Method and reagent combination for preparing single cell transcriptome sequencing library

Abstract

The invention provides a method for constructing a nucleic acid molecule library for transcriptome sequencing (such as single cell transcriptome sequencing and single cell full-length transcriptome sequencing). In addition, the invention also provides a nucleic acid molecule library constructed by using the method, and a reagent combination for implementing the method.

Description

Technical Field

[0001] The present application relates to the field of transcriptome sequencing, in particular to the technical field of single-cell transcriptome sequencing (e.g., single-cell full-length transcriptome sequencing). Specifically, the present application relates to a method for constructing a nucleic acid molecule library for transcriptome sequencing (e.g., single-cell transcriptome sequencing, single-cell full-length transcriptome sequencing). In addition, the present application also relates to a nucleic acid molecule library constructed using the method, and a reagent combination for implementing the method. Background Art

[0002] Single-cell transcriptome sequencing is a technology for building a library and sequencing analysis of the transcriptome of a single cell. The conventional process of building a library for single-cell transcriptome second-generation sequencing includes: mRNA reverse transcription, cDNA pre-amplification, cDNA fragmentation, sequencing adapter ligation, and library enrichment. However, it is difficult to build a library for a single cell. Before building a single-cell transcriptome library, single cells must be separated and then the library is built with the sorted single cells. Building a library for single cells in sequence is not only time-consuming, but also cannot guarantee that all the cells in the library are at the same level of vitality. Since the emergence of technologies such as Drop-seq, Micro-well, and Split-seq in 2012, the cost threshold of single-cell sequencing has gradually been reduced. Single-cell sequencing technology has been widely used in biology, biomedicine and other fields, such as genetic and biological research at different developmental stages of species, genetic mechanism and phenotypic research in disease progression, single-cell phenotypic research of tissues and organs, etc.

[0003] Single-cell sequencing applications have developed commercialized single-cell batch processing platforms and supporting reagents, including FluidigmC1, 10×genomics GemCode, and Wafergen's ICELL8 single-cell system. Among them, the Fluidigm C1 system not only has requirements for cell shape and size, but is only suitable for cells with regular shapes and a diameter of no more than 25μm, and the cell throughput for library construction is small, with only 96 single cells captured on a single chip. Therefore, the current application scenarios of this system are relatively limited; although the 10×Genomics system can only perform 3' or 5' library construction sequencing of the transcriptome, its cell processing throughput is large, a single chip contains 8 channels, and a single channel can capture up to 10,000 single cells at a time, and it also has certain requirements for cell shape and size; the ICELL8 single-cell system is generally applicable to single cells / single cell nuclei dissociated from various tissues, and the single cell processing throughput is larger than that of Fluidigm C1, reaching thousands of single cells, and it can obtain full-length transcript information of single cells, which can further carry out single-cell transcription-related analysis. In addition, the ICELL8 single-cell system is not limited by cell shape and size. It is used in many studies on irregularly shaped single cells or cells with larger diameters, such as cardiomyocytes, fibroblasts, oocytes, glial cells, etc., and can complete single-cell capture and library construction without single-nuclear separation. However, there is only one imported matching reagent available for matching this system for single-cell library construction, which is expensive. The cost of a single cell capture and library construction is more than 20,000 yuan, and the purchase channel of the reagent is single, which greatly restricts and hinders Chinese scientific researchers, especially in the omics exploration and research applications of irregularly shaped and large cells (diameter greater than 40μm) such as cardiomyocytes, fibroblasts, oocytes, neurons, etc. Summary of the invention

[0004] The inventors of the present application have developed a new method for constructing a nucleic acid molecule library for transcriptome sequencing based on in-depth research. The nucleic acid molecule library produced according to the method of the present application has a significantly reduced proportion of nucleic acid molecules from organelle (e.g., mitochondria, ribosome) transcripts, thereby being able to obtain high-quality sequencing data with a significantly reduced proportion of transcript data from organelle (e.g., mitochondria, ribosome) sources.

[0005] In addition, the method / reagent combination provided by the present application is not only applicable to the construction of single-cell transcriptome sequencing library, but also applicable to the construction of full-length or non-full-length transcriptome sequencing library. For example, the method / reagent combination of the present application can be significantly advantageously applied to the construction of single-cell full-length transcriptome sequencing library, so that it can be used to obtain more comprehensive transcriptome information such as 3'UTR, variable shearing, fusion gene, RNA level mutation, etc., which can be applied to the interaction of species in organism development process, evolution and ecosystem, and the single cell research in the fields of disease research, drug development, etc. In addition, the method / reagent combination of the present application is applicable to the second generation sequencing library of the full-length transcriptome of various types of single cells / mononuclei, and in particular, the method / reagent combination of the present application has no restriction on the shape and size of cells in the sample, and is therefore also applicable to the library application of individual larger, irregularly shaped cells (such as cardiomyocytes, fibroblasts, neuronal cells, etc.).

[0006] method

[0007] Therefore, in one aspect, the present application provides a method for generating a nucleic acid molecule library from an RNA sample, comprising:

[0008] (1) Providing RNA samples;

[0009] (2) using a reverse transcription primer to perform nucleic acid treatment including a reverse transcription reaction on the RNA sample to generate a nucleic acid product containing double-stranded DNA;

[0010] (3) incubating the nucleic acid product with a transposase complex and a first reverse transcriptase;

[0011] Wherein, the first reverse transcriptase has RNase H activity and nucleic acid polymerization activity;

[0012] The transposase complex contains a transposase and a transposition sequence that the transposase can recognize and bind to, and can cut or break double-stranded DNA;

[0013] The incubation is performed under conditions that allow the double-stranded DNA to be broken into nucleic acid fragments by the transposase complex and allow the first reverse transcriptase to exert its RNase H activity and nucleic acid polymerization activity;

[0014] Thus, a nucleic acid molecule library is obtained.

[0015] In certain embodiments, the first reverse transcriptase is capable of: (i) synthesizing a DNA strand using RNA as a template, and / or, (ii) synthesizing DNA using DNA as a template. In certain embodiments, the first reverse transcriptase is capable of synthesizing a DNA strand using RNA as a template.

[0016] In certain embodiments, the first reverse transcriptase is selected from: M-MLV reverse transcriptase with RNase H activity, HIV-1 reverse transcriptase with RNase H activity, AMV reverse transcriptase with RNase H activity and telomerase reverse transcriptase with RNase H activity, as well as variants, modified products and derivatives of the above reverse transcriptases with RNase H activity.

[0017] Based on a large number of experimental studies, the inventors of the present application unexpectedly discovered that, during the construction of a transcriptome sequencing library, adding a reverse transcriptase with RNase H activity to the transposase system used for double-stranded DNA fragmentation can significantly reduce the proportion of transcript data derived from organelles (e.g., mitochondria, ribosomes) in the library data, thereby significantly improving the data quality of the library.

[0018] Therefore, based on the content disclosed in the present application, it is easy for those skilled in the art to understand that the RNase H activity of the first reverse transcriptase is significantly beneficial to the construction of library molecules. In certain embodiments, the first reverse transcriptase has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the RNase H activity of a naturally occurring wild-type reverse transcriptase. In certain embodiments, the first reverse transcriptase has an RNase H activity comparable to a naturally occurring wild-type reverse transcriptase. In certain embodiments, compared with a naturally occurring wild-type reverse transcriptase, the first reverse transcriptase has an enhanced RNase H activity (e.g., an enhanced RNase H activity obtained through modification or mutation).

[0019] In certain embodiments, the transposase is selected from: TDE1 transposase, Tn5 transposase, MuA transposase, Sleeping Beauty transposase, Mariner transposase, Tn7 transposase, Tn10 transposase, Ty1 transposase, Tn552 transposase, and variants, modified products and derivatives having the transposition activity of the above transposases.

[0020] Based on the contents disclosed in this application, it is easy for a person skilled in the art to understand that the method provided in this application is not limited in the selection of transposase, and the transposases conventionally used in the art (e.g., transposases purchased from the market or prepared by genetic engineering recombination technology) are theoretically applicable to the method of this application. For example, in the embodiment using TDE1 transposase, the TDE1 transposase can be purchased from Illumina (Cat. No.: 20034197) and the like.

[0021] In certain embodiments, the library of nucleic acid molecules is used for transcriptome sequencing.

[0022] As generally understood by those skilled in the art, transcriptome can be used to represent the set of all transcription products in a cell under a certain physiological condition in a broad sense, and can be used to represent the set of all mRNA in a narrow sense. In certain embodiments, "transcriptome" as used herein is preferably understood as a set of mRNA. In certain embodiments, "transcriptome" as used herein is preferably understood as a set of mRNA obtained by transcription of a gene located in the nucleus.

[0023] In certain embodiments, the RNA sample comprises mRNA.

[0024] In certain embodiments of the method, in step (1), the RNA sample is an extracted RNA sample (eg, an RNA sample extracted from a cell), or the RNA sample is provided in a cell (eg, a living cell).

[0025] In certain embodiments of the method, in step (2), a nucleic acid product containing double-stranded DNA is produced by nucleic acid treatment comprising the following steps:

[0026] (a) reverse transcribing the RNA sample using a reverse transcription primer and a second reverse transcriptase to generate a cDNA chain containing a 3' end overhang; and,

[0027] (b) annealing the template switching sequence with the cDNA chain generated in (a), and performing an extension reaction to generate a double-stranded DNA containing the cDNA chain; wherein the template switching sequence comprises a complementary sequence to the 3' end overhang.

[0028] In certain embodiments, (a) and (b) are performed in the same reaction system, or in different reaction systems.

[0029] In certain embodiments, (a) and (b) are carried out in the same reaction system. In certain embodiments, the pH value of the reaction system is in the range of 7.5-8.5 (for example, the pH value of the reaction system is 8.3). In certain embodiments, the reaction system comprises one or more of the following:

[0030] (i) Tris or a salt thereof at a concentration of 30-70 mM (e.g., 50 mM);

[0031] (ii) potassium chloride at a concentration of 40-100 mM (e.g., 75 mM);

[0032] (iii) magnesium chloride at a concentration of 5-15 mM (e.g., 9 mM);

[0033] (iv) dithiothreitol at a concentration of 2-10 mM (e.g., 5 mM);

[0034] (v) Betaine at a concentration of 0.5-1.5 M (eg, 1 M).

[0035] In some embodiments, the pH value of the transposition reaction system of step (3) is in the range of 8.0-9.0 (for example, the pH value of the transposition reaction system is 8.5). In some embodiments, the transposition reaction system of step (3) comprises one or more of the following:

[0036] (i) magnesium chloride at a concentration of 1-10 mM (e.g., 5 mM);

[0037] (ii) tris(hydroxymethyl)aminopropanesulfonic acid or a salt thereof at a concentration of 5-15 mM (e.g., 10 mM);

[0038] (iii) N,N-dimethylformamide at a concentration of 5%-15% v / v (eg, 10% v / v).

[0039] In certain embodiments, the second reverse transcriptase is selected from the group consisting of: M-MLV reverse transcriptase, HIV-1 reverse transcriptase, AMV reverse transcriptase, telomerase reverse transcriptase, and variants, modified products and derivatives of the above reverse transcriptases.

[0040] In certain embodiments, the method has one or more of the following features:

[0041] (i) the overhang has a length of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 or more nucleotides; in certain embodiments, the overhang is an overhang of 2-5 cytosine nucleotides (e.g., a CCC overhang);

[0042] (ii) the second reverse transcriptase has terminal transfer activity; in certain embodiments, the second reverse transcriptase can synthesize a cDNA chain using RNA (eg, mRNA) as a template, and add the overhang to the 3' end of the cDNA chain;

[0043] (iii) the second reverse transcriptase has no or reduced RNase H activity;

[0044] (iv) the reverse transcription primer comprises a poly(T) sequence; in certain embodiments, the poly(T) sequence is located at the 3' end of the primer; in certain embodiments, the poly(T) sequence comprises at least 5 (e.g., at least 10, at least 15, or at least 20) thymine nucleotide residues;

[0045] (v) the template switching sequence comprises at its 3' end a complementary sequence to a 3' terminal overhang;

[0046] (vi) the template switch sequence does not contain modified nucleotides, or contains modified nucleotides (e.g., locked nucleic acids); in certain embodiments, the template switch sequence contains one or more (e.g., 1, 2, 3, 4, 5) locked nucleic acid modifications at its 3' end;

[0047] (vii) the template switching sequence and / or the reverse transcription primer comprises a purification tag;

[0048] (viii) the template switching sequence and / or the reverse transcription primer comprises a unique molecular index sequence (UMI). In certain embodiments of the method, in step (1), the RNA sample is provided in a cell (e.g., a living cell); and (a) and / or (b) of step (2) are performed outside the cell or inside the cell.

[0049] In some embodiments, (a) and (b) of step (2) are performed outside the cell; in some embodiments, the method further comprises a step of lysing the cells to release intracellular RNA before (a).

[0050] In some embodiments, (a) and (b) of step (2) are performed inside cells; in some embodiments, the method further comprises a step of fixing and / or permeabilizing the cells before (a).

[0051] In certain embodiments, (a) of step (2) is performed inside the cell, and (b) of step (2) is performed outside the cell; in certain embodiments, the method further comprises a step of fixing and / or permeabilizing the cells before (a), and / or the method further comprises a step of lysing the cells to release intracellular nucleic acid molecules after (a) and before (b).

[0052] In certain embodiments, (a) and (b) of step (2) are performed inside a cell, and step (3) is performed inside or outside a cell.

[0053] In some embodiments, step (3) is performed in cells; in some embodiments, the method further comprises a step of lysing cells to release the nucleic acid product of step (3) after step (3).

[0054] In some embodiments, step (3) is performed outside the cell; in some embodiments, the method further comprises a step of lysing the cells to release the nucleic acid product of step (2) after step (2) and before step (3).

[0055] In certain embodiments, the incubation system of step (3) further comprises a first adapter and a second adapter, wherein the first adapter and the second adapter are capable of annealing to the transposition sequence or its complementary sequence. For example, the transposase complex comprises a first transposition sequence and a second transposition sequence, wherein the first adapter is capable of annealing to the first transposition sequence or its complementary sequence, and the second adapter is capable of annealing to the second transposition sequence or its complementary sequence.

[0056] In some embodiments, the first transposition sequence and the second transposition sequence are located on the same nucleic acid molecule strand. In some embodiments, the first transposition sequence and the second transposition sequence are located on different nucleic acid molecule strands.

[0057] Based on the contents disclosed in the present application, it is easy for a person skilled in the art to understand that the use of the first linker and the second linker can enable the DNA product fragmented by the transposase complex to carry the first linker and the second linker.

[0058] In certain embodiments, the incubation system of step (3) further comprises a DNA polymerase (eg, a thermostable DNA polymerase) capable of synthesizing DNA using the DNA as a template.

[0059] In certain embodiments, in step (3), the incubation is performed under conditions that allow the transposition product to extend the nucleic acid chain using the first adapter and / or the second adapter as a primer.

[0060] In certain embodiments, the method has one or more features selected from the group consisting of:

[0061] (i) the method further comprises a DNA purification and / or amplification step after step (2) and before step (3);

[0062] (ii) the method does not include a DNA purification step after step (2) and before step (3);

[0063] (iii) The method further comprises a DNA purification and / or amplification step after step (3).

[0064] In certain embodiments, the method further comprises a DNA amplification step after step (3). In certain embodiments, step (3) comprises using the first adapter and the second adapter as described above, and the amplification comprises using a first amplification primer that can anneal to the first adapter or its complementary sequence, and / or, a second amplification primer that can anneal to the second adapter or its complementary sequence.

[0065] In certain embodiments, the nucleic acid molecule library is used for single cell transcriptome sequencing.

[0066] In certain embodiments, in step (1), the RNA sample is extracted from a single cell. In certain embodiments, the method further comprises, after step (2) or step (3), a step of combining product molecules derived from different single cell samples.

[0067] In certain embodiments, in step (1), the RNA sample is provided in a cell (eg, a living cell); step (1) comprises: providing one or more cells comprising the RNA sample.

[0068] In certain embodiments, at least 2 cells are provided in step (1).

[0069] In certain embodiments, prior to performing step (2), the cells are separated into at least two subsets (eg, the cells are separated into at least two subsets in a microplate).

[0070] In certain embodiments, in step (2), the RNA of the cells in each subset is subjected to nucleic acid treatment including a reverse transcription reaction using a reverse transcription primer to generate a nucleic acid product containing double-stranded DNA.

[0071] As is generally understood by those skilled in the art, the use of UMI can be used to distinguish product molecules derived from the same RNA template in a sequencing library, so that library molecules derived from different RNA templates can be distinguished based on the UMI sequence, thereby obtaining information such as the expression abundance of each RNA molecule in the transcriptome.

[0072] Therefore, in certain embodiments of generating double-stranded DNA nucleic acid products using a template switching sequence, in step (2), different template switching sequence molecules used in the same subset preferably have different UMIs from each other, thereby, the double-stranded DNA product molecules obtained in step (2) have different UMIs or their complementary sequences from each other.

[0073] In certain embodiments where the reverse transcription primer comprises a UMI, in step (2), different reverse transcription primer molecules used in the same subset preferably have different UMIs from each other, thereby, the double-stranded DNA product molecules obtained in step (2) have different UMIs or their complementary sequences from each other.

[0074] Similarly, it is easy to understand that in the embodiment where step (3) includes using the first adapter and the second adapter, the UMI can also be provided in the first adapter and / or the second adapter. Therefore, in the embodiment where step (3) includes using the first adapter as described above and the second adapter as described above, in step (3), different first adapter molecules used in the same subset preferably have different UMIs from each other, and / or, different second adapter molecules used in the same subset preferably have different UMIs from each other; thus, the nucleic acid product molecules obtained in step (3) have different UMIs or their complementary sequences from each other.

[0075] In certain embodiments, the nucleic acid products of step (2) or step (3) derived from different subsets contain subset-specific tag sequences that are different from each other; and the nucleic acid products produced from the same subset contain the same subset-specific tag sequence.

[0076] In certain embodiments, in step (2), the reverse transcription primers used for different subsets have different tag sequences A; thus, the nucleic acid products of step (2) produced from cells of each subset contain different tag sequences A as subset-specific tag sequences.

[0077] In certain embodiments, in step (2), for different subsets, the template switching sequences used have different tag sequences B; thus, the nucleic acid products of step (2) produced from cells of each subset contain different tag sequences B as subset-specific tag sequences.

[0078] In certain embodiments, step (3) includes using a first linker and a second linker as described above, wherein the first linker contains a tag sequence C, and the second linker optionally contains a tag sequence D; for different subsets, the first linkers used have tag sequences C that are different from each other; thereby, the nucleic acid products of step (3) produced from cells of each subset contain tag sequences C that are different from each other as subset-specific tag sequences.

[0079] In certain embodiments, step (3) includes using a first linker and a second linker as described above, wherein the first linker optionally contains a tag sequence C, and the second linker contains a tag sequence D; for different subsets, the second linkers used have tag sequences D that are different from each other; thereby, the nucleic acid products of step (3) produced from cells of each subset contain tag sequences D that are different from each other as subset-specific tag sequences.

[0080] In certain embodiments, step (3) includes using the first linker and the second linker as described above, wherein the first linker contains a tag sequence C and the second linker contains a tag sequence D; for different subsets, the first linker and the second linker used have different combinations of tag sequences C and tag sequences D; thereby, the nucleic acid products of step (3) produced from cells of each subset contain different combinations of tag sequences C and tag sequences D as subset-specific tags.

[0081] Based on the contents disclosed in the present application, it is easy for a person skilled in the art to understand that when the first adapter contains a tag sequence C and the second adapter contains a tag sequence D, the tag sequence C and the tag sequence D can each be used as a subset-specific tag alone, or the two can be combined as a subset-specific tag. When the tag sequence C is used alone as a subset-specific tag, in step (3), for different subsets, it is preferred to use a first adapter containing a tag sequence C that is different from each other. When the tag sequence D is used alone as a subset-specific tag, in step (3), for different subsets, it is preferred to use a first adapter containing a tag sequence D that is different from each other. When the tag sequence C and the tag sequence D are combined as subset-specific tags, in step (3), for different subsets, the first adapter containing the same tag sequence C can be used for some subsets, and the second adapter containing the same tag sequence D can be used for another subset, as long as it satisfies: for a given subset, the combination of the tag sequence C contained in the first adapter and the tag sequence D contained in the second adapter used is unique.

[0082] In certain embodiments, the method further comprises identifying and selecting a subset containing only one cell.

[0083] In certain embodiments, the methods provide for identification and selection of subsets containing only one cell by staining the cells.

[0084] In certain embodiments, the method uses the ICELL8 platform to sort and identify subsets.

[0085] In certain embodiments, after performing step (2) or step (3), the nucleic acid products or cells comprising the nucleic acid products of the respective subsets are combined.

[0086] In certain embodiments, the nucleic acid molecule library is used for non-full-length single-cell transcriptome sequencing (e.g., 5' transcriptome sequencing or 3' transcriptome sequencing), and the method combines the nucleic acid products of each subset or the cells containing the nucleic acid products after performing step (2) or step (3). In certain embodiments for non-full-length transcriptome sequencing, in step (2), for different subsets, the reverse transcription primers used have mutually different tag sequences A; thus, the nucleic acid products of step (2) generated from the cells of each subset contain mutually different tag sequences A as subset-specific tag sequences; or, in step (2), for different subsets, the template switching sequences used have mutually different tag sequences B; thus, the nucleic acid products of step (2) generated from the cells of each subset contain mutually different tag sequences B as subset-specific tag sequences.

[0087] In certain embodiments, the nucleic acid molecule library is used for full-length single-cell transcriptome sequencing.

[0088] In certain embodiments, after performing step (3), the nucleic acid products of each subset or the cells containing the nucleic acid products are combined. In certain embodiments, step (3) includes using the first adapter and the second adapter as described above, the first adapter contains a tag sequence C, and the second adapter optionally contains a tag sequence D; for different subsets, the first adapter used has a tag sequence C that is different from each other; thus, the nucleic acid products of step (3) produced from the cells of each subset contain a tag sequence C that is different from each other as a subset-specific tag sequence. In certain embodiments, step (3) includes using the first adapter and the second adapter as described above, the first adapter optionally contains a tag sequence C, and the second adapter contains a tag sequence D; for different subsets, the second adapter used has a tag sequence D that is different from each other; thus, the nucleic acid products of step (3) produced from the cells of each subset contain a tag sequence D that is different from each other as a subset-specific tag sequence. In certain embodiments, step (3) includes using the first adapter and the second adapter as described above, wherein the first adapter contains a tag sequence C and the second adapter contains a tag sequence D; for different subsets, the first adapter and the second adapter used have different combinations of tag sequences C and tag sequences D; thus, the nucleic acid products of step (3) produced from cells of each subset contain different combinations of tag sequences C and tag sequences D as subset-specific tags. Based on the contents disclosed in the present application, it is easy for a person skilled in the art to understand that when the first adapter contains a tag sequence C and the second adapter contains a tag sequence D, the tag sequence C and the tag sequence D can each be used as a subset-specific tag alone, or the two can be combined as a subset-specific tag. When the tag sequence C is used alone as a subset-specific tag, in step (3), for different subsets, it is preferred to use a first adapter containing different tag sequences C. When the tag sequence D is used alone as a subset-specific tag, in step (3), for different subsets, it is preferred to use a first adapter containing different tag sequences D. When the tag sequence C and tag sequence D are combined as subset-specific tags, in step (3), for different subsets, a first connector containing the same tag sequence C can be used for some subsets, and a second connector containing the same tag sequence D can be used for another subset, as long as: for a given subset, the combination of the tag sequence C contained in the first connector and the tag sequence D contained in the second connector used is unique.

[0089] In another aspect, the present application provides a transcriptome sequencing method, comprising:

[0090] constructing a nucleic acid molecule library according to the method described above; and,

[0091] The nucleic acid molecule library is sequenced.

[0092] Reagent Combination

[0093] On the other hand, the present application provides a reagent combination, comprising: a transposase and a first reverse transcriptase, wherein the first reverse transcriptase has RNase H activity and nucleic acid polymerization activity.

[0094] In certain embodiments, the first reverse transcriptase has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the RNase H activity of a naturally occurring wild-type reverse transcriptase.

[0095] In certain embodiments, the first reverse transcriptase has RNase H activity comparable to that of a naturally occurring wild-type reverse transcriptase.

[0096] In certain embodiments, the first reverse transcriptase has enhanced RNase H activity (eg, enhanced RNase H activity obtained by modification or mutation) compared to a naturally occurring wild-type reverse transcriptase.

[0097] In certain embodiments, the first reverse transcriptase and the transposase are provided as separate or mixed components.

[0098] In certain embodiments, the reagent combination further comprises one or more selected from the following:

[0099] (i) a transposition sequence (e.g., a first transposition sequence and / or a second transposition sequence); preferably, the transposition sequence and the transposase are provided in the form of a complex, or, the transposition sequence and the transposase are provided as separate components; in some embodiments, the first transposition sequence and the second transposition sequence are located on the same nucleic acid molecule chain; in some embodiments, the first transposition sequence and the second transposition sequence are located on different nucleic acid molecule chains;

[0100] (ii) a second reverse transcriptase having terminal transfer activity; in certain embodiments, the second reverse transcriptase has no or reduced RNase H activity;

[0101] (iii) a reverse transcription primer; in some embodiments, the reverse transcription primer comprises a poly(T) sequence; in some embodiments, the poly(T) sequence is located at the 3' end of the primer; in some embodiments, the poly(T) sequence comprises at least 5 (e.g., at least 10, at least 15, or at least 20) thymine nucleotide residues; in some embodiments, the reverse transcription primer further comprises a purification tag, a unique molecule index sequence (UMI) and / or a tag sequence A;

[0102] (iv) a template switching sequence; in certain embodiments, the template switching sequence comprises a complementary sequence to the 3' terminal overhang at its 3' end; in certain embodiments, the template switching sequence comprises one or more (e.g., 1, 2, 3, 4, 5) locked nucleic acid modifications at its 3' end; in certain embodiments, the template switching sequence further comprises a purification tag, a unique molecular index sequence (UMI) and / or a tag sequence B;

[0103] (v) a first adapter, the first adapter comprising a sequence capable of annealing to a transposition sequence (e.g., a first transposition sequence) or a complementary sequence thereof; in certain embodiments, the first adapter further comprises a tag sequence C and / or a unique molecular tag sequence (UMI);

[0104] (vi) a second adapter, the second adapter comprising a sequence capable of annealing to a transposition sequence (e.g., a second transposition sequence) or a complementary sequence thereof; in certain embodiments, the second adapter further comprises a tag sequence D and / or a unique molecular tag sequence (UMI);

[0105] (vii) A polymerase capable of synthesizing DNA using DNA as a template (for example, a thermostable DNA polymerase).

[0106] In certain embodiments, the second reverse transcriptase is selected from the group consisting of: M-MLV reverse transcriptase, HIV-1 reverse transcriptase, AMV reverse transcriptase, telomerase reverse transcriptase, and variants, modified products and derivatives of the above reverse transcriptases.

[0107] In certain embodiments, the actual combination further comprises a first amplification primer capable of annealing to the first adapter or its complementary sequence, and / or, a second amplification primer capable of annealing to the second adapter or its complementary sequence.

[0108] In certain embodiments, the reagent combination further comprises: one or more of Tris or a salt thereof, potassium chloride, magnesium chloride, dithiothreitol, betaine, tris(hydroxymethyl)methylaminopropanesulfonic acid or a salt thereof, and N,N-dimethylformamide.

[0109] In certain embodiments, the kit further comprises reagents for sequencing; for example, reagents for next-generation sequencing.

[0110] In certain embodiments, the first reverse transcriptase is selected from: M-MLV reverse transcriptase with RNase H activity, HIV-1 reverse transcriptase with RNase H activity, AMV reverse transcriptase with RNase H activity and telomerase reverse transcriptase with RNase H activity, as well as variants, modified products and derivatives of the above reverse transcriptases with RNase H activity; and / or, the transposase is selected from: TDE1 transposase, Tn5 transposase, MuA transposase, Sleeping Beauty transposase, Mariner transposase, Tn7 transposase, Tn10 transposase, Ty1 transposase, Tn552 transposase, as well as variants, modified products and derivatives with transposition activity of the above transposases.

[0111] In certain embodiments, the reagent set further comprises a microplate.

[0112] In another aspect, the present application provides use of the reagent combination as described above for constructing a nucleic acid molecule library or for performing transcriptome sequencing.

[0113] In certain embodiments, the nucleic acid molecule library is used to perform transcriptome sequencing (eg, single cell transcriptome sequencing).

[0114] In certain embodiments, the reagent combination is used to perform single cell transcriptome sequencing. In certain embodiments, the reagent combination is used to analyze the gene expression level of the cell, the gene transcription start position, and / or the variable shearing of the RNA molecule.

[0115] Definition of terms

[0116] In this application, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the nucleic acid chemistry laboratory operation steps used herein are conventional steps widely used in the corresponding field. At the same time, in order to better understand the present invention, the definitions and explanations of the relevant terms are provided below. Unless specifically limited or described differently elsewhere in this article, the following terms and descriptions related to the present invention should be understood according to the definitions given below.

[0117] When the terms "for example," "such as," "including," "comprising," or variations thereof are used herein, these terms will not be considered as limiting terms, but will be interpreted to mean "but not limited to" or "not limited to."

[0118] The terms "a" and "an" and "the" and similar referents in the context of describing the invention (especially in the context of the following claims) should be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0119] As used herein, "nucleic acid molecule library" refers to a collection or population of labeled nucleic acid fragments (e.g., labeled DNA double-stranded molecule fragments, labeled RNA / cDNA hybrid double-stranded molecule fragments, labeled DNA single-stranded molecule fragments, or labeled RNA single-stranded molecule fragments) generated from a target nucleic acid molecule, wherein the combination of labeled nucleic acid fragments in the collection or population exhibits sequences that qualitatively and / or quantitatively represent the target nucleic acid molecule from which the labeled nucleic acid fragments were generated.

[0120] As used herein, cells that can be used in the methods of the present invention can be any cell of interest, for example, cardiomyocytes, fibroblasts, neuronal cells, cancer cells, immune cells involved in immune responses, or their nuclei. The cell can be one cell or multiple cells. The cell can be a mixture of cells of the same type or a mixture of completely heterogeneous cells of different types. Different cell types may include cells from different tissues (e.g., epithelial tissue, connective tissue, muscle tissue, neural tissue), body fluids (e.g., blood) of an individual or cells from the same tissues (e.g., epithelial tissue, connective tissue, muscle tissue, neural tissue), body fluids (e.g., blood) of different individuals, or cells from different genera, species, strains, variants, or any or all of the aforementioned microorganisms in any combination. For example, different cell types may include normal cells and cancer cells of an individual; various cell types obtained from human subjects, such as a variety of immune cells; a variety of different bacterial species, strains, and / or variants from the environment, forensics, microbiome, or other samples; or any other various mixtures of cell types. As used herein, "transposase" refers to an enzyme that is capable of forming a functional complex with a composition comprising a transposon end (e.g., a transposon, a transposon end, a transposon end composition) and catalyzing the insertion or transposition of the composition comprising a transposon end into a double-stranded nucleic acid molecule (e.g., a DNA double-strand, an RNA / cDNA hybrid double-stranded) incubated with the enzyme in a transposition reaction (e.g., an in vitro transposition reaction).

[0121] As used herein, the term "transposition sequence" refers to a nucleotide sequence that can be recognized by a transposase and form a functional transposase complex. Generally speaking, a transposase complex containing the transposition sequence can insert or transpose the transposition sequence into a target double-stranded nucleic acid molecule incubated with it in an in vitro transposition reaction.

[0122] As used herein, a "tag sequence" (e.g., "tag sequence A", "tag sequence B", "tag sequence C", "tag sequence D", "unique molecular tag sequence", "template switching sequence", etc.) refers to an oligonucleotide that provides identification, recognition and / or molecular or biochemical manipulation means (e.g., by providing a site for annealing an oligonucleotide, such as a primer for DNA polymerase extension or an oligonucleotide for capture reaction or ligation reaction) for a non-target nucleic acid component of the nucleic acid fragment to which it is attached or a derivative product of the nucleic acid fragment to which it is attached (e.g., a complementary fragment of a nucleic acid fragment, a broken short fragment of a nucleic acid fragment, etc.). The tag sequence can be composed of at least two consecutive (preferably about 6 to 100, but there is no definite limit to the length of the oligonucleotide, the exact size depends on many factors, and these factors depend on the ultimate function or use of the oligonucleotide) nucleotides, or it can be composed of a plurality of oligonucleotides arranged in a continuous or non-continuous manner. The tag sequence can be unique to each nucleic acid fragment to which it is attached, or it can be unique to a certain type of nucleic acid fragment to which it is attached. The tag sequence can be reversibly or irreversibly joined to the polynucleotide sequence to be "tagged" by any method including ligation, hybridization or other methods.

[0123] As used herein, the term "reverse transcriptase with terminal transfer activity" refers to a reverse transcriptase that can catalyze the addition (or "tailing") of one or more deoxyribonucleoside triphosphates (dNTPs) or a single dideoxyribonucleoside triphosphate to the 3' end of a cDNA independently of a template. Examples of such reverse transcriptases include, but are not limited to, M-MLV reverse transcriptase, HIV-1 reverse transcriptase, AMV reverse transcriptase, telomerase reverse transcriptase, and variants, modified products, and derivatives having the reverse transcription activity and terminal transfer activity of the reverse transcriptase. In a preferred embodiment, the reverse transcriptase (e.g., the second reverse transcriptase described herein) used for reverse transcription of RNA to generate cDNA does not have or has reduced RNase H activity to avoid RNA degradation. Therefore, in a preferred embodiment, the reverse transcriptase (e.g., the second reverse transcriptase described herein) used for reverse transcription of RNA to generate cDNA has terminal transfer activity and does not have or has reduced RNase H activity. Examples of such reverse transcriptases include, but are not limited to, M-MLV reverse transcriptase, HIV-1 reverse transcriptase, AMV reverse transcriptase, and telomerase reverse transcriptase modified or mutated to remove RNase H activity. As used herein, the expression "having reduced RNase H activity" means that the RNase H activity of the modified or mutated reverse transcriptase is reduced compared to the naturally occurring wild-type reverse transcriptase.

[0124] As used herein, "RNase H activity" has the meaning generally understood by those skilled in the art, and typically refers to RNA chain-specific ribonuclease activity for RNA-DNA hybrids.

[0125] As used herein, the terms "transposase" and "reverse transcriptase" and "nucleic acid polymerase" refer to protein molecules or protein molecule aggregates responsible for catalyzing specific chemical reactions and biological reactions. In general, the methods, compositions or kits of the present invention are not limited to the use of specific transposases, reverse transcriptases or nucleic acid polymerases from specific sources. On the contrary, the methods, compositions or kits of the present invention include any transposase, reverse transcriptase or nucleic acid polymerase from any source that has equivalent enzymatic activity to the specific enzyme disclosed herein according to the specific method, composition or kit. Further, the methods of the present invention also include the following embodiments: wherein any one of the specific enzymes provided and used in the steps of the method is replaced by a combination of two or more enzymes, and the two or more enzymes, when used in combination, whether used separately in a stepwise manner or used together simultaneously, the reaction mixture produces the same result as the result obtained using the one specific enzyme. The methods, buffers and reaction conditions provided herein, including the methods, buffers and reaction conditions in the examples, are currently preferred for the embodiments of the methods, compositions and kits of the present invention. However, other enzyme storage buffers, reaction buffers and reaction conditions using some of the enzymes of the present invention are known in the art, which may also be suitable for use in the present invention and are included herein.

[0126] Advantageous Effects of the Invention

[0127] Compared with the existing traditional methods / commercial kits in the art, the transcriptome sequencing library construction method / reagent combination provided in the present application can obtain a nucleic acid molecule library in which the proportion of nucleic acid molecules derived from organelles (e.g., mitochondria, ribosomes) transcripts is significantly reduced, thereby obtaining high-quality sequencing data in which the proportion of transcript data derived from organelles (e.g., mitochondria, ribosomes) is significantly reduced. Especially when applied to cell types with a high proportion of organelle transcripts (e.g., cardiomyocytes), the method / reagent combination of the present application has more significant beneficial effects than the existing methods / kits in the art.

[0128] In addition, the method / reagent combination provided in the present application is not only applicable to the construction of single-cell transcriptome sequencing libraries, but also to the construction of full-length or non-full-length transcriptome sequencing libraries. For example, it can be significantly advantageously applied to the construction of single-cell full-length transcriptome sequencing libraries.

[0129] Embodiments of the present invention will be described in detail below in conjunction with the accompanying drawings and examples, but it will be appreciated by those skilled in the art that the following drawings and examples are only used to illustrate the present invention, rather than to limit the scope of the present invention. Various objects and advantages of the present invention will become apparent to those skilled in the art based on the following detailed description of the accompanying drawings and preferred embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0130] Figure 1 : Schematic diagram of the microplate structure.

[0131] Figure 2 : 2100 peak diagram of reverse transcribed full-length cDNA after 293T single cell spray selection.

[0132] Figure 3 : Electrophoresis peak diagram of 293T single cell full-length transcriptome library.

[0133] Figure 4 : Comparison of full-length transcriptome library data of non-myocardial single cells in mouse heart.

[0134] Figure 5 : Electrophoresis peak diagram of mouse myocardial single cell full-length transcriptome library.

[0135] Figure 6 : Comparison of mouse myocardial single-cell full-length transcriptome library data. DETAILED DESCRIPTION

[0136] The invention will now be described with reference to the following examples which are intended to illustrate the invention rather than to limit the invention.

[0137] Unless otherwise specified, the molecular biology experimental methods and immunoassays used in the present invention are basically carried out with reference to the methods described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, and FM Ausubel et al., Compiled Molecular Biology Laboratory Manual, 3rd Edition, John Wiley & Sons, Inc., 1995. It is understood by those skilled in the art that the embodiments describe the present invention by way of example and are not intended to limit the scope of the invention claimed.

[0138] Example 1: Preparation of microwell chip

[0139] This embodiment uses an aluminum microplate that can be adapted to the ICELL8 single cell sorting system. The microplate has a side length of 4.1 cm, a height of 2700 μm, and a hypotenuse length of 1300 μm at the lower right corner. The specific structural parameters are shown in the schematic diagram. Figure 1. 72 rows and 72 columns of nanoliter microwells are neatly arranged on the well plate, with a hole diameter of 460μm, a hole depth of 1550μm, a distance between holes of 80μm, and a distance of 1100μm between the side holes and the edge of the chip. The depth of the microwells is adjusted according to the microwell volume required for the experiment. The hole depths of 1550μm, 1600μm, and 1650μm correspond to hole volumes of 250nL, 300nL, and 350nL, respectively. There are 500μm wide concave engravings on all four sides of the back of the chip, and the height of the concave engravings is 1200μm. After the microwells and other structures on the chip are processed, acetone ultrasonic cleaning and reverse 3500g centrifugation are required for 3 times. After drying, polyparaxylene is plated as a low-adsorption coating, and the coating thickness is about 13 to 15μm.

[0140] Example 2: Single cell sorting system preparation

[0141] Single cells were stained with PI and Hochest33342 at the same time and incubated at 37°C for 10-15 minutes, and the cell density and viability were recorded under a fluorescence microscope. The single cell sorting system was prepared with reference to Table 1. The prepared system was added to 8 wells of a 384-deep well plate (A1, A2, B1, B2, C1, C2, D1, D2), with 75 μL in each well. The reagent addition operation and PCR operation were performed in accordance with the relevant instrument instructions of the ICELL8 system of Wafergen Biosystems. The ICELL8 spray system was used to select the FLA mode for single cell spraying, or the ICELL8cx system was used to independently set the spraying program, and the single cell suspension was sprayed onto the 250 nL microporous chip prepared in Example 1. After single cell spraying, an optical pressure-sensitive film is used to cover all the small holes to prevent mutual contamination. After centrifugation at 300g for 5 minutes at 4℃, the chip is scanned to identify single cells, and then frozen at -80℃ overnight or for 2 to 3 weeks.

[0142] Table 1 Components of single cell sorting system

[0143] Components Final concentration Bovine serum albumin (BSA) 0.01％ dNTPs 1mM <![CDATA[Oligo-dT(AAGCAGTGGTATCAACGCAGAGTAC(T) 30 VN,SEQ ID NO:1)]]> 1μM RNase inhibitors 0.04U / μL Cells resuspension solution (DPBS resuspension) 1.33cell / 35nL

[0144] Note: N=A,T,C,or G; V=A,C,or G.

[0145] Example 3: Preparation of reverse transcribed full-length cDNA from single cells sorted from human renal epithelial cell line 293T

[0146] The 293T single cell spray selection was performed with reference to Example 2. The chip after single cell sorting was taken out, left to stand at room temperature for 10 min, centrifuged at 3300 g for 3 min at 4°C, and placed on an adapted PCR instrument for pre-denaturation. The reaction conditions were 76°C for 5 s and 72°C for 3 min, and then immediately taken out and placed on a pre-cooled metal plate.

[0147] Prepare a one-step reverse transcription and cDNA amplification system (RT-PCR mix) (see Table 2). Dispense 45 μL of RT-PCR mix into 4 wells A3 to D3 of a 384-deep-well plate. Remove the film, select the full-length mode in the ICELL8 spray system, and select the RT program to spray the RT-PCR mix according to the saved single-cell sorting file. Perform reverse transcription and pre-amplification reactions in a PCR instrument. The reaction program is: hot cover 72°C, 42.3°C 5s, 36.6°C 3h, 99°C 9s, 95.5°C 1min, 12 to 14 cycles (100°C 5s, 99°C 7s, 59°C 5s, 64°C 30s, 69.5°C 5s, 67.5°C 6min), and store at 4°C. The number of cycles can be adjusted according to different cell types. At this point, the chip contains the full-length cDNA of 293T single cells that have been reverse transcribed and pre-amplified. After each spraying and reaction, the PDSM membrane should be covered without adhesive layer to prevent the volatilization of reagents in the microwells, and centrifuged at 3300g for 3min at 4℃. If cDNA is collected, Beckman AMpure XP beads (1:1 ratio) are used for purification and recovery, and Qubit quantification and Agilent 2100 electrophoresis are used to detect the cDNA length distribution. Figure 2 It can be seen that the full length of the obtained cDNA ranges from 400 to 3000 bp, and the main peak ranges from 900 to 2000 bp, indicating that the reverse transcription and cDNA amplification results are good.

[0148] Table 2 Components of one-step reverse transcription and cDNA amplification system

[0149]

[0150] Example 4: Library construction (including cDNA fragmentation, index adapter ligation and library enrichment)

[0151] The method of this embodiment uses transposase to fragment cDNA and connect adapters. The transposase premix system is loaded into wells A11 to D11 of a 384-deep well plate at 45 μL per well. The preparation thereof is shown in Table 3, wherein the transposase premix system contains reverse transcriptase M-MLV transcriptase (H + ).

[0152] Based on a large number of experimental studies, the inventors of the present application unexpectedly discovered that adding a reverse transcriptase with RNase H activity to the transposase system can significantly reduce the proportion of transcript data derived from organelles (e.g., mitochondria, ribosomes) in the library data, thereby significantly improving the data quality of the library.

[0153] The i5 and i7 connectors use the universal connector for illumina sequencing. The sequence information is shown in Table 5. The i5 and i7 labels are 8-base or 10-base indices suitable for illumia sequencing, and these indices can still be distinguished from each other when the sequencing error rate is 1 base. The concentration of the index used is 0.8 μM.

[0154] Single cell reverse transcription and cDNA pre-amplification were performed with reference to Example 3. No cDNA recovery was performed after amplification. The film was removed after centrifugation at 4°C and placed in the ICELL8 spray system. The i5 label adapter, transposase premix system and i7 label adapter were sprayed into the sorted single cell microwells in sequence (the index combination of the i5 adapter and the i7 adapter can ensure the uniqueness of the labels of the microwells in the chip). After the i5 label adapter and transposase premix system were sprayed, the cDNA fragmentation reaction was performed: 42.3°C for 4s, 36.6°C for 30min, and stored at 4°C. Then the i7 tag adapter was sprayed, and then the library was pre-enriched. The reaction program was: 77℃ 12s, 72℃ 3min, 99℃ 11s; 95.5℃ 1min, 6 cycles (100℃ 20s, 99℃ 10s, 53.3℃ 5s, 58℃ 15s, 71℃ 5s, 67.5℃ 2min), and stored at 4℃. After each spray and reaction, the chip needs to be coated and centrifuged at 4℃ 3300g for 3min. The fragmented library was collected, half of the volume was taken for purification, and Beckman AMpure XP beads (1:1 ratio) were used for purification, and 50μL nuclease-free water was used for elution. After secondary purification (1:1 ratio), 20μL nuclease-free water was used for elution. The formula for calculating the amount of magnetic beads used in the first step of magnetic bead purification is: V = (181.44 + 0.14 × the number of selected wells) / 2.

[0155] Prepare the library enrichment system according to Table 6. The reaction system is 100 μL. The reaction procedure for library enrichment is: 98℃2min, 7 cycles (98℃10s, 60℃15s, 68℃2min), and store at 4℃. The number of cycles can be adjusted according to the amount of cells. Use Beckman AMpure XP beads to purify the library at a 1:1 ratio and elute with 20 μL of nuclease-free water. Qubit quantification and Agilent 2100 electrophoresis are used to detect the length distribution of the library. Figure 3 It can be seen that the library length ranges from 200 to 3000 bp, the main peak ranges from 300 to 1000 bp, and the library length range is well distributed.

[0156] Table 3 Components of transposase premix system

[0157] Components Final concentration Illumina Tagment DNA Enzyme(TDE1) 0.8μL / 10μL system <![CDATA[Terra TM PCR Direct DNA Polymerase]]> 0.05U / μL <![CDATA[M-MLV transcriptase(H + )]]> 1.6 U / μL

[0158] Table 4 cDNA fragmentation premix buffer components

[0159] Components concentration <![CDATA[Magnesium chloride (MgCl 2 )]]> 25mM TAPS-NaOH (pH = 8.5) 50mM N,N-Dimethylformamide (DMF) 50%v / v

[0160] Table 5: Adapter sequences and library enrichment primer sequences of i5 and i7

[0161]

[0162] Note: N is independently A, T, C or G.

[0163] Table 6 Library enrichment system components

[0164] Reagents Final concentration KAPA HIFI Hotstart master mix 1× P5 primer 0.25μM P7 primer 0.25μM Purified fragment library 20μL

[0165] Example 5: Construction of a single-cell full-length transcriptome library of non-cardiac myocytes in mouse heart

[0166] Referring to Example 2-4, the isolated non-cardiac myocytes of mouse heart were subjected to cell spraying and single cell sorting, and reverse transcription, cDNA pre-amplification, transposase fragmentation and library enrichment were performed in sequence, and the obtained library was subjected to Quibit quantification and diluted to 3 ng / μL for electrophoresis detection by Agilent 2100. The electrophoresis results showed that the main peak of the library ranged from 300 to 1000 bp, and the library length distribution range was good.

[0167] The sequencing was performed using an Illumina sequencer, and the sequencing mode was PE150. Since the index of this set of test reagents was set to 8 bases, the index read length was set to 8 bp (if a 10-base index was selected, the index read length was set to 10 bp). The measured data were subjected to statistics of the number of reads and single-cell clustering analysis. Figure 4 The results of two repeated library constructions of two cardiac non-cardiac cell samples (sample1 and sample2) from two mice treated in the same manner using the reagent combination of the present application (exemplary schemes are shown in Examples 2-4) and a commercial single-cell full-length transcriptome reagent (SMART-Seq ICELL8 Application Kit, purchased from TAKARA, catalog number: 640188) are shown, where A1 and A2 are the data of two repeated library constructions of the reagent combination of the present application, and B1 and B2 are the data of two repeated library constructions of the commercial reagents. Figure 4 The comparison results of the mouse heart non-cardiac single-cell full-length transcriptome library data show that the number of genes detected in single cells in the sequencing data (nFeature_RNA), the total number of molecules (nCount_RNA) ( Figure 4 a~4b), and the proportion of mitochondrial genes ( Figure 4 c), the data of the library constructed with the control commercial reagents are not much different; according to the single cell clustering results ( Figure 4 e~4h) It can be seen that, whether it is based on single cell clustering in library construction replication or single cell clustering in sample replication, the dispersion and clustering of cells in the same group are relatively consistent, indicating that the library construction data of the reagent combination of this application has the same credibility as the library construction data of the control commercial reagent. Figure 4 d) The proportion of ribosomal genes ranged from 1% to 10%, and the proportion in most cells was about 4%, which was much smaller than the control commercial reagent (ranging from 1% to 30%, and most of them were about 9%). This result shows that more efficient transcriptome data can be obtained using the improved reagent combination of the present application.

[0168] Example 6: Construction of mouse myocardial single cell full-length transcriptome library

[0169] Referring to Example 2-4, the isolated mouse cardiac cardiomyocytes were subjected to cell spraying and single cell sorting, and reverse transcription, cDNA pre-amplification, transposase fragmentation and library enrichment were performed in sequence. The obtained library was quantified by Quibit and diluted to 3 ng / μL for Agilent 2100 electrophoresis detection. Figure 5 That is, to obtain the length distribution diagram of the library, the main peak of the library ranges between 300 and 1000 bp, and the length distribution range of the library is good.

[0170] PE150 sequencing was performed using the Illumina novaseq6000 sequencer, with the index read length set to 8 bp. The measured data were subjected to reads statistics and single-cell clustering analysis. Figure 6 The results of library construction of two samples (sample 1 and sample 2) of the same batch of cardiac myocardial cells using the reagent combination of the present application (exemplary schemes are shown in Examples 2-4) and commercial reagents (SMART-Seq ICELL8 Application Kit, purchased from TAKARA, catalog number: 640188) are shown, where C is the library construction data of the reagent combination of the present application, and D is the library construction data of the commercial reagents mentioned above. Figure 6 The comparison results of mouse cardiac myocardial single cell full-length transcriptome library data show that the number of genes detected in single cells in the sequencing data (nFeature_RNA) and the total number of molecules (nCount_RNA) (respectively Figure 6 a, 6b), which is not much different from the library construction data of the control commercial reagent; according to the single cell clustering results ( Figure 6 e~6h) It can be seen that, regardless of the single cell clustering constructed with different reagents or the single cell clustering in repeated samples, the dispersion and clustering of cells in the same group are relatively consistent, indicating that the library construction data of the reagent combination of this application has the same credibility as the library construction data of the control commercial reagent. Figure 6 c shows that the proportion of mitochondrial genes ranges from 5% to 50%, and in most cells it is between 10% and 30%, which is much smaller than the control commercial reagent (range is 10% to 80%, and most are around 40%). Figure 6 d shows that the proportion of rRNA is also smaller than that of the control commercial reagent. This further illustrates that using the improved reagent combination of the present application to construct a single-cell transcriptome library can obtain more efficient transcriptome data, especially suitable for constructing a transcriptome library for cell types with high mitochondrial gene content.

[0171] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

[0172] Sequence information

[0173] SEQ ID NO:1 Oligo-dT

[0174] AAGCAGTGGTATCAACGCAGAGTAC(T) 30 VN

[0175] SEQ ID NO:2TSO

[0176] AAGCAGTGGTATCAACGCAGAGTACATrGrG+G

[0177] SEQ ID NO:3i5 linker

[0178] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTC SEQ ID NO:4i7 connector

[0179] CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGG SEQ ID NO:5P5 primer

[0180] AATGATACGGCGACCACCGA

[0181] SEQ ID NO:6P7 primer

[0182] CAAGCAGAAGACGGCATACGA

Claims

1. A method for generating a nucleic acid molecule library from an RNA sample, comprising: (1) Providing RNA samples; (2) using a reverse transcription primer to perform nucleic acid treatment including a reverse transcription reaction on the RNA sample to generate a nucleic acid product containing double-stranded DNA; (3) incubating the nucleic acid product with a transposase complex and a first reverse transcriptase; Wherein, the first reverse transcriptase has RNase H activity and nucleic acid polymerization activity; The transposase complex contains a transposase and a transposition sequence that the transposase can recognize and bind to, and can cut or break double-stranded DNA; The incubation is performed under conditions that allow the double-stranded DNA to be broken into nucleic acid fragments by the transposase complex and allow the first reverse transcriptase to exert its RNase H activity and nucleic acid polymerization activity; Thus, a nucleic acid molecule library is obtained.

2. The method of claim 1, wherein The first reverse transcriptase is capable of: (i) synthesizing a DNA chain using RNA as a template, and / or, (ii) synthesizing DNA using DNA as a template; Preferably, the first reverse transcriptase is selected from: M-MLV reverse transcriptase with RNase H activity, HIV-1 reverse transcriptase with RNase H activity, AMV reverse transcriptase with RNase H activity and telomerase reverse transcriptase with RNase H activity, as well as variants, modified products and derivatives of the above reverse transcriptases with RNase H activity.

3. The method of claim 1 or 2, wherein The transposase is selected from: TDE1 transposase, Tn5 transposase, MuA transposase, Sleeping Beauty transposase, Mariner transposase, Tn7 transposase, Tn10 transposase, Ty1 transposase, Tn552 transposase, and variants, modified products and derivatives having the transposition activity of the above transposases.

4. The method of any one of claims 1 to 3, wherein The nucleic acid molecule library is used for transcriptome sequencing; Preferably, the RNA sample comprises mRNA.

5. The method of claim 4, wherein in step (1), the RNA sample is an extracted RNA sample, or the RNA sample is provided intracellularly.

6. The method of claim 4 or 5, wherein in step (2), a nucleic acid product containing double-stranded DNA is produced by nucleic acid treatment comprising the following steps: (a) reverse transcribing the RNA sample using a reverse transcription primer and a second reverse transcriptase to generate a cDNA chain containing a 3' end overhang; and, (b) annealing the template switching sequence with the cDNA chain generated in (a), and performing an extension reaction to generate a double-stranded DNA containing the cDNA chain; wherein, The template switching sequence comprises a complementary sequence to the 3' terminal overhang; Preferably, (a) and (b) are carried out in the same reaction system, or in different reaction systems.

7. The method of claim 6, comprising one or more of the following features: (i) the overhang has a length of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 or more nucleotides; preferably, the overhang is an overhang of 2-5 cytosine nucleotides (e.g., a CCC overhang); (ii) the second reverse transcriptase has terminal transfer activity; preferably, the second reverse transcriptase can synthesize a cDNA chain using RNA (eg, mRNA) as a template, and add the overhang to the 3' end of the cDNA chain; (iii) the second reverse transcriptase has no or reduced RNase H activity; (iv) the reverse transcription primer comprises a poly(T) sequence; preferably, the poly(T) sequence is located at the 3' end of the primer; preferably, the poly(T) sequence comprises at least 5 (e.g., at least 10, at least 15, or at least 20) thymine nucleotide residues; (v) the template switching sequence comprises at its 3' end a complementary sequence to a 3' terminal overhang; (vi) the template switch sequence does not contain modified nucleotides, or contains modified nucleotides (e.g., locked nucleic acids); preferably, the template switch sequence contains one or more (e.g., 1, 2, 3, 4, 5) locked nucleic acid modifications at its 3' end; (vii) the template switching sequence and / or the reverse transcription primer comprises a purification tag; (viii) The template switching sequence and / or the reverse transcription primer comprises a unique molecular index sequence (UMI).

8. The method of claim 6 or 7, wherein In step (1), the RNA sample is provided inside a cell; and (a) and / or (b) of step (2) are performed outside or inside a cell; For example, (a) and (b) of step (2) are performed outside the cell; preferably, the method further comprises a step of lysing the cells to release intracellular RNA before (a); For example, (a) and (b) of step (2) are performed in cells; preferably, the method further comprises a step of fixing and / or permeabilizing the cells before (a); For example, (a) of step (2) is performed inside the cell, and (b) of step (2) is performed outside the cell; preferably, the method further comprises a step of fixing and / or permeabilizing the cells before (a), and / or, the method further comprises a step of lysing the cells to release intracellular nucleic acid molecules after (a) and before (b).

9. The method of claim 8, wherein (a) and (b) of step (2) are performed inside the cell, and step (3) is performed inside or outside the cell; For example, the step (3) is performed in cells; preferably, the method further comprises, after step (3), a step of lysing the cells to release the nucleic acid product of step (3); For example, step (3) is performed outside the cell; preferably, the method further comprises the step of lysing the cells to release the nucleic acid product of step (2) after step (2) and before step (3).

10. The method of any one of claims 1 to 9, wherein The incubation system of step (3) further comprises a first linker and a second linker, wherein the first linker and the second linker are capable of annealing to the transposition sequence or its complementary sequence; for example, the transposase complex comprises a first transposition sequence and a second transposition sequence, wherein the first linker is capable of annealing to the first transposition sequence or its complementary sequence, and the second linker is capable of annealing to the second transposition sequence or its complementary sequence; Preferably, in step (3), the incubation is performed under conditions that allow the transposition product to extend the nucleic acid chain using the first adapter and / or the second adapter as primers; Preferably, the incubation system in step (3) further comprises a DNA polymerase capable of synthesizing DNA using the DNA as a template.

11. The method of any one of claims 1 to 10, comprising one or more features selected from the group consisting of: (i) the method further comprises a DNA purification and / or amplification step after step (2) and before step (3); (ii) the method does not include a DNA purification step after step (2) and before step (3); (iii) The method further comprises a DNA purification and / or amplification step after step (3).

12. The method of any one of claims 4 to 11, wherein The nucleic acid molecule library is used for single-cell transcriptome sequencing.

13. The method of claim 12, wherein in step (1), the RNA sample is extracted from a single cell.

14. The method of claim 12, wherein in step (1), the RNA sample is provided in a cell; step (1) comprises: One or more cells comprising the RNA sample are provided.

15. The method of claim 14, wherein In step (1), at least 2 cells are provided; Preferably, before performing step (2), the cells are divided into at least two subsets (for example, the cells are divided into at least two subsets in a microplate); Preferably, in step (2), the RNA of the cells in each subset is subjected to nucleic acid treatment including reverse transcription reaction using reverse transcription primers to generate nucleic acid products containing double-stranded DNA.

16. The method of claim 15, wherein The nucleic acid products of step (2) or step (3) derived from different subsets contain subset-specific tag sequences that are different from each other; the nucleic acid products produced from the same subset contain the same subset-specific tag sequence; For example, in step (2), for different subsets, the reverse transcription primers used have different tag sequences A; thus, the nucleic acid products of step (2) generated from cells of each subset contain different tag sequences A as subset-specific tag sequences; For example, in step (2), for different subsets, the template switching sequences used have different tag sequences B; thus, the nucleic acid products of step (2) generated from cells of each subset contain different tag sequences B as subset-specific tag sequences; For example, step (3) includes using a first adapter and a second adapter, wherein the first adapter and the second adapter are as defined in claim 10, and the first adapter contains a tag sequence C, and the second adapter optionally contains a tag sequence D; for different subsets, the first adapters used have tag sequences C that are different from each other; thereby, the nucleic acid products of step (3) generated from cells of each subset contain tag sequences C that are different from each other as subset-specific tag sequences; For example, step (3) includes using a first adapter and a second adapter, wherein the first adapter and the second adapter are as defined in claim 10, and the first adapter optionally contains a tag sequence C, and the second adapter contains a tag sequence D; for different subsets, the second adapters used have tag sequences D that are different from each other; thereby, the nucleic acid products of step (3) generated from cells of each subset contain tag sequences D that are different from each other as subset-specific tag sequences; For example, step (3) includes using a first linker and a second linker, wherein the first linker and the second linker are as defined in claim 10, and the first linker contains a tag sequence C and the second linker contains a tag sequence D; for different subsets, the first linker and the second linker used have different combinations of tag sequences C and tag sequences D; thereby, the nucleic acid products of step (3) produced from cells of each subset contain different combinations of tag sequences C and tag sequences D as subset-specific tags.

17. The method of claim 15 or 16, wherein The method further comprises identifying and selecting a subset containing only one cell; Preferably, the method is to identify and screen a subset containing only one cell by cell staining; Preferably, the method performs subset sorting and identification through the ICELL8 platform.

18. The method of any one of claims 15 to 17, wherein After performing step (2) or step (3), the nucleic acid products or cells containing the nucleic acid products of each subset are combined.

19. The method of any one of claims 15 to 18, wherein The nucleic acid molecule library is used for full-length single-cell transcriptome sequencing; Preferably, after performing step (3), the nucleic acid products or cells containing the nucleic acid products of the respective subsets are combined.

20. A transcriptome sequencing method, comprising: Constructing a nucleic acid molecule library according to the method described in any one of claims 4 to 19; and, The nucleic acid molecule library is sequenced.

21. A reagent combination comprising: a transposase and a first reverse transcriptase, wherein: The first reverse transcriptase has RNase H activity and nucleic acid polymerization activity; Preferably, the first reverse transcriptase and the transposase are provided as separate or mixed components.

22. The reagent combination of claim 21, further comprising one or more selected from the following: (i) a transposable sequence (e.g., a first transposable sequence and / or a second transposable sequence); preferably, the transposable sequence and the transposase are provided in the form of a complex, or the transposable sequence and the transposase are provided as separate components; (ii) a second reverse transcriptase having terminal transfer activity; preferably, the second reverse transcriptase has no or reduced RNase H activity; (iii) a reverse transcription primer; preferably, the reverse transcription primer comprises a poly(T) sequence; preferably, the poly(T) sequence is located at the 3' end of the primer; preferably, the poly(T) sequence comprises at least 5 (e.g., at least 10, at least 15, or at least 20) thymine nucleotide residues; preferably, the reverse transcription primer further comprises a purification tag, a unique molecule index sequence (UMI) and / or a tag sequence A; (iv) a template switching sequence; preferably, the template switching sequence comprises a complementary sequence of the 3' terminal overhang at its 3' end; preferably, the template switching sequence comprises one or more (e.g., 1, 2, 3, 4, 5) locked nucleic acid modifications at its 3' end; preferably, the template switching sequence further comprises a purification tag, a unique molecular identifier sequence (UMI) and / or a tag sequence B; (v) a first adapter, wherein the first adapter comprises a sequence capable of annealing to a transposition sequence (e.g., a first transposition sequence) or a complementary sequence thereof; preferably, the first adapter further comprises a tag sequence C and / or a unique molecular tag sequence (UMI); (vi) a second adapter, wherein the second adapter comprises a sequence capable of annealing to a transposition sequence (e.g., a second transposition sequence) or a complementary sequence thereof; preferably, the second adapter further comprises a tag sequence D and / or a unique molecular tag sequence (UMI); (vii) a polymerase capable of synthesizing DNA using DNA as a template; Preferably, the kit further comprises reagents for sequencing; for example, reagents for next-generation sequencing.

23. The reagent combination of claim 21 or 22, wherein The first reverse transcriptase is selected from: M-MLV reverse transcriptase with RNase H activity, HIV-1 reverse transcriptase with RNase H activity, AMV reverse transcriptase with RNase H activity and telomerase reverse transcriptase with RNase H activity, as well as variants, modified products and derivatives of the above reverse transcriptases with RNase H activity; and / or, the transposase is selected from: TDE1 transposase, Tn5 transposase, MuA transposase, Sleeping Beauty transposase, Mariner transposase, Tn7 transposase, Tn10 transposase, Ty1 transposase, Tn552 transposase, as well as variants, modified products and derivatives with transposition activity of the above transposases.

24. The reagent combination of any one of claims 21 to 23, further comprising a microplate.

25. Use of the reagent combination according to any one of claims 21 to 24 for constructing a nucleic acid molecule library or for performing transcriptome sequencing; Preferably, the nucleic acid molecule library is used for transcriptome sequencing (eg, single-cell transcriptome sequencing); Preferably, the reagent combination is used to perform single-cell transcriptome sequencing; preferably, the reagent combination is used to analyze the gene expression level of the cell, the gene transcription start position, and / or the variable splicing of RNA molecules.

Images