CRISPR / Cas system-based variable-temperature nucleic acid detection kit and detection method

Abstract

The invention discloses a variable-temperature nucleic acid detection kit and a variable-temperature nucleic acid detection method based on a CRISPR / Cas system. The invention develops a variable-temperature and single-step nucleic acid detection kit based on cooperative regulation of PAM site and temperature on Cas system reaction, and can effectively improve the detection sensitivity, shorten the detection time and improve the detection efficiency. The invention also provides a variable-temperature nucleic acid detection method based on the CRISPR / Cas system, and high-sensitivity detection of clinical samples (such as HPV-16, HPV-18, mycoplasma pneumoniae and the like) can be realized through the kit and a variable-temperature reaction (pre-incubation at 37-42 DEG C and then heating to 45-60 DEG C for reaction).

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and in particular relates to a temperature-variable nucleic acid detection kit and a detection method based on the CRISPR / Cas system. Background Art

[0002] The CRISPR / Cas system, which originates from the adaptive immune mechanism of prokaryotes, has brought revolutionary progress to in vivo gene editing technology with its high specificity, simplicity and high efficiency. In particular, the discovery of the trans-cleavage activity of systems such as CRISPR-Cas12a has further opened up new directions in the field of in vitro diagnosis. However, in the widely used CRISPR-Cas12 system, a short PAM motif containing the "TTTV" sequence is a prerequisite for the Cas protein to bind and cleave targets. This inherent requirement limits its scope of application and reduces its programmability, especially when developing detection for mutations, because some mutation sites, as markers of drug resistance and tumor development, are not always adjacent to the classic TTTV PAM site. Although many studies have tried to relax specific PAM requirements and are continuing to search for or engineer protein variants without PAM requirements, most methods are cumbersome and lack simplicity and flexibility. At present, whether in in vivo gene editing or in vitro detection applications, the vast majority of studies focus on the PAM sites of the classic TTTV, but the abundance of non-classical PAM sites is much higher than that of the classic PAM. Therefore, it is of great research value to systematically and meticulously screen PAM sites in order to obtain more non-classical PAM sites whose reaction efficiency is comparable to or close to that of classical PAM.

[0003] Recent studies have found that in addition to the classical PAM of TTTV, there are some C-rich PAM sites such as CTTV, TCTV and TTCV, which are suboptimal non-classical PAMs with slightly lower activity than the classical PAM. These suboptimal non-classical PAMs have been used to develop simple and sensitive one-tube nucleic acid detection technology. The principle is that the CRISPR system mediated by non-classical PAM has a slower enzyme cleavage rate than the traditional TTTV classical PAM, which can reduce the damage to the target and primers in the early stage of the one-tube reaction and help accumulate the amplification products in the early stage. However, this low efficiency also affects the later CRISPR detection and signal output to a non-optimal level, thereby affecting its detection sensitivity. Therefore, it is of great application value to develop a detection technology that is not restricted by PAM sites and has high sensitivity. Summary of the invention

[0004] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a temperature-variable nucleic acid detection kit based on the CRISPR / Cas system.

[0005] Another object of the present invention is to provide a temperature-variable nucleic acid detection method based on the CRISPR / Cas system.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A variable temperature nucleic acid detection kit based on the CRISPR / Cas system, comprising a CRISPR / Cas detection system and an isothermal amplification system; wherein:

[0008] The CRISPR / Cas detection system includes Cas protein, guide RNA (crRNA) designed based on PAM site, CRISPR / Cas reaction buffer and fluorescent reporter probe.

[0009] The Cas protein includes Cas12 series proteins or Cas13 series proteins; preferably Cas12a, Cas12b and Cas12c proteins, etc.; further preferably LbCas12a protein.

[0010] The PAM site is NNNN (N=A, T, C, G) (excluding the classical PAM site TTTV); preferably at least one of WCAC, ACCM, ACGS, ACTV, ATCC, MTTN, CCAV, CCBN, CTAC, CTCN, CTGN, CTGV, GCAS, GCYV, GCGN, GTTV, TCBN and TTVN (81 in total); wherein Y=C or T; M=A or C; S=G or C; W=A or T; B=G, T or C; V=G, A or C; N=A, T, C or G; further preferably CCCV, CCTV, CTCV, CTTN, GTTV, TCGN, TCTN, TTAV, TTCN, TTGN (35 in total, 35 non-classical PAMs at 45°C can achieve trans-cleavage activity equivalent to that of the classical PAM TTTV); wherein V=G, A or C; N=A, T, C or G.

[0011] The guide RNA (crRNA) is designed according to the nucleic acid sample to be tested (target nucleic acid chain), including two regions, a repeat region and a spacer region, and the target position is restricted by different PAM sites; crRNA has no sequence length requirement (generally about 40 to 44 nt in length), and it is only necessary to find the PAM site of the four bases upstream and the crRNA complementary region of 20 bases downstream during design; the four bases of the PAM site are NNNN (N=A / T / C / G); the nucleotide sequence of the guide RNA is preferably at least one of SEQ ID NO.36 (the nucleic acid sample to be tested is HPV-16), SEQ ID NO.40 (the nucleic acid sample to be tested is HPV-18) and SEQ ID NO.43 (the nucleic acid sample to be tested is Mycoplasma pneumoniae).

[0012] The nucleic acid samples to be tested include nucleic acid samples extracted by standardized laboratories, clinical samples, etc.

[0013] The clinical samples include but are not limited to nasopharyngeal swab samples, cervical swabs, anal swabs, blood, urine, amniotic fluid, peritoneal effusion and alveolar lavage fluid, etc.; preferably, samples containing human papillomavirus (HPV) or Mycoplasma pneumonia (Mycoplasmapneumonia, Mp); more preferably, samples containing human papillomavirus HPV-16, human papillomavirus HPV-18 or Mycoplasma pneumonia.

[0014] The CRISPR / Cas reaction buffer is a universal buffer for the CRISPR / Cas system; preferably a Cas12 reaction buffer.

[0015] The isothermal amplification system includes isothermal amplification primers and a reaction solution; preferably, it includes isothermal amplification primers, a reaction solution and a magnesium acetate solution; wherein, the reaction solution includes amplification raw materials (dNTPs), isothermal amplification reaction buffer and isothermal amplification enzyme, which can be directly obtained from the market, preferably the Primer-Free-Rehydration-buffer in the RPA nucleic acid amplification kit.

[0016] The isothermal amplification includes at least one of loop-mediated isothermal amplification (LAMP), recombinase polymerase isothermal amplification (RPA), recombinase-mediated isothermal nucleic acid amplification (RAA), helicase-dependent isothermal amplification (HDA), strand displacement amplification (SDA), rolling circle amplification (RCA), exponential isothermal amplification (EXPAR), nucleic acid sequence-dependent amplification (NASBA), single primer isothermal amplification technology (SPIA), chimeric primer-induced nucleic acid isothermal amplification (ICAN) and strand exchange amplification technology (SEA); preferably, recombinase polymerase isothermal amplification (RPA) is selected from the group consisting of:

[0017] The isothermal amplification primers are designed according to the conventional methods in the art based on the nucleic acid sample to be tested (target nucleic acid chain) and the isothermal amplification method adopted; taking RPA as an example, the primer length is generally required to be 30-36 nt, the primer GC content (GC%) is 20%-70%, the primer Tm value (melting temperature) is 50-100 (°C), and the length of the amplification product is 80-500 bp; the nucleotide sequence of the isothermal amplification primer is preferably at least one (pair) of the primer pairs of SEQ ID NO.33-34 (the nucleic acid sample to be tested is HPV-16), SEQ ID NO.37-38 (the nucleic acid sample to be tested is HPV-18) and SEQ ID NO.41-42 (the nucleic acid sample to be tested is Mycoplasma pneumoniae).

[0018] The isothermal amplification raw materials are dNTPs, including dATP, dTTP, dCTP, and dGTP.

[0019] The isothermal amplification reaction buffer is a universal buffer for isothermal amplification systems; preferably, it is an RPA reaction buffer.

[0020] The isothermal amplification enzyme includes at least one of Bst enzyme, single-stranded DNA binding protein (SSB), strand displacement DNA polymerase, and recombinase capable of binding to single-stranded nucleic acid.

[0021] The fluorescent reporter probe is a nucleotide labeled with a fluorescent element and a quenching group; it is generally a short single-stranded DNA probe with a length of 5 to 15 nt, with fluorescent and quenching groups labeled at both ends, respectively, and basically no sequence restrictions; its nucleotide sequence is preferably as shown in SEQ ID NO.44 (high efficiency).

[0022] The initial concentration of each component in the kit can be set according to actual needs, such as the concentration of Cas12a protein can be set to 500nM, the concentration of crRNA can be set to 500nM, the concentration of fluorescent reporter probe can be set to 50μM, the concentration of RPA upstream and downstream primers can be set to 10μM, and the concentration of magnesium acetate solution can be set to 350mM.

[0023] The conditions for the variable temperature nucleic acid detection based on the CRISPR / Cas system are: first react at 37-42°C for 3-30 minutes (pre-incubation) (this stage ensures the accumulation of sufficient amplification products), and then heat to 45-60°C (i.e., heat 8-18°C) for 5-60 minutes (at this stage, the accumulated amplification products in the previous stage efficiently activate the CRISPR reaction system to achieve shearing of the signal probe and signal output); preferably: first react at 37-42°C for 5-30 minutes, then heat to 45-60°C for 10-60 minutes; further preferably: first react at 37°C for 10 minutes, then heat to 45°C for 10-30 minutes.

[0024] The application of the CRISPR / Cas system-based temperature-variable nucleic acid detection kit in detecting nucleic acids for purposes other than disease diagnosis and treatment.

[0025] The nucleic acid includes nucleic acid samples extracted by standardized laboratories, clinical samples, and the like.

[0026] The clinical samples include but are not limited to nasopharyngeal swab samples, cervical swabs, anal swabs, blood, urine, amniotic fluid, peritoneal effusion and alveolar lavage fluid, etc.; preferably, samples containing human papillomavirus (HPV) or Mycoplasma pneumonia (Mycoplasmapneumonia, Mp); more preferably, samples containing human papillomavirus HPV-16, human papillomavirus HPV-18 or Mycoplasma pneumonia.

[0027] A method for detecting nucleic acids at a variable temperature based on the CRISPR / Cas system for non-disease diagnosis and treatment purposes, comprising using the above-mentioned CRISPR / Cas system-based variable temperature nucleic acid detection kit for detection; the specific steps are as follows:

[0028] (1) Prepare the reaction system:

[0029] The nucleic acid sample to be tested, the CRISPR / Cas detection system (Cas protein, guide RNA designed based on the PAM site, CRISPR / Cas reaction buffer and fluorescent reporter probe) and the isothermal amplification system (isothermal amplification primers, reaction solution and magnesium acetate solution) are mixed to prepare a reaction system;

[0030] (2) Nucleic acid testing

[0031] The reaction system prepared in step (1) is first reacted (pre-incubated) at 37-42° C. for 3-30 minutes, then heated to 45-60° C. for 5-60 minutes, and real-time fluorescence signals are collected;

[0032] (3)Judgment

[0033] If the detection result in step (2) shows a fluorescent signal and it gradually increases (the fluorescence curve is S-shaped), it means that the nucleic acid sample to be tested is a positive sample; conversely, if the detection result in step (2) shows no obvious change in the fluorescent signal, it means that the sample to be tested is a negative sample.

[0034] In step (1), for different nucleic acid samples to be tested, the PAM site can be selected from any one of the above-mentioned PAM sites.

[0035] The nucleic acid samples to be tested in step (1) include nucleic acid samples extracted by standardized laboratory methods and clinical samples.

[0036] The clinical samples include but are not limited to nasopharyngeal swab samples, cervical swabs, anal swabs, blood, urine, amniotic fluid, peritoneal effusion and alveolar lavage fluid, etc.; preferably, samples containing human papillomavirus (HPV) or Mycoplasma pneumonia (Mycoplasma pneumonia, Mp); more preferably, samples containing the L1 gene of human papillomavirus HPV-16, the L1 gene of human papillomavirus HPV-18 or the P1 gene of Mycoplasma pneumonia; wherein,

[0037] When the nucleic acid sample to be tested is human papillomavirus HPV-16, the isothermal amplification primers and guide RNA can be designed according to the L1 gene of HPV-16 (the PAM site is preferably: CCCC); the isothermal amplification primers are preferably as shown in SEQ ID NO.33-34, and the guide RNA designed based on the PAM site is preferably as shown in SEQ ID NO.36;

[0038] When the nucleic acid sample to be tested is human papillomavirus HPV-18, the isothermal amplification primers and guide RNA can be designed according to the L1 gene of HPV-16 (the PAM site is preferably: CCTG); the isothermal amplification primers are preferably as shown in SEQ ID NO.37-38, and the guide RNA designed based on the PAM site is preferably as shown in SEQ ID NO.40;

[0039] When the nucleic acid sample to be tested is Mycoplasma pneumoniae, the isothermal amplification primers and guide RNA can be designed according to the P1 gene of Mycoplasma pneumoniae (the PAM site is preferably: TTAG); the isothermal amplification primers are preferably as shown in SEQ ID NO.41-42, and the guide RNA designed based on the PAM site is preferably as shown in SEQ ID NO.43.

[0040] The final concentration of the Cas protein in the reaction system described in step (1) is 10 to 600 nmol / L; preferably 10 to 100 nmol / L; more preferably 10 nmol / L.

[0041] The final concentration of the guide RNA (crRNA) designed based on the PAM site in the reaction system described in step (1) is 10 to 600 nmol / L; preferably 10 to 100 nmol / L; more preferably 10 nmol / L.

[0042] The final concentration of the fluorescent reporter probe in the reaction system described in step (1) is 100 nmol / L to 1.2 μmol / L; preferably 200 nmol / L to 1 μmol / L; more preferably 1 μmol / L; to ensure that there are sufficient fluorescent reporter probes near the target nucleic acid that can be cut.

[0043] The final concentration of the isothermal amplification primers (upstream and downstream primers) in the reaction system described in step (1) is 10-600 nmol / L, preferably 250 nmol / L.

[0044] The final concentration of magnesium acetate in the reaction system described in step (1) is 14 to 280 mmol / L, preferably 14 mmol / L.

[0045] The conditions for nucleic acid detection described in step (2) are preferably: first react (pre-incubate) at 37-42°C for 5-30 minutes, then heat to 45-60°C for 10-60 minutes; more preferably: first react at 37°C for 10 minutes, then heat to 45°C for 10-30 minutes.

[0046] The principle of the present invention is as follows:

[0047] The present invention constructs a single-tube one-step variable temperature CRISPR nucleic acid detection technology that is coordinated and regulated by PAM sites and temperature. This method uses non-classical PAM sites to reduce the damage to the target and primers by the CRISPR system in the early stage of the single-tube reaction. The nucleic acid amplification reaction at this stage is the dominant reaction, so sufficient amplification products can be accumulated under the premise of minimal interference. Since the crRNA of non-classical PAM has a shearing activity comparable to that of classical PAM at higher temperatures, we add a variable temperature step. At this time, the raw materials of the early amplification reaction are exhausted, and sufficient amplification products activate the efficient CRISPR reaction, achieving efficient, rapid and sensitive single-tube nucleic acid detection.

[0048] Compared with the prior art, the present invention has the following advantages and effects:

[0049] 1. Compared with the step-by-step reaction system, the kit and method of the present invention avoid the generation of aerosol pollution and simplify the experimental steps.

[0050] 2. Compared with other existing CRISPR one-tube reaction systems (crRNA design is limited to the PAM site of TTTV), the present invention is basically not limited by the PAM site.

[0051] 3. Compared with the constant temperature non-classical PAM-based CRISPR detection scheme (sPAMC), the non-classical PAM-mediated variable temperature one-pot CRISPR-Cas12a detection platform (POP-CRISPR) developed in the present invention has greatly improved the comprehensive detection performance (increased sensitivity, shortened detection time, single-base mismatch resolution ability, etc.).

[0052] 4. Compared with optimizing the Cas reaction system (for example, reducing the concentration of Cas protein in the system), the kit and method of the present invention can achieve high-sensitivity nucleic acid detection.

[0053] 5. Compared with the conventional one-tube detection method based on the CRISPR system, the present invention invents a variable temperature, single-step nucleic acid detection method based on the new discovery of the coordinated regulation of the PAM site and temperature on the response of the Cas system, achieving improvements in sensitivity, specificity and detection efficiency.

[0054] 6. Compared with most existing CRISPR-based one-tube detection systems that require standardized laboratory extraction of nucleic acid samples, the present invention only requires rapid processing of clinical samples (including but not limited to nasopharyngeal swab samples, cervical swabs, anal swabs, blood, urine, amniotic fluid, peritoneal effusion, alveolar lavage fluid, etc.) to achieve highly sensitive detection, and can quickly and on-site detect clinical pathogen samples within 20 minutes, greatly shortening the sample-in-result-out operation time. It can be used for early rapid screening of HPV-16 and HPV-18, and can also be used for rapid identification of Mycoplasma pneumoniae infection (distinguishing bacterial pneumonia from viral pneumonia, etc.). Targeted treatment plans can be quickly formulated based on the test results, effectively avoiding the abuse of antibiotics. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 It is a scatter plot of the construction method of 256 PAM full-map target DNA libraries and the trans-cleavage activity test of 256 PAM sites at reaction temperatures of 37 and 45°C; wherein, a is a schematic diagram of LbCas12a bound to the target double-stranded DNA (the red arrow indicates the specific interaction between the LbCas12a residues and the PAM site bases); b is the construction method of 256 PAM full-map target DNA libraries; c is a scatter plot of the trans-cleavage activity test of 256 PAM sites at a reaction temperature of 37°C; d is a scatter plot of the trans-cleavage activity test of 256 PAM sites at a reaction temperature of 45°C.

[0056] Figure 2 It is an experimental result diagram of high temperature promoting the trans-cleavage activity of Cas12a; wherein, a is the thermal stability evaluation result of LbCas12a (① and ② represent the order of sample addition, N = 3 repetitions); b is the thermal stability evaluation result of crRNA; c is the thermal stability evaluation result of LbCas12a-crRNA complex; d is the thermal stability evaluation of LbCas12a after activation by target DNA; e is the maintenance of the trans-cleavage activity of LbCas12a protein after activation by target DNA at different temperatures.

[0057] Figure 3It is a gel imaging analysis diagram of the cis-cutting activity of Cas12a mediated by crRNA of two TTTA classical PAMs and two non-classical PAMs of TCCA and TTGG; wherein, a and b are gel imaging analysis diagrams of the cis-cutting activity of Cas12a mediated by crRNA of two TTTA classical PAMs; c and d are gel imaging analysis diagrams of the cis-cutting activity of Cas12a mediated by crRNA of two non-classical PAMs of TCCA and TTGG, respectively.

[0058] Figure 4 It is a result diagram of the synergistic regulation of non-classical PAM and temperature to enhance the specificity of the Cas12a system; wherein, a is a DNA double-stranded target whose PAM site is the classical PAM TTTA, and two consecutive base mutations are designed at different positions of the crRNA spacer, and the trans-cleavage activity of different crRNA variants at 45, 53 and 55°C is measured, and the end point fluorescence value of 30min is used as a bar graph; b is to select the position in a that is most sensitive to double base mutations at 45°C to design a single-base mutation mismatched crRNA variant, and the trans-cleavage activity of these different crRNA variants at 45, 53 and 55°C is measured, and the end point fluorescence value of 30min is used as a bar graph; c is to change the PAM site of the target to the non-classical GTTA, and the crRNA variants and experimental conditions are the same as a; d is to change the PAM site of the target to the non-classical GTTA, and the crRNA variants and experimental conditions are the same as b.

[0059] Figure 5 : is a comparison result diagram of the sensitivity of three CRISPR one-tube methods including the present invention for detecting HPV-16 and HPV-18; wherein a is the sensitivity of the one-tube method mediated by TTTA classical PAM for detecting HPV-16; b is the sensitivity of the one-tube method mediated by CCCC non-classical PAM (constant temperature 37°C) for detecting HPV-16; c is the sensitivity of the one-tube method mediated by CCCC non-classical PAM (first low temperature 37°C for 10 minutes and then heated to 45°C) for detecting HPV-16; d is the sensitivity of the three C e is the sensitivity comparison results of RISPR one-tube method for detecting HPV-16; e is the sensitivity of TTTA classical PAM-mediated one-tube method for detecting HPV-18; f is the sensitivity of CCTG non-classical PAM-mediated one-tube method (constant temperature 37°C) for detecting HPV-18; g is the sensitivity of CCTG non-classical PAM-mediated one-tube method (first low temperature 37°C for 10 minutes and then heated to 45°C) for detecting HPV-18; h is the sensitivity comparison results of three CRISPR one-tube methods for detecting HPV-18.

[0060] Figure 6It is a result diagram of the effect of different nucleic acid amplification times on detection sensitivity; wherein, a is the detection sensitivity of HPV-16; b is the detection sensitivity of HPV-18; and c is a schematic diagram of the working principle of the present invention.

[0061] Figure 7 The real-time fluorescence curve diagram is obtained by using the method of the present invention to detect 27 nasopharyngeal swab samples suspected of being infected with Mycoplasma pneumoniae. DETAILED DESCRIPTION

[0062] The present invention will be described in further detail below in conjunction with the examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. The test methods for which specific experimental conditions are not specified in the following examples are usually carried out according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention can be obtained commercially.

[0063] Example 1 Cas12a PAM site full map screening

[0064] (1) Construct a target DNA library containing 256 PAM site combinations (NNNN, N = A / T / C / G). The CRISPR-Cas12a system recognizes T-rich PAM sequences, where the LKL motif of the PI domain recognizes specific PAM bases, and the lysine residues of the WED domain form hydrogen bonds with the nucleotide phosphate groups of the PAM site, thereby stabilizing the formation of RNA-DNA hybrids ( Figure 1 a). Specifically, a circular plasmid was used as a template, and a PAM site was introduced into the PCR front primer to obtain a double-stranded DNA target library of 256 fragments with the same length (294 bp), the same spacer sequence (GGGGTTTGAGGTCCATTACA), but different PAM sites ( Figure 1 b). The obtained library is sequenced to confirm the sequence accuracy of the inserted PAM site, and the library target is accurately quantified by gel recovery purification and Qubit fluorometer to ensure the uniformity of target concentration in subsequent fluorescence experiments;

[0065] The sequences of the circular plasmid fragments used in this example are shown in Table 1.

[0066] Table 1

[0067]

[0068]

[0069] (2) Using the target DNA library with the same concentration as above as the target, and adding the CRISPR mixed reaction system (including reaction buffer, Cas protein, crRNA, fluorescent reporter probe), Cas12a in vitro fluorescence experiment was performed at 37°C and 45°C respectively and real-time fluorescence acquisition was performed ( Figure 1 c. Figure 1 d), the experiment was repeated 3 times.

[0070] The final concentrations of each component in the CRISPR mixed reaction system are: Cas protein concentration is 10nM, guide RNA (crRNA) concentration is 10nM, fluorescent reporter probe concentration is 500nM, and target DNA concentration is 1nM; that is, the reaction system (20μL) includes: Cas12a reaction buffer 2μL, Cas12a protein (200nM) 1μL, crRNA (200nM) 1μL, fluorescent reporter probe (20μM) 0.5μL, target DNA (20nM) 1μL, enzyme-free water 14.5μL. The Cas12a protein used is LbCas12a protein, and LbCas12a protein and its reaction buffer (1×Cas12a Reaction buffer) are purchased from Guangzhou Bolais Biological Co., Ltd. The sequences of the PCR primers and crRNA sequences used to construct the PAM full-map target library and the fluorescent reporter probe (FAM-6C-BHQ1) are shown in Table 2.

[0071] Table 2

[0072] Name Sequence(5'-3') PCR-F (294 bp) GGGGCTGATAGTATTTANNNNGGGGTTTGAGGTCCATT(SEQ ID NO.2) PCR-R (294 bp) CCAGGAGGTATCGGTGGAG(SEQ ID NO.3) crRNA UAAUUUCUACUAAGUGUAGAUGGGGUUUGAGGUCCAUUACA(SEQ ID NO.4) FAM-6C-BHQ1 FAM-CCCCCC-BHQ1 (SEQ ID NO. 44)

[0073] (3) Count the time it takes for the target at each PAM site to reach half of the maximum fluorescence value at a final concentration of 1 nM ( Figure 1 c. Figure 1 d), and classified these 256 PAM sites based on 5 min and 10 min, and divided all non-canonical PAMs into three categories: (1) suboptimal or best-performing PAMs (t≤5 min); (2) mediocre non-canonical PAMs (5 min <t≤10min);(3)Bad non-canonical PAM(t>10min)。

[0074] We found that by increasing the reaction temperature (from 37°C to 45°C), 81 non-classical PAMs were able to achieve trans-cleavage activity comparable to the classical PAM TTTV, and the number of suboptimal PAMs at 45°C increased from 5 at 37°C to 81 (Table 3). When observing the four-base composition of all PAMs, we found that the second base is crucial to the activity of Cas12a. Most PAMs with a second base of C or T exhibited high trans-cleavage activity at 45°C, while when the second base was A or G, the trans-cleavage activity was significantly reduced.

[0075] Table 3

[0076]

[0077] In the table, R=A / G; Y=C / T; M=A / C; K=G / T; S=G / C; W=A / T; H=A / T / C; B=G / T / C; V=G / A / C; D=G / A / T; N=A / T / C / G.

[0078] Example 2 High temperature improves Cas12a trans-cleavage activity

[0079] This example evaluates the reaction step at which the LbCas12a system is heat-resistant, and the specific steps are as follows:

[0080] (1) Evaluation of the thermal stability of LbCas12a

[0081] The LbCas12a protein (purchased from Guangzhou Bolais Biotechnology Co., Ltd.) was pre-incubated at 37, 45 and 53 ° C for 30 minutes, and the remaining components (crRNA, target DNA and fluorescent reporter probe) were added (the reaction system configuration and experimental conditions were the same as those in Example 1 above) for reaction at 45 ° C and real-time fluorescence collection. The signal was collected for 60 minutes, and the signal was collected once every minute. The experiment was repeated 3 times.

[0082] The results are as follows Figure 2 As shown in a: We found that the LbCas12a protease itself is extremely heat-labile, and pre-treatment of LbCas12a at 37, 45 and 53°C for 30 minutes resulted in complete loss of activity.

[0083] (2) Evaluate the thermal stability of crRNA.

[0084] After pre-incubating crRNA at 37°C, 45°C, and 53°C for 30 minutes, the remaining components (LbCas12a protein, target DNA, and fluorescent reporter probe) were added for reaction at 45°C and real-time fluorescence acquisition (the specific method is the same as the above step (1)), and the experiment was repeated 3 times.

[0085] The results are as follows Figure 2 As shown in b: When only crRNA is processed under the same temperature conditions (37, 45 and 53°C), the LbCas12a system can still work effectively.

[0086] (3) Evaluation of the thermal stability of the LbCas12a-crRNA complex

[0087] After pre-incubating LbCas12a protein and crRNA at 37°C, 45°C, and 53°C for 30 minutes, the remaining components (target DNA and fluorescent reporter probe) were added for reaction at 45°C and real-time fluorescence acquisition (the specific method is the same as the above step (1)), and the experiment was repeated 3 times.

[0088] The results are as follows Figure 2 As shown in c: The thermal stability of the LbCas12a protein and crRNA complex is better. The complex does not lose activity after pretreatment at 37°C, but is still intolerant to treatment at 45 and 53°C.

[0089] (4) Evaluation of the thermal stability of target DNA activated LbCas12a

[0090] After LbCas12a protein, crRNA and target DNA were pre-incubated at 37°C, 45°C and 53°C for 30 minutes, the fluorescent reporter probe was added for reaction at 45°C and real-time fluorescence acquisition (the specific method was the same as the above step (1)). The experiment was repeated 3 times.

[0091] The results are as follows Figure 2 As shown in d: In a system where LbCas12a protein, crRNA and target DNA coexist, the Cas12a reaction exhibits excellent heat resistance, indicating that this heat resistance only comes from the state of being activated by the DNA target.

[0092] (5) Testing the maintenance of the trans-cleavage activity of the activated LbCas12a protein at different temperatures

[0093] In view of the fact that the Cas12a protein activated by the target is so stable at high temperatures, we further tested the maintenance of its trans-cleavage activity of the activated Cas12a protein at different temperatures. The reaction system configuration is the same as in Example 1 above, and other reaction systems except the fluorescent reporter probe are configured (i.e., the fluorescent reporter probe is not added first) and stored at 4, 25, 37, and 45 ° C., and then the fluorescent reporter probe is added at 0, 4, 8, 12, 16, 36, 46, 56, and 66 days, and the reaction and signal collection are carried out at 45 ° C.

[0094] The results are as follows Figure 2As shown in e: It was found that the activity of the activated Cas12a protein was only slightly attenuated when stored at 4, 25, and 37°C for up to two months, and its activity could be maintained for nearly a month at 45°C.

[0095] Example 3 Synergistic regulation of Cas12a cis-cleavage activity by non-classical PAM and temperature

[0096] (1) Using the S gene fragment (S-gene fragment, 1000 bp) (SEQ ID NO.5) of the novel coronavirus SARS-CoV-2 as the target (the target used here is a plasmid containing the S-gene fragment, commissioned by Qingke Biosynthesis, and the vector used is PUC57), two crRNAs with a classical PAM site of TTTA and two crRNAs with non-classical PAM sites of TCCA and TTGG (non-classical PAM) were designed on this target. Among them,

[0097] The sequence of the S-gene fragment (SEQ ID NO.5) used in this example is as follows:

[0098] ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTC

[0099] AATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTC

[0100] AGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTCCAATGTTACTTGGTTCCATGCTATACAT

[0101] GTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTG

[0102] CTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGT

[0103] CCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCA

[0104] TTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAG

[0105] TGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAA

[0106] TTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACG

[0107] CCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAG

[0108] GTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTC

[0109] TTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAA

[0110] ATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGT

[0111] GTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACA

[0112] GAATCTATTGTTAGATTTCCTAATATTACAA。

[0113] The sequences (5'-3') of the two TTTA-crRNAs, TCCA-crRNA and TTGG-crRNA used in this example are as follows:

[0114] TTTA-crRNA5: UAAUUUCUACUAAGUGUAGUAGAAUAUUGAUGGUUAUUUU (SEQ ID NO.6); TTTA-crRNA11: UAAUUUCUACUAAGUGUAGAUAAAUAUAUUCUAAGCACACG (SEQ ID NO.7); TCCA-crRNA: UAAUUUCUACUAAGUGUAGAUCUGAGAAGUCUAACAUAAUA (SEQ ID NO.8);

[0115] TTGG-crRNA: UAAUUUCUACUAAGUGUAGAUUAGAUUUGCCAAUAGGUAUU (SEQ ID NO. 9).

[0116] (2) The final concentrations of the components in the CRISPR mixed reaction system are: Cas protein concentration is 10nM, guide RNA (crRNA) concentration is 10nM, and S-gene target concentration is 120nM; that is, the reaction system (total 20μL) includes: Cas12a reaction buffer 2μL, Cas12a protein (200nM) 1μL, crRNA (200nM) 1μL, target DNA (1.2μM) 2μL, enzyme-free water 14μL. The Cas12a protein (LbCas12a protein) and its reaction buffer (1×Cas12a Reaction buffer) used were purchased from Guangzhou Bolais Biological Co., Ltd. After the above mixed system was prepared, it was incubated at different time gradients (10-90min) at 37, 45, 53, and 55°C, and 2uL proteinase K was added at the corresponding time point to terminate the reaction. Finally, the product after the reaction was analyzed by 2% agarose electrophoresis.

[0117] The experimental results are as follows Figure 3 As shown, the results show that both classical PAM and non-classical PAM can mediate the cis-cleavage behavior of Cas12 in all the temperature ranges tested, but the efficiency of cis-cleavage mediated by classical PAM is significantly better than that of non-classical PAM. However, as the temperature rises, the trans-cleavage activity of double-stranded substrates mediated by non-classical PAM is significantly enhanced.

[0118] Example 4 Non-classical PAM and temperature synergistically regulate the specificity of CRISPR-Cas reactions

[0119] (1) Using the method of inserting a PAM site into the pre-amplification primer in Example 1 above, two targets with the classical PAM TTTA and the non-classical PAM GTTA were obtained (except for the difference in the PAM site, the other sequences and lengths were exactly the same).

[0120] (2) Design a set of crRNAs that introduce two consecutive mutations at different positions of the paired spacer, and use two sets of double-stranded DNA (100 pM) of the same concentration obtained in step (1) as targets to test the trans-cleavage activity of these crRNAs (SEQ ID NO.13-22) with double base mutations at different reaction temperatures (45, 53, 55°C) for 30 minutes. The CRISPR mixed reaction system is the same as step (2) of Example 1, except that the final concentration of the target DNA is 100 pM. The results are shown in Figure 2. Figure 4 a and Figure 4 As shown in c.

[0121] (3) Based on step (2), a group of crRNAs with single base mismatches (SEQ ID NO. 23-32) were designed at sites sensitive to double base mutations at 45°C, and the trans-cleavage activities of the two targets were also measured at different reaction temperatures (45, 53, 55°C) for 30 min (the CRISPR mixed reaction system was the same as step (2)). The results are shown in Figure 2. Figure 4 b and Figure 4 As shown in d.

[0122] The circular plasmid sequence and post-PCR primers used in this example are consistent with those in Example 1, and the sequences of the PCR primers used and the designed crRNA mutants are shown in Table 4 below. The above experimental results prove that non-classical PAM and high temperature can synergistically improve the specificity of Cas12a, enabling it to have single-base mismatch resolution capability.

[0123] Table 4

[0124]

[0125]

[0126] Example 5 CRISPR-Cas variable temperature one-tube nucleic acid detection method with non-classical PAM and temperature coordinated regulation

[0127] 1. Sensitivity of CRISPR one-tube method for detecting HPV-16 and HPV-18

[0128] (1) Using the L1 gene of human papillomavirus HPV-16 and HPV18 (NCBI ID: 1489082 and 1489090 respectively) as the target (the target used is a plasmid containing the L1 gene fragment, commissioned by Qingke Biosynthesis, and the vector used is PUC57), RPA primers and non-classical PAM CCCC and CCTG-mediated crRNA were designed respectively. Among them,

[0129] The RPA primers and CCCC and CCTG-mediated crRNA sequences used in this example are shown in Table 5.

[0130] Table 5

[0131] Name Sequence(5'-3') HPV-16RPA-F GACTACTTGCAGTTGGACATCCCTATTTTCCT(SEQ ID NO.33) HPV-16RPA-R CTACCTCAACACCTACACAGGCCCAAACCA(SEQ ID NO.34) HPV-16TTTA-crRNA UAAUUUCUACUAAGUGUAGAUGAAUACAUUUACCUGACCCC(SEQ ID NO.35) HPV-16CCCC-crRNA UAAUUUCUACUAAGGUAGUAUAAUAAGUUUGGUUUUCCUGA(SEQ ID NO.36) HPV-18RPA-F TTGGAAGATGGTGATATGGTAGATACTGG(SEQ ID NO.37) HPV-18RPA-R TATAAGGATTGAGGCACAGTGTCACCCAT(SEQ ID NO.38) HPV-18TTTA-crRNA UAAUUUCUACUAAGUGUAGAUGUACAUUGCAAGAUACUAAA(SEQ ID NO.39) HPV-18CCTG-crRNA UAAUUUCUACUAAGUGUAGAUAUUAUUUACAAAUGUCUGCA(SEQ ID NO.40)

[0132] (2) Prepare 50 μL of CRISPR one-tube reaction system, including 37 μL of RAA amplification system and 13 μL of CRISPR reaction system; the concentrations of each component are as follows:

[0133] Primer-Free-Rehydration-buffer (from the RPA nucleic acid amplification kit, containing RPA nucleic acid amplification buffer, amplification raw materials (dNTPs) and isothermal amplification enzyme) is 25 μL, RPA upstream and downstream primers (10 μM) are 1.25 μL each, magnesium acetate solution (350 mM) is 2 μL, and the target nucleic acid to be tested with a known concentration of gradient dilution is 7.5 μL;

[0134] Cas12a reaction buffer 5 μL, Cas12a protein (500 nM) 1 μL, crRNA (500 nM) 1 μL, fluorescent reporter probe (50 μM) 1 μL, enzyme-free water 5 μL;

[0135] Among them, the RPA nucleic acid amplification kit was purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd., the Cas12a protein (i.e., LbCas12a protein) and Cas12a reaction buffer were purchased from Guangzhou Bolais Biotechnology Co., Ltd., and the fluorescent reporter probe was the same as in Example 1.

[0136] (3) The one-tube reaction system prepared above was subjected to a constant temperature reaction at 37°C and a variable temperature reaction of first keeping the temperature at 37°C for 10 min and then heating the temperature to 45°C. The signal was collected for 60 min using the Bio-Rad CFX96 Touch Real-Time PCR System, with the signal collected once per minute. The sensitivity was compared with that of the TTTA-mediated one-tube method. The experiment was repeated three times.

[0137] The results are as follows Figure 5(NTC stands for no target control): The results show that the one-tube method mediated by the classical PAM TTTA shows weak detection sensitivity, and the non-classical PAM CCCC improves the detection sensitivity. In the present invention, the detection sensitivity can be significantly improved by the coordinated regulation of non-classical PAM CCCC and temperature, which is an order of magnitude higher than that of 37°C isothermal nucleic acid amplification. Therefore, the present invention adopts PAM sites and performs a 37-45°C variable temperature program. At 37°C, isothermal nucleic acid amplification is at an advantage and can be less interfered by CRISPR cutting. At 45°C, CRISPR detection shows the best efficiency, thereby effectively improving the detection effect.

[0138] 2. Effect of different nucleic acid amplification times on detection sensitivity

[0139] A one-tube reaction system was prepared in the same manner as above, and the reaction was performed at 37°C for 5, 10 and 30 min, and then at 45°C for a variable temperature reaction. The signal was collected for 60 min using the Bio-Rad CFX96 Touch Real-Time PCR System, with the signal collected once per minute. The experiment was repeated three times.

[0140] The results are as follows Figure 6 As shown: It was found that shortening the amplification time to 10 minutes can achieve higher detection efficiency than 30 minutes. In contrast, the overall detection signal is lowest when the amplification time is 5 minutes ( Figure 6 a and Figure 6 b). Therefore, for the method of the present invention, an amplification time of about 10 minutes is sufficient to accumulate sufficient products, and starting the CRISPR detection procedure at high temperature in advance is beneficial for improving the detection sensitivity ( Figure 6 c).

[0141] Example 6 Non-classical PAM and temperature coordinated CRISPR-Cas variable temperature one-tube nucleic acid detection method for the detection of Mycoplasma pneumoniae clinical samples

[0142] (1) Using the P1 gene of Mycoplasma pneumoniae (NCBI ID: 3776070) as the target, RPA primers and crRNA with TTAG non-classical PAM were designed. The RPA primers and TTAG-mediated crRNA sequences used in this example are shown in Table 6:

[0143] Table 6

[0144]

[0145] (2) A rapid lysis buffer containing Chelex-100 was used to rapidly lyse and release nasopharyngeal swab samples collected clinically from 27 cases of suspected Mycoplasma pneumoniae infection. The lysis buffer formula and conditions were as follows: 20% (w / v) Chelex-100 TE buffer (pH 8.0) (Chelex-100 was purchased from Bio-Rad, TE-buffer (pH 8.0) was purchased from Bio-Industry, and 20% Chelex-100 TE buffer was prepared at a ratio of 2g:10ml), 50mM DTT (dithiothreitol), the ratio (volume ratio) of sample to lysis buffer was 1:1, and heated at 80°C for 2 minutes to obtain high-quality nucleic acid samples for downstream detection.

[0146] (3) The actual sample (7.5 μL) obtained from the above treatment was added to the variable temperature CRISPR one-tube reaction system. The total reaction system was 50 μL, including 37 μL of RAA amplification system and 13 μL of CRISPR reaction system. The concentrations of each component were as follows:

[0147] Primer-Free-Rehydration-buffer is 25 μL, RPA upstream and downstream primers (10 μM) are 1.25 μL each, magnesium acetate solution (350 mM) is 2 μL, and the target nucleic acid to be detected is 7.5 μL;

[0148] Cas12a reaction buffer 5 μL, Cas12a protein (500 nM) 1 μL, crRNA (500 nM) 1 μL, fluorescent reporter probe (50 μM) 1 μL, enzyme-free water 5 μL;

[0149] Among them, the RPA nucleic acid amplification kit was purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd., the Cas12a protein (i.e., LbCas12a protein) and Cas12a reaction buffer were purchased from Guangzhou Bolais Biotechnology Co., Ltd., and the fluorescent reporter probe was the same as in Example 1.

[0150] (3) The one-tube reaction system prepared above was subjected to a temperature change reaction, first at 37°C for 10 min and then heated to 45°C, and its real-time fluorescence signal was collected once per minute for 60 min.

[0151] The results are as follows Figure 7 As shown: 27 nasopharyngeal swab samples that were previously tested using the gold standard RT-qPCR method (commercial detection kit, purchased from Shenzhen Rongjin Technology Co., Ltd.) were tested using the method of the present invention (POP-CRISPR), and a total of 13 positive samples and 14 negative samples were detected, and the test results were 100% consistent with the RT-qPCR method. The method can obtain test results within 20 minutes, significantly reducing the operation steps and detection time.

[0152] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A temperature-variable nucleic acid detection kit based on the CRISPR / Cas system, characterized in that: Including CRISPR / Cas detection system and isothermal amplification system; among them, The CRISPR / Cas detection system includes Cas protein, guide RNA designed based on PAM site, CRISPR / Cas reaction buffer and fluorescent reporter probe; The PAM site is NNNN, N=A, T, C or G, excluding the classical PAM site TTTV.

2. The temperature-variable nucleic acid detection kit based on the CRISPR / Cas system according to claim 1, characterized in that: The Cas protein includes Cas12 series protein or Cas13 series protein; The PAM site is at least one of WCAC, ACCM, ACGS, ACTV, ATCC, MTTN, CCAV, CCBN, CTAC, CTCN, CTGN, CTGV, GCAS, GCYV, GCGN, GTTV, TCBN and TTVN; wherein Y=C or T; M=A or C; S=G or C; W=A or T; B=G, T or C; V=G, A or C; N=A, T, C or G; The conditions for the temperature-variable nucleic acid detection based on the CRISPR / Cas system are: first react at 37-42°C for 3-30 minutes, then heat to 45-60°C for 5-60 minutes.

3. The temperature-variable nucleic acid detection kit based on the CRISPR / Cas system according to claim 2, characterized in that: The Cas protein is Cas12a, Cas12b or Cas12c protein; The PAM site is CCCV, CCTV, CTCV, CTTN, GTTV, TCGN, TCTN, TTAV, TTCN, TTGN; Wherein, V=G, A or C; N=A, T, C or G; The conditions for the variable temperature nucleic acid detection based on the CRISPR / Cas system are: first react at 37-42°C for 5-30 minutes, then heat to 45-60°C for 10-60 minutes.

4. The temperature-variable nucleic acid detection kit based on the CRISPR / Cas system according to claim 3, characterized in that: The Cas protein includes LbCas12a protein; The conditions for the temperature-variable nucleic acid detection based on the CRISPR / Cas system are: first react at 37°C for 10 minutes, then heat to 45°C for 10 to 30 minutes.

5. The temperature-variable nucleic acid detection kit based on the CRISPR / Cas system according to claim 1, characterized in that: The guide RNA is designed according to the nucleic acid sample to be tested, and includes two regions: a repeat region and a spacer region; The fluorescent reporter probe is a nucleotide labeled with a fluorescein and a quencher group; The isothermal amplification includes at least one of loop-mediated isothermal amplification LAMP, recombinase polymerase isothermal amplification RPA, recombinase-mediated isothermal nucleic acid amplification RAA, helicase-dependent isothermal amplification HDA, strand displacement amplification SDA, rolling circle amplification RCA, exponential isothermal amplification EXPAR, nucleic acid sequence-dependent amplification NASBA, single primer isothermal amplification SPIA, chimeric primer-triggered nucleic acid isothermal amplification ICAN, and strand exchange amplification SEA; The isothermal amplification system comprises isothermal amplification primers and a reaction solution; The isothermal amplification primers are designed according to the nucleic acid sample to be tested and the isothermal amplification method adopted.

6. The temperature-variable nucleic acid detection kit based on the CRISPR / Cas system according to claim 5, characterized in that: The nucleotide sequence of the guide RNA is at least one of SEQ ID NO.36, SEQ ID NO.40 and SEQ ID NO.43; The CRISPR / Cas reaction buffer is a Cas12 reaction buffer; The nucleotide sequence of the fluorescent reporter probe is shown in SEQ ID NO.44; The isothermal amplification system comprises isothermal amplification primers, a reaction solution and a magnesium acetate solution; The nucleotide sequence of the isothermal amplification primer is at least one of the primer pairs of SEQ ID NOs. 33-34, SEQ ID NOs. 37-38 and SEQ ID NOs. 41-42; The reaction solution is the Primer-Free-Rehydration-buffer in the RPA nucleic acid amplification kit.

7. Use of the CRISPR / Cas system-based temperature-variable nucleic acid detection kit according to any one of claims 1 to 6 in detecting nucleic acids for purposes other than disease diagnosis and treatment.

8. A temperature-variable nucleic acid detection method based on the CRISPR / Cas system for non-disease diagnosis and treatment purposes, characterized in that: Detection is performed using the CRISPR / Cas system-based temperature-variable nucleic acid detection kit according to any one of claims 1 to 6; the specific steps are as follows: (1) Prepare the reaction system: The nucleic acid sample to be tested, the CRISPR / Cas detection system and the isothermal amplification system are mixed to prepare a reaction system; (2) Nucleic acid testing The reaction system prepared in step (1) is first reacted at 37-42° C. for 3-30 minutes, then heated to 45-60° C. for 5-60 minutes, and real-time fluorescence signals are collected; (3)Judgment If the detection result in step (2) shows a fluorescent signal and it gradually increases, it means that the nucleic acid sample to be tested is a positive sample; conversely, if the detection result in step (2) shows no obvious fluorescent signal change, it means that the sample to be tested is a negative sample.

9. The method according to claim 8, characterized in that: The nucleic acid samples to be tested in step (1) include nucleic acid samples extracted by laboratory standardization and clinical samples; The clinical samples described include nasopharyngeal swab samples, cervical swabs, anal swabs, blood, urine, amniotic fluid, peritoneal effusion, and bronchoalveolar lavage fluid; The final concentration of the Cas protein in the reaction system described in step (1) is 10 to 600 nmol / L; The final concentration of the guide RNA designed based on the PAM site in the reaction system described in step (1) is 10 to 600 nmol / L; The final concentration of the fluorescent reporter probe in the reaction system described in step (1) is 100 nmol / L to 1.2 μmol / L; The final concentration of the isothermal amplification primers in the reaction system described in step (1) is 10 to 600 nmol / L; The conditions for nucleic acid detection described in step (2) are: first react at 37-42°C for 5-30 minutes, then heat to 45-60°C for 10-60 minutes.

10. The method according to claim 9, characterized in that: The final concentration of the Cas protein in the reaction system described in step (1) is 10 to 100 nmol / L; The final concentration of the guide RNA designed based on the PAM site in the reaction system described in step (1) is 10 to 100 nmol / L; The final concentration of the fluorescent reporter probe in the reaction system described in step (1) is 200 nmol / L to 1 μmol / L; The final concentration of the isothermal amplification primers in the reaction system described in step (1) is 250 nmol / L; The conditions for nucleic acid detection described in step (2) are: first react at 37°C for 10 minutes, then heat to 45°C for 10 to 30 minutes.

Images