

6. The screening method according to any one of claims 1 to 5, characterized in that The phage enrichment method includes the following steps: sterilizing a sample containing phages and then mixing and culturing it with a host bacterium to obtain a phage solution; Preferably, the culture conditions for phage enrichment are 18-38° C., 100-250 rpm, and 1-5 h.

7. The screening method according to any one of claims 1 to 5, characterized in that The screening method further comprises a phage purification step.

8. The screening method according to claim 7, characterized in that The purification step comprises: gradient dilution of the supernatant containing the targeted membrane protein phage after screening to obtain a dilution; culturing the dilution in a double-layer agar plate containing host bacteria until plaques appear on the plate; picking a single plaque and resuspending it in a buffer; repeating the above steps 2 to 3 times to obtain the purified targeted membrane protein phage. 9 . A bacteriophage targeting membrane protein TolC, obtained by screening by the screening method according to any one of claims 1 to 8 .

10. Use of the screening method according to any one of claims 1 to 8 in screening phages targeting specific receptors.

Images