Use of phgdh in disseminated tumor cell subtyping and predicting, screening and identifying immune-escaped disseminated tumor cells
By using PHGDH as a biomarker, the challenges of typing disseminated tumor cells and screening for immune-evading DTCs in existing technologies have been solved, enabling accurate typing of disseminated tumor cells and prediction of tumor metastasis and colonization, thus improving the targeted nature of cancer treatment.
Patent Information
- Application Number
- CN202411537593.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-30
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-10-30
AI Technical Summary
Current technologies lack effective biomarkers for disseminated tumor cell (DTC) typing, screening for immune-escape DTCs, and prediction of tumor metastasis and colonization, resulting in poor early warning of distant metastasis of cancer and an inability to provide personalized targeted treatment.
Phosphoglycerate dehydrogenase (PHGDH) was used as a novel biomarker to detect the level of PHGDH in samples for disseminated tumor cell typing, screening for immune-evading DTCs, and prediction of cancer metastasis and colonization. The gene expression and protein activity levels of PHGDH were used for evaluation.
It enables accurate typing of disseminated tumor cells and screening of immune-evading DTCs, improving the accuracy of tumor metastasis and colonization prediction and providing personalized treatment plans for cancer patients.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of tumor / cancer biology. More specifically, the present application relates to a novel biomarker, phosphoglycerate dehydrogenase (PHGDH), and its use in the manufacture of a product for detecting PHGDH levels in a sample obtained from a subject for the purpose of DTC typing, tumor metastasis colonization prediction, immune-escaped DTC screening and / or identification, and / or cancer treatment prognosis evaluation, as well as to the corresponding products and methods. BACKGROUND
[0002] Most cancer-related deaths occur as a result of metastasis, which is the process by which cancer cells spread from the site of the primary tumor to distant organs, i.e. the growth of cancer cells in an organ that is distant from the organ of origin. Metastasis is the cause of most cancer-related deaths, and is the ultimate and most deadly manifestation of cancer. The vast majority of cancer patients die as a consequence of their metastatic disease, not the primary tumor.
[0003] Taking hepatocellular carcinoma (hereinafter referred to as liver cancer and / or HCC) as an example, as a malignant tumor with high morbidity and mortality in China, most patients are found to be in the middle and advanced stages, especially advanced patients often have distant metastasis such as lung, bone or brain, which is difficult to treat and has a poor prognosis. The metastasis process of liver cancer mainly includes dissemination, entry into the blood circulation and distant colonization. First, part of the tumor cells of the primary tumor infiltrate into the proximal blood vessels or lymphatic vessels, and then as circulating tumor cells (CTC), they are transmitted through blood or lymphatic vessels. Due to physical, biochemical and immunological stressors, the number of CTCs is greatly reduced. After CTCs reach the distant organs, they are retained in the capillary bed of the distant organs, and finally exosmosis and migrate to the organ parenchyma as disseminated tumor cells (DTCs), completing the colonization and metastasis of tumor cells. Similarly, for breast cancer, although the survival rate of early breast cancer patients has improved, distant recurrence is still the main cause of high mortality and is usually considered to be incurable. Studies have shown that up to 75% of breast cancer patients may carry micro-metastatic lesions at the time of diagnosis, and metastatic recurrence often occurs several years or even decades after treatment. There are documents that have reviewed the clinical and biological aspects of DTCs and dormancy in breast cancer, which point out that during the clinical latency period, DTCs can enter the cell cycle arrest or dormancy state at distant sites, and can be shielded by immune detection and treatment (see, for example, Ring A, Spataro M, Wicki A, Aceto N. Clinical and Biological Aspects of Disseminated Tumor Cells and Dormancy in Breast Cancer Front Cell Dev Biol. 2022; 10: 929893).
[0004] Currently, the main means for predicting patient metastasis in clinical practice include detecting CTCs, circulating tumor DNA (ctDNA), circulating free nucleic acids (cfDNA) and exosomes, etc. However, these means all lack specific recognition of disseminated tumor cells (DTCs), so the effect of early warning of distant metastasis of cancer (e.g. liver cancer) is not good.
[0005] As of today, WO2011150256A2 discloses the use of the phosphoglycerate dehydrogenase (PHGDH) gene copy number in a biological sample in methods for diagnosing a cell proliferative disorder in a subject or assigning a prognosis risk of developing a cell proliferative disorder in a subject; WO2017009261A1 discloses the use of PHGDH as a biomarker for detecting epithelial-mesenchymal transition (EMT) in a subject; CN115969975A discloses the use of PHGDH as a target in the preparation of a medicament for preventing and / or treating colorectal cancer metastasis; EP2669682A1 uses PHGDH as one of numerous biomarkers to predict the prognosis (recurrence or progression) of tumors in breast cancer patients. In addition, a previous document on breast cancer discloses that human primary tumors with uniform high levels of PHGDH expression can grow faster but are less likely to metastasize than tumors with expression heterogeneity or low levels of PHGDH. The presence of PHGDH-low expressing cancer cells in primary tumors indicates a poor prognosis, with PHGDH expression being reduced in circulating tumor cells (CTCs) and early metastatic cells, i.e. low PHGDH expression in primary tumors often indicates a predisposition to distant metastasis of breast cancer; and the PHGDH protein expression level on CTCs is significantly lower than that in primary tumors (see Rossi, Matteo et al. “PHGDH heterogeneity potentiates cancer cell dissemination and metastasis.” Nature vol. 605, 7911 (2022): 747-753.).
[0006] In summary, there is no research report or related technology on phosphoglycerate dehydrogenase (PHGDH) as a new biomarker for disseminated tumor cell (DTC) typing and prediction, diagnosis, screening and identification of immune escape disseminated tumor cells. In fact, until the inventors’ research, no relationship between PHGDH and disseminated tumor cells (DTCs) has been found, nor has there been evidence that PHGDH can serve as a molecular marker for immune escape DTCs, and for disseminated tumor cell (DTC) typing, tumor metastasis colonization prediction, immune escape DTC screening and / or identification and / or cancer treatment prognosis evaluation on samples obtained from a subject.
[0007] Therefore, in view of the current limitations and urgency in the art for tools to predict metastasis in tumor patients, there is an urgent need in the art to find new biomarkers and their applications that can be effectively used for disseminated tumor cell (DTC) typing, immune-escaped DTC screening and / or identification, tumor metastasis colonization prediction, and / or cancer treatment prognosis evaluation, so as to make the systemic treatment such as targeted therapy, immunotherapy, etc. for distant metastasis of cancer (e.g. liver cancer) more targeted, and provide more personalized targeted treatment for patients. SUMMARY
[0008] Provided herein is a novel biomarker phosphoglycerate dehydrogenase (PHGDH) that can be used for disseminated tumor cell (DTC) typing, immune-escaped DTC screening and / or identification, tumor metastasis colonization prediction, and / or cancer treatment prognosis evaluation.
[0009] In some aspects herein, provided is the use of phosphoglycerate dehydrogenase (PHGDH) as a biomarker in the manufacture of a product for detecting PHGDH level in a sample obtained from a subject for disseminated tumor cell (DTC) typing, immune-escaped DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis evaluation.
[0010] In some aspects herein, provided is the use of a substance for detecting PHGDH as a biomarker in the manufacture of a product for detecting PHGDH level in a sample obtained from a subject for disseminated tumor cell (DTC) typing, immune-escaped DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis evaluation.
[0011] In some embodiments, the disseminated tumor cell (DTC) typing herein comprises typing DTCs including immune-escaped DTCs or non-immune-escaped DTCs according to PHGDH level in a sample obtained from a subject. In some embodiments, the immune-escaped DTC screening and / or identification herein comprises screening and / or identifying immune-escaped DTCs according to PHGDH level in a sample obtained from a subject. In some embodiments, the cancer metastasis colonization prediction herein comprises predicting the likelihood of a subject developing cancer metastasis colonization according to PHGDH level in a sample obtained from the subject. In some embodiments, the cancer treatment prognosis evaluation herein comprises evaluating a subject suffering from cancer and having received treatment as having a good or poor prognosis of treatment according to PHGDH level in a sample obtained from the subject. In some cases, the subject suffering from cancer and having received treatment is, for example, a subject suffering from a primary cancer and having received treatment for the primary cancer and / or a subject suffering from a primary cancer and having received treatment for the primary cancer and receiving a preventive treatment for cancer metastasis.
[0012] In some embodiments, the disseminated tumor cell (DTC) typing herein comprises typing a DTC as an immune escape DTC or a non-immune escape DTC based on the level of PHGDH in a sample obtained from the subject, wherein the DTC is typed as an immune escape DTC if the level of PHGDH is higher than a reference level, and the DTC is typed as a non-immune escape DTC if the level of PHGDH is lower than a reference level.
[0013] In some embodiments, the immune escape DTC screening and / or identification herein comprises screening and / or identifying a DTC as an immune escape DTC based on the level of PHGDH in a sample obtained from the subject, wherein the DTC in the sample is identified as an immune escape DTC or screened out as an immune escape DTC if the level of PHGDH in the sample obtained from the subject is higher than a reference level.
[0014] In some embodiments, the cancer metastasis colonization prediction herein comprises predicting the likelihood of cancer metastasis colonization in a sample obtained from a subject based on the level of PHGDH in the sample, wherein the subject is susceptible to cancer metastasis colonization if the level of PHGDH is higher than a reference level; and the subject is not susceptible to cancer metastasis colonization if the level of PHGDH is lower than a reference level.
[0015] In some embodiments, the cancer treatment prognosis evaluation herein comprises evaluating a subject suffering from cancer and having received a treatment as having a good prognosis or a poor prognosis based on the level of PHGDH in a sample obtained from the subject, wherein the subject is evaluated as having a poor prognosis if the level of PHGDH is higher than a reference level; and the subject is evaluated as having a good prognosis if the level of PHGDH is lower than a reference level. In some instances, the subject suffering from cancer and having received a treatment is, for example, a subject suffering from a primary cancer and having received a treatment for the primary cancer and / or a subject suffering from a primary cancer and having received a treatment for the primary cancer and receiving a preventive treatment for cancer metastasis.
[0016] In some embodiments, the level of PHGDH herein is determined by the gene expression level, the protein expression level, and / or the protein activity level of PHGDH. In some instances, the gene expression level of PHGDH herein comprises a nucleic acid expression level or an mRNA expression level.
[0017] In some embodiments, the nucleic acid expression level herein is determined by Western blot, quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR), RNA-Seq, multiplex qPCR or RT-qPCR, microarray analysis, SAGE, MassARRAY technology, in situ hybridization (e.g., FISH), and the like.
[0018] In some embodiments, the mRNA expression level herein is determined by real-time quantitative PCR (qRT-PCR), RNA-Seq, PCR, qPCR, RT-PCR, in situ hybridization, gene expression profiling, serial analysis of gene expression, microarray analysis, and the like. In some preferred embodiments, the PHGDH level herein is the mRNA expression level determined by qRT-PCR. In some more preferred embodiments, the mRNA expression level is determined by real-time quantitative PCR (qRT-PCR) using forward primer ATGGCCTTCGCAAATCTGC (SEQ ID NO: 4) and reverse primer AGTTCAGCTATCAGCTCCTCC (SEQ ID NO: 5) as the PHGDH expression herein.
[0019] In some embodiments, the protein expression level and / or protein activity level of PHGDH herein is determined by mass spectrometry (MS), reverse transcriptase-polymerase chain reaction (RT-PCR), microarray analysis, serial analysis of gene expression (SAGE), gene expression analysis by massively parallel signature sequencing (MPSS), immunoassay (e.g., ELISA), immunohistochemical staining (IHC), transcriptomics and proteomics techniques. In some preferred embodiments, the protein expression level and / or protein activity level of PHGDH herein is determined by immunohistochemical staining (IHC), e.g., immunofluorescence, radioimmunoassay, immunoenzymatic assay, immunogold silver method, preferably by immunoenzymatic assay. In some particularly preferred embodiments, the protein expression level and / or protein activity level of PHGDH is determined by direct detection using PHGDH antibody (e.g., PHGDH antibody with catalog number #ab240744 from Abeam) as the PHGDH expression herein. In some preferred embodiments, the protein expression level and / or protein activity level of PHGDH is determined by immunohistochemical staining (IHC) score, wherein the PHGDH immunohistochemical staining (IHC) score = immunohistochemical staining intensity score x immunohistochemical staining area score; wherein the immunohistochemical staining intensity score is: no staining is 0 point, light brown is 1 point, brown is 2 points, dark brown is 3 points; the immunohistochemical staining area score (the proportion of tumor cell staining positive area to the total area of tumor cells) is: no staining positive is 0 point, <25% is 1 point, ≥25 to <50% is 2 points, ≥50 to <75% is 3 points, ≥75% is 4 points.
[0020] In some embodiments, the PHGDH level in the sample obtained from the subject herein is the median value, the mean value, or the statistically determined standard value of the gene expression level, the protein expression level, and / or the protein activity level measured in the sample obtained from the subject. In some embodiments, the PHGDH level in the sample obtained from the subject herein is the median value, the mean value, or the statistically determined standard value of the gene expression level, the protein expression level, and / or the protein activity level measured in the sample obtained from the subject.
[0021] In some embodiments, a reference level herein is (1) the median, mean, or statistically determined standard value of the level of gene expression, protein expression, and / or protein activity of PHGDH in a sample obtained from the subject at a prior time point; (2) the median, mean, or statistically determined standard value of the level of gene expression, protein expression, and / or protein activity of PHGDH in a reference population; or (3) a pre-specified PHGDH level, e.g., a pre-specified immunohistochemical staining (IHC) score value.
[0022] In some embodiments, a PHGDH level in a sample obtained from a subject that is higher than a reference level herein includes a PHGDH level in the sample obtained from the subject that is about 1% or more or about 1-fold or more higher than the median, mean, or statistically determined standard value of the level of gene expression, protein expression, and / or protein activity of PHGDH in a sample obtained from the subject at a prior time point.
[0023] In some embodiments, a PHGDH level in a sample obtained from a subject that is higher than a reference level herein includes a PHGDH level in the sample obtained from the subject that is about 1% or more or about 1-fold or more higher than the median, mean, or statistically determined standard value of the level of gene expression, protein expression, and / or protein activity of PHGDH in a reference population; and / or
[0024] In some embodiments, a PHGDH level in a sample obtained from a subject that is higher than a reference level herein includes a PHGDH level in the sample obtained from the subject that is higher than a pre-specified PHGDH level value, e.g., a pre-specified immunohistochemical staining (IHC) score value; preferably the immunohistochemical staining (IHC) score is 6.
[0025] In some embodiments, a PHGDH herein is a molecule selected from the group consisting of genomic DNA, cDNA, mRNA, protein of PHGDH, or a functional fragment of any of the foregoing.
[0026] In some embodiments, a PHGDH herein includes a molecule having a sequence:
[0027] (a) genomic DNA having a sequence such as set forth in SEQ ID NO: 1, or a functional fragment thereof;
[0028] (b) mRNA having a sequence such as set forth in SEQ ID NO: 2, or a functional fragment thereof;
[0029] (c) PHGDH protein having a sequence such as set forth in SEQ ID NO: 3, or a functional fragment thereof;
[0030] (d) a molecule or a functional fragment thereof having 70% or more sequence homology or identity to the sequence of any one of (a) to (c) and being capable of indicating the level of PHGDH in the sample.
[0031] In some embodiments, the subject herein is a mammal, such as a human, a non-human primate (e.g., chimpanzee, ape), a rodent (e.g., rat, mouse, guinea pig), a pet (e.g., cat, dog), a farm animal (e.g., horse, cow, sheep, pig, rabbit); and / or
[0032] In some embodiments, the subject herein is selected from the group consisting of: a subject suspected of having a primary cancer; a subject afflicted with a primary cancer but has not received a treatment against the primary cancer; a subject afflicted with a primary cancer and has received a treatment against the primary cancer; a subject afflicted with a primary cancer and has received a treatment against the primary cancer but has not received a prophylactic treatment against cancer metastasis; a subject afflicted with a primary cancer and has received a treatment against the primary cancer and a prophylactic treatment against cancer metastasis; or a subject having one or more of the foregoing; preferably a subject suspected of having metastatic colonization according to the medical history and imaging results (e.g., CT, MRI, etc.).
[0033] In some embodiments, the sample herein can be selected from the group consisting of: a tissue obtained from the subject, such as a fresh sample, a frozen sample, a fixed sample (e.g., a formalin-fixed sample, a paraffin-embedded sample); preferably a biopsy suspected of having metastatic colonization according to the medical history and imaging results (e.g., CT, MRI, etc.) of the subject.
[0034] In some embodiments, the subject herein is afflicted with a primary cancer. In some embodiments, the subject herein is afflicted with a hepatocellular carcinoma, a cholangiocellular carcinoma, a prostate cancer, a squamous cell carcinoma, a small cell lung cancer, a non-small cell lung cancer, a lung adenocarcinoma, a lung squamous carcinoma, a peritoneal cancer, a gastrointestinal cancer, a pancreatic cancer, a glioblastoma, a cervical cancer, an ovarian cancer, a bladder cancer, a breast cancer, a colon cancer, a colorectal cancer, an endometrial or uterine cancer, a salivary gland cancer, a renal cancer, a vulvar cancer, a thyroid cancer, a gastric cancer, a melanoma, or a neck cancer; preferably a hepatocellular carcinoma, a breast cancer, a colorectal cancer, a lung adenocarcinoma. In some embodiments, the subject herein is afflicted with a primary cancer and is suspected of having and / or is at risk of having a cancer metastasis caused by the primary cancer, such as a lung (e.g., a liver cancer lung metastasis), bone, brain, or lymph node (e.g., a liver cancer lymph node metastasis) metastasis.
[0035] In some embodiments, the products herein can be kits or combinations of reagents and detection devices. In some embodiments, the products herein comprise reagents, apparatuses, and / or devices for assaying PHGDH levels in a sample, e.g., the reagents for assaying PHGDH levels in a sample include one or more selected from the group consisting of probes, gene chips, primers, antibodies, protein chips, chemical small molecules having detection specificity for PHGDH. In some embodiments, the products herein are used to assay PHGDH levels in a sample by a method including, but not limited to, real-time quantitative reverse transcription PCR, biochip detection, Southern blotting, Northern blotting, in situ hybridization, immunofluorescence, immunohistochemical staining (e.g., immunoenzymatic staining), or Northern blotting or in situ hybridization. In some embodiments, the reagents for assaying PHGDH levels in a sample herein are directly or indirectly labeled with a detectable label, e.g., the detectable label is selected from the group consisting of a radioisotope, a fluorescent group, a chemiluminescent moiety, an enzyme, an enzyme substrate, an enzyme cofactor, an enzyme inhibitor, a dye, a metal ion, or a ligand.
[0036] In some aspects herein, there is provided a product for performing disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis assessment by detecting PHGDH levels in a sample from a subject (e.g., a sample, cells, and / or tissues from a subject suspected of having metastatic colonization, e.g., based on prior medical history and imaging results (e.g., CT, MRI, etc.)). In some embodiments, the product comprises reagents, apparatuses, and / or devices for detecting PHGDH levels in the sample. In some embodiments, the product comprises one or more contents as described in detail herein.
[0037] In some aspects herein, there is provided a product (e.g., a kit) for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, tumor metastasis colonization prediction, and / or cancer treatment prognosis assessment.
[0038] In some aspects herein, there is provided a method of performing disseminated tumor cell (DTC) typing, tumor metastasis colonization prediction, immune escape DTC screening and / or identification, and / or cancer treatment prognosis assessment on a sample. In some embodiments, the method comprises: assaying PHGDH levels in a sample obtained from a subject; comparing the PHGDH levels in the sample obtained from the subject to a reference level, and performing disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis assessment on the subject based on the PHGDH levels in the sample obtained from the subject.
[0039] In some aspects herein, a system is provided, comprising: a module for obtaining PHGDH levels in a sample from a subject; a module for analyzing PHGDH levels in a sample from a subject (e.g., a module for comparing PHGDH levels in a sample from a subject to a reference level); and a module for DTC typing, tumor metastasis colonization prediction, immune escape DTC screening and / or identification, and / or cancer treatment prognosis evaluation of the subject; a module for outputting and / or storing the results of the analysis. In some embodiments, the system can optionally further comprise one or more modules selected from the group consisting of: a module for sample collection or receiving from a subject; a module for detecting PHGDH levels in a sample; a module for inputting, comparing, storing, and / or outputting PHGDH levels; a module for local, remote, or cloud data storage, reading, and / or analysis.
[0040] Those skilled in the art can combine any of the technical solutions and technical features described herein without departing from the inventive concept and protection scope of the present application. Other aspects of the present application will be apparent to those skilled in the art from the disclosure herein. BRIEF DESCRIPTION OF DRAWINGS
[0041] The present application is further described below in conjunction with the accompanying drawings, which are shown only for the purpose of illustrating embodiments of the present application and not for limiting the scope of the present application.
[0042] Figure 1 Definition of TME unit, wherein a 50x50 pm 2 area around a tumor cell determined based on spatial transcriptome data is defined as one TME unit, and one TME unit is further divided into 25 10x10 pm 2 areas, with the center 10x10 pm 2 area defined as the tumor location point.
[0043] Figure 2A Pseudo-time analysis for all tumor cells, using Monocle2 R package to determine the pseudo-time differentiation trajectory and transcriptome kinetics characteristics of all tumor cells collected at different sampling time points, and based on the pseudo-time analysis results automatically generated by the R package analysis, tumor cells are divided into 1-4 phases along the pseudo-time axis, i.e., Phase 1-4.
[0044] Figure 2B Unsupervised clustering of TME units for all samples, using single-cell dimensionality reduction and clustering methods, and dividing TME units into 1-4 clusters along the pseudo-time axis, i.e., Cluster 1-4.
[0045] Figure 3: The change of tumor cell gene expression along the pseudo-temporal axis and the relationship of cell population in TME unit on the timeline, it was found that tumor cell staging was synchronized with TME unit clustering on the timeline, suggesting that tumor cells and immune microenvironment cooperatively evolved in the process of liver cancer metastasis and colonization.
[0046] Figure 4: Percentage of tumor cells and number of stage 3 tumor cells at each time point (T1 (0.25 hours), T2 (1 hour), T3 (4 hours), T4 (12 hours), T5 (24 hours), T6 (2 days), T7 (8 days), T8 (21 days), and T9 (35 days)). Figure 4A The proportion of stage 3 tumor cells to all tumor cells and the proportion of all tumor cells to all cells at each time point are shown; wherein, the left Y-axis represents the proportion of the number of tumor cells with stage 3 tumor cell characteristics detected in the mouse lung tissue obtained at each sampling time point to the number of all tumor cells at the sampling time point; the right Y-axis represents the proportion of the number of all tumor cells in the mouse lung tissue obtained at each sampling time point to the total number of cells. Figure 4B The number of stage 3 tumor cells at each time point is shown; wherein, the Y-axis represents the absolute value of the number of tumor cells with stage 3 tumor cell characteristics detected in the mouse lung tissue obtained at each sampling time point.
[0047] Figure 5 : Differential expression gene analysis of stage 3 tumor cells and other tumor cells, wherein the x-axis is Log2 (fold change) and the y-axis is -log10 (adjusted p-value). This differential expression gene analysis for a large number of genes showed that PHGDH was the most significantly up-regulated in stage 3 tumor cells (t-test). PHGDH expression was highly coincident with stage 3 tumor cells, so stage 3 tumor cells were defined as PHGDH+ tumor cells.
[0048] Figure 6 : PHGDH+ tumor cell pathway analysis, wherein the x-axis is -log10 (adjusted p-value) and the y-axis is cell proliferation and immune response related pathways. The pathway analysis results showed that PHGDH+ tumor cells were significantly down-regulated in cell proliferation and immune response related pathways (t-test; NS represents no significant difference, * represents p<0.05, ** p<0.01, *** p<0.001).
[0049] Figure 7 : Immune cells in the TME of tumor cells. The results showed that the TME unit immune cell infiltration around PHGDH+ tumor cells was significantly reduced (t-test).
[0050] Figure 8: The histochemical score (H-score) of PHGDH and CD45+ immune cell infiltration in lymph node metastasis of breast cancer (BRCA), colorectal cancer (CRC), lung adenocarcinoma (LUAD) and hepatocarcinoma (HCC); wherein PHGDH+ tumor cells are significantly enriched in breast cancer (BRCA, n=3), colorectal cancer (CRC, n=4), lung adenocarcinoma (LUAD, n=4) and hepatocarcinoma (HCC, n=6) micrometastases compared to macrometastases (t-test; NS represents no significant difference, * represents p<0.05, ** p<0.01, *** p<0.001) Figure 8A , while CD45+ immune cell infiltration is significantly reduced (t-test; NS represents no significant difference, * represents p<0.05, ** p<0.01, *** p<0.001) Figure 8B .
[0051] Figure 9: The results of multicolor immunofluorescence analysis of mouse lung tissue at T5 time point (sgPHGDH represents PHGDH knockout cells; sgCtrl represents control). The results show that the immune cell infiltration around PHGDH knockout tumor cells is more and the distance between PHGDH knockout tumor cells and immune cells is closer than that of the control group.
[0052] Figure 10 Figure 10: The lung metastasis load of mice (Hepa1-6 hepatocarcinoma cells, H22 hepatocarcinoma cells, MC38 colorectal cancer cells and B16-F10 melanoma cells) at T8 time point (sgPHGDH represents PHGDH knockout cells; sgCtrl represents control; C57BL6 / J and BALB / C represent immune competent mice, Nod / scid and BALB / C nude represent immune deficient mice; t-test, NS represents no significant difference, * represents p<0.05, ** p<0.01, *** p<0.001). The results show that in immune competent mice, PHGDH knockout tumor cells form significantly less lung metastases than the control group, while in immune deficient mice, PHGDH knockout tumor cells and the control group show no significant difference in the number of lung metastases.
[0053] Figure 11 Figure 11: The ability of cell lines with PHGDH knockdown or overexpression to recruit CD3+ T cells and NK cells isolated from tumor tissue in vitro (shPHGDH represents PHGDH knockdown cells; shCtrl represents control; PHGDH OE represents PHGDH overexpression cells; t-test, NS represents no significant difference, * represents p<0.05, **represent p<0.05, *** represent p<0.05,
[0054] Figure 12 : Chemokine expression along the pseudo-time axis, where PHGDH+ tumor cells (stage 3 tumor cells) have significantly lower chemokine expression than other stage tumor cells.
[0055] Figure 13 : Activity of related transcription factors in tumor cells, where PHGDH+ tumor cells (stage 3 tumor cells) have significantly lower activity of related transcription factors than other stage tumor cells.
[0056] Figure 14 : PCR and ELISA detection results of murine hepatoma cells (Hepal-6) and human hepatoma cells (Huh7). The results show that PHGDH-knockdown or knockout tumor cells have significantly higher mRNA expression levels of Ccl20, Cxcl2, and Cxcl10 and significantly more secretion of CCL2, CXCL2, and CXCL10 than the control group; while PHGDH-overexpressing tumor cells have significantly lower mRNA expression levels of Ccl20, Cxcl2, and Cxcl10 and significantly less secretion of CCL2, CXCL2, and CXCL10 than the control group, suggesting that PHGDH is a key factor for inhibiting chemokine expression in tumor cells.
[0057] Figure 15 : Mass spectrometric analysis of serine, methionine, and SAM, etc. serine metabolites in PHGDH-knockout murine cells or PHGDH-knockdown human cells. The results show that serine, methionine, and SAM, etc. serine metabolites are significantly reduced, while serine metabolites in PHGDH-overexpressing cells are significantly increased (sgPHGDH represents PHGDH-knockout cells; sgCtrl represents the control relative to PHGDH-knockout cells; shPHGDH represents PHGDH-knockdown cells; shCtrl represents the control relative to PHGDH-knockdown cells; PHGDH OE represent p<0.05, * represent p<0.05, ** represent p<0.05, *** represent p<0.05.
[0058] Figure 16Multicolor immunofluorescence and digital pathology analysis of lung tissue of C57BL6 / J mice at T5 time point and lymph node micrometastasis samples of HCC patients, PHGDH+ disseminated tumor cells (DTCs) co-express significantly more H3K27me3 than PHGDH- disseminated tumor cells (DTCs).
[0059] Figure 17 Epigenetic and chromatin accessibility analysis at single cell level (scCPA-Tag). The results show that the level of H3K27me3 modification of chemokines and inflammatory transcription factors such as RELA, IRF1, NFKB2 and STAT1 in PHGDH-knockout tumor cells is significantly lower than that in the control group. DETAILED DESCRIPTION
[0060] The present inventors, through extensive and in-depth research, first accidentally and surprisingly found that PHGDH gene or its protein is highly expressed in disseminated tumor cells (DTCs) with immune escape ability, and further confirmed through related experiments that PHGDH+ tumor cells are significantly enriched in micrometastases, and CD45+ immune cell infiltration is significantly reduced. Therefore, PHGDH can be used as a marker for DTC typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis evaluation, thereby providing a more accurate method for DTC typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction and / or cancer treatment prognosis evaluation of samples of different sources. On this basis, the present application is completed.
[0061] All numerical ranges expressed in the present specification should be understood to encompass each and every value and sub-range within the range. Combinations of features or steps can be made. All features disclosed in the specification may be used in any combination, and each individual feature disclosed in the specification may be used in any combination with any alternative feature disclosed in the specification. Thus, unless expressly excluded, features disclosed in the specification may be used in any combination.
[0062] As used herein, "containing", "having", or "including" encompasses "comprising", "consisting essentially of", "consisting essentially of", and "consisting of"; "consisting essentially of", "consisting essentially of", and "consisting of" are subsumed by "containing", "having", or "including".
[0063] The numerical ranges recited herein include all values from and including the lower and upper values. For ranges containing values that are less than or greater than, for example, 1 or 2 or 3 or 4 or 5, or the like, the ranges are intended to include, for example, from 0.5 to 1, from 4 to 5, and the like. For ranges containing values that are less than or greater than, for example, 1 or 2 or 3 or 4 or 5, or the like, the ranges are intended to include, for example, from 0.5 to 1, from 4 to 5, and the like.
[0064] Phosphoglycerate dehydrogenase (PHGDH)
[0065] Phosphoglycerate dehydrogenase (PHGDH), also known as phosphoglycerate dehydrogenase, is a key metabolic enzyme that plays a crucial role in the serine synthesis pathway as the first rate-limiting enzyme of serine synthesis from glucose sources. PHGDH is responsible for catalyzing the conversion of 3-phosphoglycerate (3-PG) to 3-phosphohydroxypyruvate (3-PHP), which is the first and rate-limiting step of serine biosynthesis, and plays an important role in maintaining the homeostasis of related substances in cells. Serine is a non-essential amino acid that is essential for cell proliferation and various biosynthetic processes. It is involved in the one-carbon metabolic pathway, promoting the biosynthesis of nucleotides, S-adenosyl methionine (SAM), reduced nicotinamide adenine dinucleotide phosphate (NADPH), and glutathione (GSH) through the transfer of one-carbon units. The reaction of 3-phosphoglycerate catalyzed by PHGDH to 3-phosphohydroxypyruvate uses NAD+ / NADH as a cofactor. PHGDH is currently known to play a role in cancer progression, and it has been found that PHGDH is amplified in a significant portion of primary tumors, including 6% of breast cancer, 70% in, for example, estrogen receptor-negative breast tumors, and 40% of melanoma, etc. PHGDH plays a key role in the metabolic reprogramming of cancer cells, in which primary cancer cells with high expression of PHGDH have increased serine synthesis flux, thereby supporting the high proliferation and tumor growth of cancer cells, in which these cancer cells use PHGDH for serine synthesis. The activity of PHGDH is regulated by multiple signaling pathways, and changes in its expression and activity are closely related to various biological processes, including the occurrence and development of tumors, cell proliferation, metabolic regulation, etc. In addition, the expression heterogeneity of PHGDH in tumor cells is related to tumor invasiveness and metastasis tendency, its activity drives cancer proliferation, and PHDGH-dependent sialic acid synthesis and loss of integrin glycosylation increase metastatic spread. A previous literature on breast cancer has reported that low expression of PHGDH in primary tumors often indicates a predisposition for distant metastasis of breast cancer (see Rossi, Matteo et al. “PHGDH heterogeneity potentiates cancer cell dissemination and metastasis.” Nature vol. 605, 7911 (2022): 747-753).
[0066] There is no report on the expression of PHGDH in disseminated tumor cells (DTC) or specific application thereof. Surprisingly and unexpectedly, the present inventors have found, through long-term and in-depth research, that one of the biological effects of PHGDH expression is that it can regulate H3K27me3-mediated DTC transcriptional silence through SAM, inhibit chemokine expression, reduce immune cell recruitment, and thus promote the formation of a local immune desert microenvironment, which is conducive to the immune escape of DTC metastasis and colonization.
[0067] As used herein, the terms "phosphogly cerate dehydrogenase", "phosphogly cerate dehydrogenase", "PHGDH" or "PHGDH molecule" are used interchangeably and have their broadest meaning, including one or more of any type of PHGDH molecule present in a subject normal and tumor / cancer, such as a PHGDH gene, a PHGDH mRNA, a PHGDH cDNA, a PHGDH precursor, a PHGDH antisense transcript, a PHGDH miRNA, a PHGDH polypeptide, a PHGDH protein, a PHGDH protein fragment, or any other active fragment or marker fragment indicative of PHGDH gene expression level, polypeptide / protein expression level and / or protein activity level, for detection purposes. In addition, the term also includes molecules obtained by modification of natural PHGDH molecules for detection purposes, such as derived molecules obtained by fragmentation, tagging, chemical modification, binding to specific molecules, etc.
[0068] An exemplary (Homo sapiens) genomic DNA sequence of PHGDH can be shown as NCBI NG 009188.1 (SEQ ID NO: 1), its polypeptide sequence can be shown as NP_006614.2 (SEQ ID NO: 3), and its mRNA sequence can be shown as NM_006623.3 (SEQ ID NO: 2). It is understood that substitution of nucleotides in the codon is acceptable when encoding the same amino acid. Likewise, it is understood that substitution of nucleotides is acceptable when resulting in conservative amino acid substitution by the nucleotide substitution. In addition, it is also understood that the above specific sequences are exemplary sequences, and any molecule having 70% or more (e.g., 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5% or more, or any value or range of values therebetween) sequence homology, similarity, identity, etc. and being able to indicate the PHGDH level in a sample falls within the scope of the term "phosphogly cerate dehydrogenase", "phosphogly cerate dehydrogenase", "PHGDH" or "PHGDH molecule" as described herein.
[0069] Biomarkers and detection thereof
[0070] As used herein, the term "biomarker" means an indicator molecule or collection of molecules that can be detected in a sample, including a gene, mRNA, cDNA, precursor, antisense transcript, miRNA, polypeptide / protein, protein fragment, or any other active fragment or signature fragment that is indicative of a level of gene expression, polypeptide / protein expression, and / or protein activity level. In some embodiments, a "biomarker" includes genomic DNA, cDNA, mRNA, protein of PHGDH, or a functional fragment of any of the foregoing. In one embodiment, a biomarker described herein includes (a) genomic DNA having a sequence such as set forth in SEQ ID NO: 1 or a functional fragment thereof; (b) mRNA having a sequence such as set forth in SEQ ID NO: 2 or a functional fragment thereof; (c) PHGDH protein having a sequence such as set forth in SEQ ID NO: 3 or a functional fragment thereof; (d) a molecule having 70% or more sequence homology or identity to the sequence of any of (a) to (c) and is indicative of a level of PHGDH in a sample or a functional fragment thereof.
[0071] The combination of a biomarker (e.g., PHGDH) and "level," "expression level," or "amount," which are used interchangeably herein, means a detectable level of the biomarker in a sample (e.g., such as a biopsy or a biopsy tissue). "Expression" generally refers to the process by which information (e.g., genetically encoded and / or epigenetically) is converted into structures that are present in and run in a cell. Thus, as used herein, "expression" can refer to transcription into a polynucleotide, translation into a polypeptide, or even polynucleotide and / or polypeptide modification (e.g., post-translational modification of a polypeptide). Fragments of a transcribed polynucleotide, a translated polypeptide, or a polynucleotide and / or polypeptide modification (e.g., post-translational modification of a polypeptide) should also be considered to have been expressed, whether they originate from a transcript generated by alternative splicing or degradation, or from post-translational processing of a polypeptide (e.g., by proteolysis). "Expressed gene" should be understood to include those that are transcribed into a polynucleotide such as mRNA, which is then translated into a polypeptide, and also those that are transcribed into RNA but not translated into a polypeptide (e.g., transfer and ribosomal RNAs). In this document, the terms "PHGDH level," "PHGDH expression level," "PHGDH amount," and terms that are grammatically and meaningfully identical thereto, mean a level of gene expression (e.g., nucleic acid expression level or mRNA expression level), polypeptide / protein expression level, and / or protein activity level of PHGDH.
[0072] Detecting biomarker (e.g., PHGDH) levels in a sample (e.g., a biopsy or a biopsy tissue) can be measured by methods known to those of skill in the art and / or disclosed herein. Numerous methods of assaying gene expression levels, polypeptide / protein expression levels, and / or protein activity levels of PHGDH are known in the art and appreciated by the skilled artisan, including but not limited to immunohistochemical staining (“IHC”), Western blot analysis, immunoprecipitation, molecular binding assays, ELISA, ELIFA, flow cytometry, fluorescence activated cell sorting (“FACS”), spatial transcriptomics, spatial proteomics, MassARRAY, proteomics, blood-based quantitative assays (e.g., serum ELISA), biochemical enzyme activity assays, in situ hybridization (ISH), fluorescence in situ hybridization (FISH), Southern blot analysis, Northern blot analysis, whole genome sequencing, massively parallel DNA sequencing (e.g., next generation sequencing), polymerase chain reaction (PCR) (including quantitative real-time PCR (qRT-PCR) and other amplification-type detection methods such as branched DNA, SISBA, TMA, etc.), RNA-seq, microarray analysis, gene expression profiling, and / or serial analysis of gene expression (“SAGE”), as well as any of a variety of assays that can be performed by protein, gene, and / or tissue array analysis. Typical protocols for assessing the status of genes and gene products can be found in, e.g., Ausubel et al., eds., 1995, Current Protocols In Molecular Biology, Unit 2 (Northern Blotting), Unit 4 (Southern Blotting), Unit 15 (Immunoblotting), and Unit 18 (PCR Analysis).
[0073] In some embodiments, PHGDH levels are determined by gene expression levels of PHGDH (e.g., nucleic acid expression levels or mRNA expression levels), e.g., by assaying PHGDH gene copy number. Methods of assessing PHGDH gene copy number are well known in the art, including but not limited to hybridization and amplification-based analysis.
[0074] Any hybridization-based detection method can be used to detect the copy number of the PHGDH gene in a biological sample. One such method is Western blotting, in which genomic DNA can be fragmented, electrophoretically separated, transferred to a membrane, and then hybridized to a PHGDH-specific probe. Comparing the intensity of the hybridization signal of the probe of interest to that of a control probe for a normal, non-amplified, single copy genomic DNA region in the same genome allows for an estimate of the relative PHGDH gene copy number corresponding to the particular probe used. An increase in signal compared to the control indicates the presence of amplification. Another method for determining the copy number of the PHGDH gene in a sample is in situ hybridization, such as fluorescence in situ hybridization (FISH). In situ hybridization often includes the following steps: (1) fixation of the biological sample to be analyzed; (2) prehybridization treatment of the biological sample to increase the accessibility of the target DNA and reduce non-specific binding; (3) hybridization of the nucleic acid mixture to the nucleic acids in the biological sample; (4) post-hybridization washes to remove nucleic acid fragments that did not bind in the hybrid. And (5) detection of the hybridized nucleic acid fragments. Determining gene copy number can also be done by comparative genomic hybridization (CGH). In the comparative genomic hybridization method, one set of "test" nucleic acids is labeled with a first marker, while the other set (e.g., from normal cells or tissues) is labeled with a second marker. The ratio of nucleic acid hybridization is determined by the ratio of the first and second markers bound on each fiber in the array. Differences in the signal ratio from the two markers due to amplification of genes in the test set are detected, and this ratio provides a measure of the gene copy number corresponding to the particular probe used. Cytogenetic characterization of DNA copy number variations can be generated by CGH, which can provide a fluorescence ratio of the differentially labeled test and reference genomic DNA along the length of the chromosome. Furthermore, amplification-based assays can also be used to measure the copy number of the PHGDH gene. In such assays, the corresponding PHGDH nucleic acid sequence serves as a template for an amplification reaction (e.g., polymerase chain reaction or PCR). In quantitative amplification, the amount of amplification product is proportional to the amount of template in the original sample. According to the principles discussed above, comparison to an appropriate control can measure the copy number of the PHGDH gene corresponding to the particular probe used. Real-time quantitative PCR (qRT-PCR) methods using TaqMan probes are well known in the art. TaqMan-based detection methods use fluorescent oligonucleotide probes containing a 5' fluorescent dye and a 3' quencher. The probe hybridizes to the PCR product, but cannot itself be extended due to the blocking agent at the 3' end. As the PCR product is amplified in subsequent cycles, the 5' nuclease activity of the polymerase (e.g., AmpliTaq) causes cleavage of the TaqMan probe. This cleavage separates the 5' fluorescent dye from the 3' quencher, resulting in an increase in fluorescence as a function of amplification.Other suitable amplification methods include, but are not limited to, ligase chain reaction (LCR), transcriptional amplification, self-sustained sequence replication, etc. In addition, PHGDH gene copy number can also be determined using microarray-based platforms (e.g., single nucleotide polymorphism (SNP) arrays) as microarray technology has high resolution.
[0075] In some embodiments, nucleic acid expression levels can be determined by Western blotting, quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR), RNA-Seq, multiplex qPCR or RT-qPCR, microarray analysis, SAGE, MassARRAY technology, in situ hybridization (e.g., FISH), etc. In other embodiments, mRNA expression levels can be determined by real-time quantitative PCR (qRT-PCR), RNA-Seq, PCR, qPCR, RT-PCR, in situ hybridization, gene expression profiling, gene expression series analysis, microarray analysis, etc. In some preferred embodiments, mRNA expression levels can be determined by qRT-PCR. In some more preferred embodiments, mRNA expression levels can be determined by real-time quantitative PCR (qRT-PCR) employing a forward primer of ATGGCCTTCGCAAATCTGC (SEQ ID NO: 4) and a reverse primer of AGTTCAGCTATCAGCTCCTCC (SEQ ID NO: 5).
[0076] In some embodiments, PHGDH levels are determined by protein expression levels and / or protein activity levels of PHGDH. It is known in the art that the presence and / or expression levels (amounts) of a biomarker, such as PHGDH, can be measured by determining the protein expression levels and / or protein activity levels of the biomarker. Methods for determining polypeptide / protein expression levels and / or protein activity levels are also well known in the art, including but not limited to mass spectrometry (MS), reverse transcriptase-polymerase chain reaction (RT-PCR), microarray, serial analysis of gene expression (SAGE), gene expression analysis by massively parallel signature sequencing (MPSS), immunoassays (e.g., ELISA), immunohistochemical staining (IHC), transcriptomic and proteomic techniques. In some embodiments, the proteins in a tissue sample can be stained and detected by immunohistochemical staining (IHC) techniques using specific antibodies. For example, in the detection of PHGDH protein levels, the expression of PHGDH protein in a tissue is observed by IHC techniques. IHC techniques utilize labeled specific antibodies to qualitatively, quantitatively, or locally study the distribution and content of certain chemical components in tissue sections or cell specimens in situ. According to the principles of antigen-antibody reaction and chemical color development, the antigen in a tissue section or cell specimen is first combined with a primary antibody, and then the primary antibody is reacted with a secondary antibody labeled with biotin, fluorescein, etc. The former is combined with labeled horseradish peroxidase (HRP) or alkaline phosphatase (AKP) etc. Finally, the chemical components in the cells or tissues are displayed by color development or fluorescence, and the antigen-antibody reaction products occurring in the cells can be clearly seen under an optical microscope or a fluorescence microscope, so that the distribution and content of certain chemical components can be determined in situ on cell slides or tissue sections. Those skilled in the art are familiar with how to evaluate polypeptide / protein expression levels and / or protein activity levels using IHC techniques, and can select a specific type of IHC technique according to specific needs. For example, according to the marker species, fluorescent dyes, radioisotopes, enzymes (mainly horseradish peroxidase and alkaline phosphatase), ferritin, colloidal gold, etc. are selected; according to the specific type, immunofluorescence, radioimmunoassay, immunoenzyme labeling, and immunogold-silver staining methods, etc. are selected; according to the staining steps, direct method (also known as one-step method) and indirect method (two-step, three-step or multi-step method) are selected; according to the binding mode, antigen-antibody binding (such as peroxidase-anti-peroxidase (PAP) method) or affinity connection such as avidin-biotin-peroxidase complex (ABC) method, streptavidin-peroxidase connection (SP) method, etc. are selected. In some preferred embodiments, considering that the immunoenzyme labeling method has the advantages of accurate positioning, good contrast, long-term preservation of stained specimens, and suitability for light and electron microscopy, etc. compared with the immunofluorescence technique, the immunoenzyme labeling method is selected to determine the protein expression levels of PHGDH.In some more preferred embodiments, the immunoassay is performed using direct detection with a PHGDH antibody (e.g. PHGDH antibody from Abeam with catalog number #ab240744). In a preferred embodiment, the PHGDH level is determined by PHGDH immunohistochemistry staining (IHC) score, wherein the PHGDH immunohistochemistry staining score = immunohistochemistry staining intensity score x immunohistochemistry staining area score; wherein the immunohistochemistry staining intensity score is: 0 score for no staining, 1 score for light brown, 2 score for brown, 3 score for dark brown; and the immunohistochemistry staining area score (the proportion of tumor cell staining positive area in the total area of tumor cells) is: 0 score for no staining positive, 1 score for <25%, 2 score for ≥25 to <50%, 3 score for ≥50 to <75%, 4 score for ≥75%.
[0077] In some embodiments, the PHGDH level is the median value, the mean value or the statistically determined standard value of the PHGDH level determined by any one of the above-mentioned methods for detecting the biomarker level in the sample.
[0078] As used herein, the term "reference level," "reference expression level," or terms of grammatical and conceptual equivalence, means a PHGDH level measured in a reference sample, reference cell, reference tissue, control sample, control cell, control tissue, or internal control (e.g., housekeeping gene), or a pre-specified PHGDH level, e.g., an immunohistochemical staining (IHC) score value. A reference level as used herein can be a numerical point or a threshold range. A person of ordinary skill in the art can determine a particular numerical value or numerical range based on common general knowledge in the art. As used herein, the terms "reference sample," "reference cell," "reference tissue," "control sample," "control cell," or "control tissue" are used interchangeably and mean a sample, cell, tissue, standard, or level for comparison purposes. In one embodiment, the reference level, reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is obtained from a healthy and / or non-diseased body site (e.g., tissue or cell) of the same subject or individual. For example, the reference level, reference sample, reference cell, reference tissue, control sample, control cell, or control tissue can be a healthy and / or non-diseased cell or tissue adjacent to a diseased cell or tissue (e.g., a cell or tissue adjacent to a tumor). In another embodiment, the reference sample is obtained from a non-treated tissue and / or cell of the body of the same subject or individual. In yet another embodiment, the reference level, reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is obtained from a healthy and / or non-diseased body site (e.g., tissue or cell) of a subject or individual other than the subject or individual. In even another embodiment, the reference level, reference sample, reference cell, reference tissue, control sample, control cell, or control tissue is obtained from a non-treated tissue and / or cell of the body of a subject or individual other than the subject or individual. In some embodiments, the reference level is the median, mean, or statistically determined standard value of PHGDH levels in samples obtained from the subject at a prior time point. In some embodiments, the reference level is the median, mean, or statistically determined standard value of PHGDH levels in a reference population (e.g., healthy tissue samples from the same patient or different subjects, e.g., healthy subjects, or average (e.g., mean or median) expression levels of multiple individuals or patients). In some embodiments, the reference level is a pre-specified PHGDH level. In some preferred embodiments, the reference level is a pre-specified immunohistochemical staining (IHC) score value, e.g., an immunohistochemical staining (IHC) score of 6.
[0079] As used herein, reference to a particular biomarker (e.g., PHGDH) level being "higher," "greater," "elevated," or a grammatical equivalent thereof means that the gene expression level (e.g., nucleic acid expression level or mRNA expression level), protein expression level, and / or protein activity level of the biomarker in the sample being tested is elevated by about 1% or more (e.g., about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1,000%, 2,000%, 5,000%, or about 10,000% or more) or increased by about 1-fold or more (e.g., about 1-fold, about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 3-fold, about 3.5-fold, about 4-fold, about 4.5-fold, about 5-fold, about 5.5-fold, about 6-fold, about 6.5-fold, about 7-fold, about 7.5-fold, about 8-fold, about 8.5-fold, about 9-fold, about 9.5-fold, about 10-fold, about 11-fold, about 12-fold, about 13-fold, about 14-fold, about 15-fold, about 16-fold, about 17-fold, about 18-fold, about 19-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 500-fold, about 1,000-fold or more, or higher than a pre-designated PHGDH level value, e.g., a pre-designated immunohistochemical staining (IHC) score value; preferably an immunohistochemical staining (IHC) score of 6.
[0080] Reference to a particular biomarker (e.g., PHGDH) level being "below," "less than," "reduced," or grammatical equivalents thereof means that the gene expression level (e.g., nucleic acid expression level or mRNA expression level), protein expression level, and / or protein activity level of the biomarker in the sample under test is reduced by about 1% or more (e.g., about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 850%, 900%, 950%, 1,000%, 2,000%, 5,000%, or about 10,000% or more) or increased by about 1-fold or more (e.g., about 1-fold, about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1.6-fold, about 1.7-fold, about 1.8-fold, about 1.9-fold, about 2-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2.4-fold, about 2.5-fold, about 3-fold, about 3.5-fold, about 4-fold, about 4.5-fold, about 5-fold, about 5.5-fold, about 6-fold, about 6.5-fold, about 7-fold, about 7.5-fold, about 8-fold, about 8.5-fold, about 9-fold, about 9.5-fold, about 10-fold, about 11-fold, about 12-fold, about 13-fold, about 14-fold, about 15-fold, about 16-fold, about 17-fold, about 18-fold, about 19-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 500-fold, about 1,000-fold or more), or below a pre-specified PHGDH level value, e.g., a pre-specified immunohistochemistry staining (IHC) score value; preferably an immunohistochemistry staining (IHC) score of 6.
[0081] Cancer metastasis and disseminated tumor cells (DTCs)
[0082] As used herein, the terms "sample," "biological sample," or "test sample" are used interchangeably and refer to a sample obtained from a subject and used for detecting PHGDH. The sample can be a tissue obtained from the subject, such as fresh tissue, frozen sample, fixed sample (e.g., formalin-fixed sample, paraffin-embedded sample), etc., preferably fresh tissue, formalin-fixed or paraffin-embedded tissue, particularly preferably a biopsy tissue suspected to have metastatic implantation according to the subject's past medical history and imaging results (e.g., CT, MRI, etc.).
[0083] Cancer metastasis is known in the art to comprise a series of biological events, processes that mainly include dissemination, entry into the blood circulation, and distant colonization; each of these events is driven by the ability of tumor cells to adopt different phenotypic cell states and co-opt their surrounding immune and stromal cells in the tumor environment to support their growth and evasion of the immune system. Specifically, during dissemination, cancer cells of a primary tumor first acquire the ability to penetrate the basement membrane, thereby invading the surrounding tissue; these cells subsequently acquire the ability to enter the blood circulation or lymphatic system through intravasation, i.e., cancer cells enter a nearby blood vessel or lymphatic vessel. Upon entry into the blood circulation, cancer cells form circulating tumor cells (CTCs), although CTCs are subject to substantial loss at this stage due to physical, biochemical, and immune factors, some CTCs are able to survive as single cells or cell microparticles and are coated with platelets, neutrophils, or tumor-derived stromal cells, thereby assisting their evasion of immune surveillance and increasing metastatic potential. During distant colonization, CTCs eventually exit blood vessels through extravasation processes, migrate into parenchymal tissue of distant organs, forming disseminated tumor cells (DTCs). In distant organs, although DTCs can be eliminated by local immune defenses, some cells are still able to survive and enter a dormant state. While these surviving DTCs have not yet expanded to form clinically detectable metastatic lesions, they are able to adapt to and evade immune surveillance in organ-specific microenvironments, ultimately leading to the formation of clinically detectable macroscopic metastases (see, e.g., Gerstberger S, Jiang Q, Ganesh K. Metastasis. Cell. 2023; 186(8): 1564-1579).
[0084] As used herein, the term “disseminated tumor cell (DTC)” refers to tumor cells that have detached from a tumor primary lesion of a primary cancer and are circulating in blood vessels or lymphatic vessels, and after reaching a distant target organ, colonize, survive, e.g., tumor cells that have not yet expanded to form a clinically detectable metastatic lesion. Thus, the term “disseminated tumor cell (DTC)” is opposite to the concept of “circulating tumor cell (CTC)” that has disseminated from a primary cancer and is in blood circulation.
[0085] Cancers that result in / produce disseminated tumor cells (DTCs) can be any cancer, such as any primary cancer or metastatic cancer from a primary cancer. In this context, the terms "tumor" and "cancer" are used interchangeably herein to refer to what is well known in the art and means the presence of cells in a subject that have characteristics unique to cancerous cells, such as uncontrolled proliferation, immortality, metastatic potential, rapid growth and proliferation rate, decreased cell death / apoptosis, and certain unique morphological features. Cancer cells are usually in the form of a solid tumor. However, cancer also includes non-solid tumors, such as blood tumors, e.g., leukemia, where the cancer cells originate from the bone marrow. The term "cancer" as used herein includes precancerous lesions as well as malignant cancers and tumors. Many types of cancer are known to metastasize and shed circulating tumor cells or are metastatic, such as secondary cancers from a primary cancer that has metastasized. Other cancers can include, but are not limited to, the following organs or systems: brain, heart, lung, gastrointestinal, genitourinary tract, liver, bone, nervous system, gynecological, hematological, skin, breast, and adrenal gland.Examples of cancer include, but are not limited to, acoustic neuroma, acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia (myeloblastic, myelocytic, myelomonocytic, monocytic and eosinophilic), acute T-cell leukemia, basal cell carcinoma, biliary tract cancer, bladder cancer, brain cancer, breast cancer, bronchus cancer, cervical cancer, chondrosarcoma, chordoma, choriocarcinoma, chronic leukemia, chronic lymphocytic leukemia, chronic myelocytic (granulocytic) leukemia, chronic myelogenous leukemia, colon cancer, colorectal cancer, craniopharyngioma, cystadenocarcinoma, diffuse large B-cell lymphoma, Burkitt's lymphoma, dysplasia, endometrial cancer, endotheliosarcoma, ependymoma, epithelial carcinoma, erythroleukemia, esophageal cancer, estrogen-receptor positive breast cancer, essential thrombocythemia, Ewing's sarcoma, fibrosarcoma, follicular lymphoma, germ cell testis cancer, glioma, heavy chain disease, hemangioblastoma, hepatoma, hepatocellular cancer, hormone insensitive prostate cancer, leiomyosarcoma, liposarcoma, lung cancer, lymphangioendotheliosarcoma, lymphangiosarcoma, lymphoblastic leukemia, lymphoma (Hodgkin's and non-Hodgkin's), malignancies and hyperproliferative disorders of the bladder, breast, colon, lung, ovaria, pancreas, prostate, skin and uterus, lymphoid malignancies of T-cell or B-cell origin, leukemia, lymphoma, medullary carcinoma, medulloblastoma, melanoma, meningioma, mesothelioma, multiple myeloma, myelogenous leukemia, myeloma, myxosarcoma, neuroblastoma, non-small cell lung cancer, oligodendroglioma, oral cancer, osteogenic sarcoma, ovarian cancer, pancreatic cancer, papillary adenocarcinoma, papillary carcinoma, pinealoma, polycythemia vera, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, sarcoma, sebaceous gland carcinoma, seminoma, skin cancer, small cell lung cancer, solid tumors (carcinomas and sarcomas), small cell lung cancer, stomach cancer, squamous cell carcinoma, synovioma, sweat gland carcinoma, thyroid cancer, primary macroglobulinemia, testicular tumor, uterine cancer, and Wilms' tumor.Other cancers include primary cancer, metastatic cancer, oropharyngeal cancer, hypopharyngeal cancer, liver cancer, gallbladder cancer, bile duct cancer, small intestine cancer, urethral cancer, kidney cancer, urothelial cancer, female genital tract cancer, uterine cancer, gestational trophoblastic disease, male genital tract cancer, seminal vesicle cancer, testicular cancer, germ cell tumor, endocrine gland tumor, thyroid cancer, adrenal gland cancer, pituitary cancer, angioma, sarcoma originating from bone and soft tissue, Kaposi's sarcoma, neural cancer, ocular cancer, meningeal cancer, glioblastoma, neuroma, neuroblastoma, schwannoma, solid tumors from hematological malignancies such as leukemia, metastatic melanoma, recurrent or persistent epithelial ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gastrointestinal stromal tumor, colorectal cancer, gastric cancer, melanoma, glioblastoma multiforme, non-squamous non-small cell lung cancer, malignant glioma, epithelial ovarian cancer, primary peritoneal serous carcinoma, metastatic liver cancer, neuroendocrine cancer, refractory malignancy, triple-negative breast cancer, HER2-amplified breast cancer, nasopharyngeal cancer, oral cancer, cholangiocarcinoma, hepatocellular carcinoma, squamous cell carcinoma of the head and neck (SCCHN), non-thyroid medullary carcinoma, recurrent glioblastoma multiforme, neurofibromatosis type 1, CNS cancer, liposarcoma, leiomyosarcoma, salivary gland cancer, mucosal melanoma, acral-lentiginous melanoma, paraganglioma, pheochromocytoma, advanced metastatic cancer, solid tumor, triple-negative breast cancer, colorectal cancer, sarcoma, melanoma, kidney cancer, endometrial cancer, thyroid cancer, rhabdomyosarcoma, multiple myeloma, ovarian cancer, glioblastoma, gastrointestinal stromal tumor, mantle cell lymphoma, and refractory malignancy.
[0086] In some embodiments, the subject is a mammal, e.g., a human, a non-human primate (e.g., chimpanzee, ape), a rodent (e.g., rat, mouse, guinea pig), a pet (e.g., cat, dog), a farm animal (e.g., horse, cow, sheep, pig, rabbit). In some embodiments, the subject is selected from the group consisting of:
[0087] ■a subject suspected of having a primary cancer;
[0088] ■a subject afflicted with a primary cancer but who has not yet received a treatment for the primary cancer;
[0089] ■a subject afflicted with a primary cancer and who has received a treatment for the primary cancer;
[0090] ■a subject afflicted with a primary cancer and who has received a treatment for the primary cancer but who has not yet received a prophylactic treatment for cancer metastasis;
[0091] ■a subject afflicted with a primary cancer and who has received a treatment for the primary cancer and who has received a prophylactic treatment for cancer metastasis; and / or
[0092] ■a subject having one or more of the foregoing.
[0093] In some embodiments, the subject is suspected to have metastatic colonization based on the subject's medical history and imaging results (e.g., CT, MRI, etc.).
[0094] In some embodiments, the subject has a primary cancer, such as hepatocellular carcinoma, cholangiocellular carcinoma, prostate cancer, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous carcinoma, peritoneal cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer or uterine cancer, salivary gland cancer, renal cancer, vulvar cancer, thyroid cancer, gastric cancer, melanoma, or neck cancer; preferably hepatocellular carcinoma, breast cancer, colorectal cancer, lung adenocarcinoma. In some embodiments, the subject has a primary cancer as described above and has or is at risk of having cancer metastasis from the primary cancer, such as lung (e.g., liver cancer lung metastasis), bone, brain, or lymph node (e.g., liver cancer lymph node metastasis) metastasis from the primary cancer.
[0095] As used herein, the term "immune-escaped DTC" means a disseminated tumor cell with the ability of immune escape, which is capable of evading recognition and attack / killing by the body's immune system, or resisting the surveillance and attack / killing by the immune system through various mechanisms, thereby surviving, activating and proliferating in the body. For example, the immune-escaped DTC can significantly reduce or inhibit immune cell infiltration (e.g., CD45+ immune cell infiltration) through various mechanisms of down-regulating immune response-related pathway enrichment, inhibiting chemokine expression, reducing immune cell recruitment, antigen presentation deficiency, evading immune response, resting state, and / or promoting metastatic colonization by shaping an immune desert microenvironment, etc.
[0096] Detection products and methods
[0097] Provided herein are products and methods for DTC typing, immune-escaped DTC screening and / or identification, cancer metastatic colonization prediction, and / or cancer treatment prognosis evaluation based on PHGDH levels in a subject sample.
[0098] The products herein can be detection kits and / or detection devices and / or detection systems. The reagents, components, modules, etc. contained therein can be selected according to the needs in actual applications (e.g., selected detection methods, specific conditions of the subject, etc.).
[0099] The products herein can comprise: (i) a detection-effective amount of one or more reagents, devices and / or modules that detect PHGDH molecules; (ii) one or more substances selected from the group consisting of containers, instructions for use, positive controls, negative controls, buffers, adjuvants or solvents, e.g., solutions for suspending or immobilizing cells, detectable labels or markers, solutions that facilitate hybridization of nucleic acids, solutions for lysing cells, or solutions for purification of nucleic acids.
[0100] As used herein, the terms "detection reagent" or "reagent that detects PHGDH molecules" or "reagent that detects the level / amount of PHGDH in a biological sample" are used interchangeably and refer to a reagent that is specific for PHGDH molecules and can be used to directly or indirectly detect the presence and / or amount of PHGDH molecules.
[0101] Since the sequences of PHGDH molecules are known in the art, one of ordinary skill in the art can routinely prepare or obtain commercially available reagents that are specific for PHGDH molecules. For example, useful detection reagents include, but are not limited to, probes, gene chips, PCR primers, antibodies, chemical binding molecules, etc., that have detection specificity for PHGDH molecules, such as primers for antisense sequences of PHGDH molecules, sequences set forth in SEQ ID NO: 4 and / or 5, etc.
[0102] For ease of detection, the detection reagents can also be provided with detectable labels, which include, but are not limited to, radioisotopes, fluorophores, chemiluminescent moieties, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, ligands (e.g., biotin or hapten), etc.
[0103] The detection reagents can be present in solution, immobilized on a support (e.g., a substrate, an adsorbent), or in other ways conventional in the art, as long as the mode of presence is suitable for detection of PHGDH molecules in a biological sample. For example, when the detection reagent is a nucleic acid probe, it can be present in the form of a biochip (or "microarray").
[0104] The products herein (e.g., detection kits) can also be accompanied by instructions for use of the kit, which set forth how to perform the detection using the kit, and how to utilize the results of the detection for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis assessment.
[0105] The products herein can also comprise other reagents that are clinically useful for disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis assessment, to assist or validate the results obtained by detecting PHGDH molecules. One of ordinary skill in the art can routinely select other reagents as needed.
[0106] In some embodiments, the PHGDH level in a biological sample is detected using a real-time quantitative reverse transcription PCR (qRT-PCR) method, and the products used can include: reverse transcription primers specific to PHGDH and PCR primers. In some specific examples, the PHGDH level in a biological sample is detected using a real-time quantitative reverse transcription PCR (qRT-PCR) method, and the products used can include:
[0107] (a) reverse transcriptase;
[0108] (b) RNase inhibitor;
[0109] (c) reverse transcription buffer;
[0110] (d) reverse transcription primers and PCR upstream and downstream primers for the target gene (PHGDH):
[0111] the forward primer is ATGGCCTTCGCAAATCTGC (SEQ ID NO: 4);
[0112] the reverse primer is AGTTCAGCTATCAGCTCCTCC (SEQ ID NO: 5);
[0113] (e) PCR buffer;
[0114] (f) dNTP;
[0115] (g) Taq DNA polymerase.
[0116] In some embodiments, the PHGDH level in a biological sample is detected using an immunohistochemical staining (IHC) method, and the products used can include specific antibodies, for example, PHGDH antibodies, such as PHGDH antibody with catalog number #ab240744 from Abeam.
[0117] "Specific antibodies" and / or "PHGDH antibodies" described herein include polyclonal antibodies and monoclonal antibodies, particularly monoclonal antibodies, that are specific for PHGDH polypeptides. The term "specific antibodies" refers to antibodies that are capable of binding to a PHGDH gene (e.g., human PHGDH gene) product or fragment. Preferably, the antibodies are capable of binding to a human PHGDH gene product or fragment but do not recognize and bind to other, non-related antigenic molecules. Antibodies in the present application include those that are capable of binding to and inhibiting PHGDH protein, and also those that do not affect the function of PHGDH protein. The present application also includes antibodies that are capable of binding to modified or unmodified forms of PHGDH gene product. "Specific antibodies" and / or "PHGDH antibodies" described herein include not only intact monoclonal or polyclonal antibodies, but also fragments of antibodies that have immunological activity, such as Fab' or (Fab)2 fragments; antibody heavy chains; antibody light chains; genetically engineered single-chain Fv molecules or chimeric antibodies, such as those with the binding specificity of a murine antibody but which still retain portions of the antibody from a human. "Specific antibodies" and / or "PHGDH antibodies" described herein can be prepared by various techniques known to those skilled in the art or can be purchased commercially. Disseminated tumor cell (DTC) typing, cancer metastasis colonization prediction, Immune-escaped DTC screening and / or identification and / or cancer treatment prognosis assessment
[0118] Provided herein are products and methods for disseminated tumor cell (DTC) typing, immune-escaped DTC screening and / or identification, cancer metastasis colonization prediction, and / or cancer treatment prognosis evaluation of a sample obtained from a subject.
[0119] In the present context, disseminated tumor cell (DTC) typing is the typing of DTCs as immune-escaped DTCs or non-immune-escaped DTCs according to the level of PHGDH in a sample obtained from a subject. It is disclosed herein for the first time that tumor cells with high expression of PHGDH are significantly enriched in micrometastases with significantly reduced CD45+ immune cell infiltration, and thus, DTCs can be typed as "immune-escaped DTCs"; conversely, as "non-immune-escaped DTCs".
[0120] As used herein, the term "immune-escaped DTCs", "DTCs with immune-escape ability" or grammatical variants thereof are used interchangeably and refer to a key population of tumor cells that escape immune surveillance and killing during cancer metastasis and promote the proliferation and expansion of metastatic foci.
[0121] In the present disclosure, immune escape DTC screening and / or identification is screening and / or identifying immune escape DTCs according to PHGDH level in a sample obtained from a subject. It is first disclosed herein that tumor cells with high PHGDH expression are significantly enriched in micrometastases with significantly reduced CD45+ immune cell infiltration, thus, immune escape DTCs are identified according to PHGDH level in a sample obtained from a subject, wherein a DTC is identified as an immune escape DTC if the PHGDH level is higher than a reference level; and a DTC is identified as a non-immune escape DTC if the PHGDH level is lower than a reference level.
[0122] In the present disclosure, cancer metastasis colonization prediction is predicting the likelihood of cancer metastasis colonization in a subject according to PHGDH level in a sample obtained from the subject. It is first disclosed herein that tumor cells with high PHGDH expression create an immune desert microenvironment that promotes cancer metastasis colonization, thus, the likelihood of cancer metastasis colonization in a sample is predicted according to PHGDH level in the sample, wherein a subject is likely to develop cancer metastasis colonization if the PHGDH level is higher than a reference level; and a subject is not likely to develop cancer metastasis colonization if the PHGDH level is lower than a reference level.
[0123] In the present disclosure, cancer treatment prognosis evaluation is evaluating a subject with cancer who has received treatment (e.g., a subject with a primary cancer who has received treatment for the primary cancer and / or a subject with a primary cancer who has received treatment for the primary cancer and received prophylactic treatment for cancer metastasis) as having a good prognosis or a poor prognosis according to PHGDH level in a sample obtained from the subject. Thus, a subject with cancer who has received treatment is evaluated as having a good prognosis or a poor prognosis according to PHGDH level in a sample obtained from the subject, wherein the subject is evaluated as having a poor prognosis if the PHGDH level is higher than a reference level; and the subject is evaluated as having a good prognosis if the PHGDH level is lower than a reference level.
[0124] As used herein, the term "prognosis" refers to the prediction of the probable course and outcome of a disease, which includes the judgment of a specific consequence of a disease (such as recovery, the appearance or disappearance of certain symptoms, signs, and complications, and other abnormalities, and death). The poor prognosis described in the present disclosure includes, but is not limited to, a subject with a primary cancer who has received treatment for the primary cancer developing a secondary cancer, e.g., metastatic cancer due to the primary cancer, e.g., lung (e.g., liver cancer lung metastasis), bone, brain, or lymph node (e.g., liver cancer lymph node metastasis) metastasis due to the primary cancer; a subject with a primary cancer who has received treatment for the primary cancer and received prophylactic treatment for cancer metastasis developing metastatic cancer and exacerbation, e.g., an immune desert microenvironment or the appearance of disseminated tumor cell colonization.
[0125] The control level used herein can be a numerical point or a threshold range. A person of ordinary skill in the art can determine the specific numerical value or numerical range according to common knowledge in the art.
[0126] Disclosed herein is a novel marker phosphoglycerate dehydrogenase (PHGDH) and the use of PHGDH as a biomarker or a substance for detecting PHGDH as a biomarker in the preparation of a product for detecting the level of PHGDH in a sample obtained from a subject to perform disseminated tumor cell (DTC) typing, immune escape DTC screening and / or identification, tumor metastasis colonization prediction and / or cancer treatment prognosis evaluation, which provides a new idea and approach for disseminated tumor cell (DTC) research and development of detection and other uses for disseminated tumor cells (DTC), thereby providing a novel biomarker for the field, which has clinical application prospects.
[0127] Examples
[0128] The present application will be further described in conjunction with specific examples and drawings. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. Those skilled in the art can make appropriate modifications and changes to the present application, and these modifications and changes are within the scope of the present application.
[0129] The experimental methods in the following examples, unless otherwise specified, are generally carried out according to the conventional conditions described in Michael R. Green et al. Molecular Cloning: A Laboratory Manual, Fourth Edition, New York: Cold Spring Harbor Laboratory Press, 2017, or according to the conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by weight.
[0130] The mice used in the examples were purchased from Shanghai Easbihoo Biotechnology Co., Ltd.; the experimental ethics involving clinical patients in the examples were approved by the Ethics Committee of Zhongshan Hospital, Fudan University, and written informed consent forms were signed by all included patients or their families.
[0131] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any method and material similar or equivalent to those described herein can be used in the present application. The preferred methods and materials described herein are only used for demonstration.
[0132] Example 1 : Profiling the changing signatures of disseminated tumor cells (DTCs) during metastasis colonization
[0133] To characterize the changes in disseminated tumor cells (DTCs) during metastasis and colonization, C57BL6 / J immunocompetent mice (purchased from Shanghai Lingchang Biotechnology Co., Ltd.) were injected via tail vein with 50 μL of Hepal-6 liver cancer cell suspension (cell injection volume 6*10). 6 A mouse model of liver cancer with lung metastasis was constructed using cells per mouse. The success of model construction was determined by the following criteria: CT scans were performed on mice 3 weeks after cell injection, and the CT results indicated the presence of lung metastases; mice were sacrificed 5 weeks after cell injection, and lung tissue was fixed, embedded, and stained with hematoxylin and eosin (HE), with HE results confirming the presence of lung metastases.
[0134] After establishing a mouse model of liver cancer lung metastasis (n=27), lung tissue was collected at nine time points following cell injection: T1 (0.25 hours), T2 (1 hour), T3 (4 hours), T4 (12 hours), T5 (24 hours), T6 (2 days), T7 (8 days), T8 (21 days), and T9 (35 days). Fresh mouse lung tissue was collected after euthanasia. Spatial transcriptome sequencing and single-cell transcriptome sequencing were performed using the BGI Stereo-seq platform (T1: n=1; T2: n=1; T3: n=2, T4: n=2, T5: n=2, T6: n=3, T7: n=4, T8: n=2, T9: n=1, total n=18) and the 10x genomics platform (n=1 at each time point).
[0135] Spatial transcriptome sequencing was performed according to the conditions, methods, and / or parameters recommended by the BGI Stereo-seq platform, following these steps:
[0136] ■Sample preparation: Tissue samples were frozen, OCT embedded and sectioned, and then mounted onto a Stereo-seq chip;
[0137] ■ Tissue permeabilization and library construction: After tissue sections are fixed and permeabilized, probes capture mRNA molecules in situ on the chip, followed by cDNA synthesis, amplification and library construction;
[0138] ■ Sequencing: Sequencing was completed using the BGI DNBSEQ series high-throughput sequencer.
[0139] Single-cell transcriptome sequencing was performed according to the conditions, methods, and / or parameters recommended by the 10x Genomics platform, following these steps:
[0140] ■Single-cell suspension preparation: Single-cell suspensions were prepared using grinding and enzymatic digestion methods. Trypan blue staining solution was mixed with the cell suspension at a ratio of 1:9. The staining was observed under a microscope, and the cell count and viability were recorded. After repeating the experiment twice, the average value met the quality control values recommended by the 10x Genomics platform before proceeding with subsequent experimental procedures.
[0141] ■Cell capture and cDNA amplification: Cells were resuspended in PBS containing 0.1% BSA and mixed with gel beads and oil droplets. Cells (about 20,000 cells / sample) were added to the Chromium Chip channel, and water-in-oil structure was formed by microfluidic system. Gel beads released primer sequences after cell lysis, and cDNA with 10x Barcode and Unique molecular identifier (UMI) information was generated after mRNA reverse transcription. cDNA was purified after water-in-oil structure was broken, and PCR amplification was performed to finally obtain stable cDNA.
[0142] ■Library construction and sequencing: The amplified cDNA was subjected to enzymatic fragmentation, end repair, and sequencing primer ligation to construct a 3' end expression library. Double-end sequencing was performed based on the Illumina Novaseq 6000 sequencing platform.
[0143] To investigate the dynamic changes of the immune microenvironment around disseminated tumor cells (DTCs) during metastatic colonization, a 50x50 μm 2 area around tumor cells determined based on spatial transcriptome data was defined as a tumor microenvironment (TME) unit, and a TME unit was further divided into 25 10x10 μm 2 areas, and the central 10x10 μm 2 area was defined as the tumor location point (TLP). Figure 1
[0144] Subsequently, the inventors performed unsupervised clustering of TME units for all samples, and used single-cell dimensionality reduction and clustering methods to divide the TME units into 1-4 clusters along the pseudo-time axis, i.e., Cluster 1-Cluster 4. Figure 2B
[0145] ■Identify high-variable genes in the single-cell data expression matrix and perform PCA dimensionality reduction;
[0146] ■Unsupervised clustering of cells according to gene expression profiles;
[0147] ■Visualization of single-cell clustering using the Uniform manifold approximation and projection (UMAP) algorithm;
[0148] ■Based on the clustering results, divide into Cluster 1-Cluster 4.
[0149] Simultaneously, pseudo-temporal analysis was performed on all tumor cells. The Monocle2R package was used to determine the pseudo-temporal differentiation trajectory and transcriptomic dynamics of all tumor cells collected at different sampling time points. Based on the pseudo-temporal analysis results automatically generated by the R package, the tumor cells were divided into phases 1 to 4 along the pseudo-temporal axis. Figure 2A ).
[0150] Table 1: TME unit clusters and tumor cells at different time points
[0151]
[0152] Table 2: Changes in tumor cell gene expression along a pseudo-timeline.
[0153]
[0154] Finally, gene expression information from the same tumor cell was matched with information from its surrounding TME units to construct the relationship between changes in tumor cell gene expression along a pseudo-timeline and the cell population within the TME unit over time. Figure 3 ).
[0155] Analysis revealed that tumor cell staging and TME unit clustering were synchronized on the timeline, suggesting that tumor cells and the immune microenvironment co-evolve during the metastasis and colonization of liver cancer.
[0156] Example 2: Immune-escaped, resting PHGDH+ tumor cells transiently enriched during cancer metastasis colonization Figure 4A
[0157] To analyze the percentage of tumor cells and the number of phase 3 tumor cells at time points T1 (0.25 hours), T2 (1 hour), T3 (4 hours), T4 (12 hours), T5 (24 hours), T6 (2 days), T7 (8 days), T8 (21 days), and T9 (35 days), the inventors calculated the proportion of phase 3 tumor cells to all tumor cells and the proportion of all tumor cells to all cells at each time point. Figure 4B ) and the number of stage 3 tumor cells at each time point ( Figure 4A ).
[0158] Figure 4B The data shows the proportion of stage 3 tumor cells to all tumor cells and the proportion of all tumor cells to all cells at each time point. The left Y-axis represents the proportion of tumor cells with stage 3 tumor cell characteristics detected in mouse lung tissue at each sampling time point to the total number of tumor cells at that sampling time point. The right Y-axis represents the proportion of all tumor cells to the total number of cells in mouse lung tissue at each sampling time point. Figure 4AThe number of stage 3 tumor cells at each time point is shown; wherein the Y axis represents the absolute number of tumor cells with characteristics of stage 3 tumor cells detected in the lung tissue of mice at each sampling time point. Therefore, as shown in the results of Figure 5 and 4B The results show that stage 3 tumor cells are basically concentrated at T5-T7 time points, accounting for about half of all tumor cells that survive under immune stress, while the number and proportion of cells at other time points are low. This result shows that stage 3 tumor cells are transiently enriched in disseminated tumor cells (DTC) that escape immune escape.
[0159] The inventors further performed differential gene expression analysis of stage 3 tumor cells and other tumor cells, and used the FindMarkers function in the R package Seurat to calculate the up-regulated or down-regulated genes of the target cell subpopulation compared to other cell subpopulations. By comparing gene expression, a "significance" threshold of p=0.05 was selected to obtain differentially expressed genes Figure 5 ).
[0160] Figure 6 The differential gene expression analysis of stage 3 tumor cells and other tumor cells is shown, wherein the x-axis is Log2(fold change) and the y-axis is -log10(adj. p-value). The above differential gene expression analysis of the genes shows that PHGDH is the most significantly up-regulated in stage 3 tumor cells (t-test), and PHGDH expression is highly coincident with stage 3 tumor cells, so stage 3 tumor cells are defined as PHGDH+ tumor cells and subsequent studies are performed.
[0161] Thereafter, the inventors performed pathway analysis on PHGDH+ tumor cells, and used the Metascape online tool to perform GO, KEGG enrichment analysis on the differential genes. The R package GSVA was used to analyze the pathway activity of individual cells. The R package GSEABase was used to analyze gene sets from MSigDB, KEGG and Canonical pathways.
[0162] The above pathway analysis results show that PHGDH+ tumor cells are significantly down-regulated in cell proliferation and immune response related pathways Figure 7 , and the TME unit immune cell infiltration around PHGDH+ tumor cells is significantly reduced Example 3: PHGDH+ tumor cells are significantly enriched in micrometastases with significantly reduced CD45+ immune cell infiltration , suggesting that PHGDH+ tumor cells have characteristics such as immune response evasion and quiescence.
[0163] The above results show that PHGDH+ disseminated tumor cells (DTC) may be a key tumor cell population that escapes immune surveillance and killing during liver cancer metastasis, and promotes the proliferation and expansion of metastatic foci.
[0164] Example 4: PHGDH+ tumor cells sculpt an immune desert microenvironment to promote cancer metastasis colonization
[0165] The inventors collected lymph node metastatic paraffin-embedded samples from pan-cancer patients with both macro-metastasis and micro-metastasis from clinical, and performed multi-color immunofluorescence staining and digital pathology platform-based cell analysis.
[0166] Specifically, based on the patient's medical history and pathological diagnosis information, the inventors retrospectively screened from the pathological specimen library of Zhongshan Hospital Affiliated to Fudan University, and finally obtained 6 cases of liver cancer patients, 4 cases of colorectal cancer patients, 3 cases of breast cancer patients and 3 cases of lung cancer patients of lymph node metastatic paraffin tissue samples. The above samples were confirmed by pathologists to have macro-metastasis (the number of tumor cells in the metastatic nest is more than 100) and micro-metastasis (single tumor cell metastasis or the number of tumor cells in the metastatic nest is less than 100).
[0167] Each paraffin tissue sample was subjected to multi-color immunofluorescence staining, wherein the antibody information was anti-PanCK antibody (Abeam, product number ab7753), anti-PHGDH antibody (Abeam, product number ab240744) and anti-CD45 antibody (CST, product number 47937). The method of multi-color immunofluorescence staining is known in the art, including de-waxing, after hydration, the section is subjected to antigen repair, blocking, primary antibody and secondary antibody incubation, and after incubation is completed, fluorescent dye reaction and antibody elution are performed. After multiple rounds of repeated staining, the nucleus is stained. After mounting, the whole slide is scanned using a full-automatic pathological scanning system, and digital analysis is completed by HALO software (v3.2, IndicaLabs).
[0168] As shown in the results in FIG. 8, in breast cancer (BRCA), colorectal cancer (CRC), lung adenocarcinoma (LUAD) and HCC lymph node metastasis, PHGDH+ tumor cells were significantly enriched in micro-metastasis compared with macro-metastasis, while CD45+ immune cell infiltration was significantly reduced.
[0169] The above results further indicate that PHGDH+ disseminated tumor cells (DTCs) are a key tumor cell population that escapes immune surveillance and killing during cancer metastasis, and promotes the proliferation and expansion of metastatic foci.
[0170] Figure 10
[0171] In order to study the influence of PHGDH+ tumor cells on shaping the immune desert microenvironment and promoting cancer metastasis and colonization, PHGDH knockout (sgPHGDH) and control (sgCtrl) mouse cell lines were further constructed, including Hepal-6 hepatocarcinoma cells, H22 hepatocarcinoma cells, B16-F10 melanoma cells and MC38 colorectal cancer cells, and immune-competent mice and immune-deficient mice were constructed by tail vein injection.
[0172] Methods for constructing the above PHGDH knockout and control mouse cell lines are known in the art, for example, lentiCRISPRv2-mCherry is digested with BsmB1 enzyme, and then 4 sgRNAs targeting PHGDH are cloned into lentiCRISPRv2-mCherry using standard molecular cloning methods. Hepa1-6 tumor cells are pre-plated in 6-well plates, and the required virus volume is calculated according to the cell MOI value and virus titer, and virus suspension and transfection reagent Polybrene are added to infect Hepa1-6 tumor cells. After 48 hours of transfection, the cells are transferred to a 96-well plate and clones with successful PHGDH knockout are selected to achieve PHGDH knockout in tumor cells. The control Hepa1-6 cell line is constructed using sgRNAs that do not knockout any genes.
[0173] The T5 time point mouse lung tissues are subjected to multicolor immunofluorescence by tail vein injection to construct immunocompetent mice and immunodeficient mice, as shown in FIG. 9, the results show that the immune cell infiltration of the PHGDH knockout cell group is significantly increased compared with the control group.
[0174] In addition, T8 time point lung tissues are collected for comparison of lung metastasis load. Figure 10 The load of T8 time point mouse lung metastasis (Hepa1-6 hepatoma cells, H22 hepatoma cells, MC38 colorectal cancer cells and B16-F10 melanoma cells) is shown, wherein sgPHGDH represents PHGDH knockout cells; sgCtrl represents the control; C57BL6 / J and BALB / C represent immunocompetent mice, Nod / scid and BALB / C nude represent immunodeficient mice; t test, NS represents no significant difference, * represents p < 0.05, ** represents p < 0.01, ** * represents p < 0.001. Therefore, it is found that in immunocompetent mice, the lung metastasis load of the PHGDH knockout cell group is significantly lower than that of the control group; while in immunodeficient mice, there is no significant difference between the two groups Figure 11 ).
[0175] The inventors also constructed cell lines with PHGDH knockdown (shPHGDH) or overexpression (PHGDH OE ) based on human hepatoma cell line Huh7 cells, for recruiting CD3+T cells and NK cells isolated from tumor tissues in vitro. The experimental results show that compared with the control group (shCtrl), the PHGDH knockdown group significantly increases the recruitment of CD3+T cells and NK cells, while overexpression of PHGDH significantly inhibits the migration of CD3+T cells and NK cells Example 5: PHGDH downregulates chemokine expression via H3K27me3-mediated epigenetic silencing, promoting immune desert microenvironment formation and tumor cell colonization ).
[0176] These results indicate that PHGDH+ tumor cells can promote metastasis and colonization by creating an immune desert microenvironment.
[0177] Figure 12 Figure 13
[0178] To elucidate the molecular mechanism by which PHGDH shapes the immune desert microenvironment, the inventors compared the expression of chemokines and the activity of related transcription factors in PHGDH+ tumor cells (stage 3 tumor cells) with those in other tumor cells.
[0179] like Figure 12 and Figure 13 As shown, the expression of chemokines in PHGDH+ tumor cells (stage 3 tumor cells) Figure 14 ) and related transcription factor activities ( Figure 15 (This is significantly lower than that of other tumor cells.)
[0180] Simultaneously, the inventors validated the findings using PCR and ELISA in human and mouse cell lines. The results of PCR and ELISA experiments suggested that PHGDH is a key factor in inhibiting the expression of tumor cell chemokines. Figure 16 ).
[0181] Furthermore, since PHGDH itself is the most critical rate-limiting enzyme in serine metabolism, providing S-adenosylmethionine (SAM) for histone methylation, the inventors also performed mass spectrometry analysis on serine metabolites such as serine, methionine, and SAM in PHGDH knockout mouse cells or PHGDH knockdown human cells. Figure 17 As shown, mass spectrometry analysis revealed that serine metabolites such as serine, methionine, and SAM were significantly reduced in PHGDH knockout mouse cells or PHGDH knockdown human cells, while serine metabolites were significantly increased in PHGDH overexpression.
[0182] SAM is known to regulate H3K27me3 (a histone methylation modification catalyzed by EZH2 and associated with gene expression silencing). Therefore, we performed multicolor immunofluorescence and digital pathology analysis on mouse lung tissue and lymph node micrometastases from HCC patients at T5 time point. Based on the multicolor fluorescence results and analysis using a digital pathology platform, we obtained the number of H3k27me3+PHGDH+ disseminated tumor cells (DTCs) versus H3k27me3+PHGDH-DTCs in each field of view, and performed a t-test, where p < 0.05. Example 6: PHGDH as a biomarker for disseminated tumor cell (DTC) typing, tumor metastasis colonization prediction, immune-escaped DTC screening and / or identification and / or cancer treatment prognosis assessmentAs shown, PHGDH+ disseminated tumor cells (DTCs) co-express H3K27me3 significantly more than PHGDH- disseminated tumor cells (DTCs), suggesting that the presence of H3k27me3+ PHGDH+ tumor cell infiltration in micrometastatic lesions is a potential intervention point for tumor metastasis. The above results show that PHGDH upregulates H3K27me3 in disseminated tumor cells (DTCs) by regulating SAM.
[0183] In addition, based on the epigenetic and chromatin accessibility maps at the single-cell level (scCPA-Tag), we found that chemokine and related transcription factor genes (e.g., inflammatory transcription factors such as RELA, IRF1, NFKB2, and STAT1) exhibited significantly lower H3K27me3 modification levels in PHGDH-knockout tumor cells than in the control group ), indicating that H3K27me3 can inhibit the transcriptional expression of chemokines.
[0184] In summary, PHGDH expression mediates the transcriptional silencing of disseminated tumor cells (DTCs) by regulating H3K27me3, inhibits the expression of chemokines, reduces the recruitment of immune cells, and thus promotes the formation of a local immune desert microenvironment, which is conducive to the metastasis and colonization of PHGDH+ disseminated tumor cells (DTCs).
[0185]
[0186] Based on the patient's medical history and pathological physician diagnosis information, the inventors randomly selected 6 lymph node metastasis paraffin tissue samples of hepatocellular carcinoma patients and 6 paraffin tissue samples of hepatocellular carcinoma patients without lymph node metastasis (liver cancer lymph node metastasis group), 6 lymph node metastasis paraffin tissue samples of colorectal cancer patients and 6 paraffin tissue samples of colorectal cancer patients without lymph node metastasis (intestinal cancer lymph node metastasis group), and 6 lymph node metastasis paraffin tissue samples of breast cancer patients and 6 paraffin tissue samples of breast cancer patients without lymph node metastasis (breast cancer lymph node metastasis group) from the pathological specimen library of Zhongshan Hospital Affiliated to Fudan University.
[0187] The above samples were delivered to an immunohistochemical (IHC) staining supplier (Nanjing Freyes Biotechnology Co., Ltd.) after the identification indicating the relevant cancer and metastasis was shielded, and the above samples in the liver cancer lymph node metastasis group, intestinal cancer lymph node metastasis group, and breast cancer lymph node metastasis group were subjected to immunohistochemical (IHC) staining in a blind manner according to the scheme provided by the immunohistochemical (IHC) staining supplier, wherein a PHGDH antibody (such as a PHGDH antibody with catalog number #ab240744 from Abeam) was used for direct detection. After immunohistochemical (IHC) staining, PHGDH immunohistochemical staining scoring was performed.
[0188] PHGDH immunohistochemistry staining score = immunohistochemistry staining intensity score x immunohistochemistry staining area score; wherein,
[0189] ■the immunohistochemistry staining intensity score is: 0 point for no staining, 1 point for light brown, 2 points for brown, and 3 points for dark brown;
[0190] ■the immunohistochemistry staining area score (the proportion of tumor cell staining positive area to the total tumor cell area) is: 0 point for no staining positive, 1 point for <25%, 2 points for ≥25 to <50%, 3 points for ≥50 to <75%, and 4 points for ≥75%.
[0191] The PHGDH immunohistochemistry (IHC) score of each sample is shown in Table 3 below. The IHC score results of each sample are associated with the results of the identification of the relevant cancer and metastasis, and the results are confirmed by pathological medical examination.
[0192] Table 3: Sample IHC score and corresponding identification
[0193]
[0194]
[0195] The above immunohistochemistry staining (IHC) results correspond to the sample conditions, indicating that PHGDH can be used as a biomarker for typing disseminated tumor cells (DTC), predicting tumor metastasis colonization, screening and / or identifying immune escape DTC, and / or evaluating the prognosis of cancer treatment, and the results are accurate.
[0196] In addition, the above results also indicate that, as confirmed again by the pathologist:
[0197] 1) When the IHC score of the sample is higher than the pre-designated immunohistochemistry staining (IHC) score value (i.e., the reference level), the disseminated tumor cell (DTC) is an immune escape DTC, and lower than the value is a non-immune escape DTC;
[0198] 2) When the IHC score of the sample is higher than the pre-designated immunohistochemistry staining (IHC) score value (i.e., the reference level), cancer metastasis colonization is prone to occur, and lower than the value is not prone to occur;
[0199] 3) When the IHC score of the sample is higher than the pre-designated immunohistochemistry staining (IHC) score value (i.e., the reference level), the prognosis of the subject is poor; and lower than the value indicates that the prognosis of the subject is good.
[0200] The above embodiments show that phosphoglycerate dehydrogenase (PHGDH) as a novel disseminated tumor cell (DTC) biomarker can be used for DTC prediction, diagnosis, screening and identification of immune escape disseminated tumor cells, specifically, can include DTC typing, immune escape DTC screening and / or identification, tumor metastasis colonization prediction and / or cancer treatment prognosis evaluation. The above citation can make the targeted treatment, immunotherapy and other systemic treatment for cancer distant metastasis more targeted, and provide more personalized targeted treatment for patients.
[0201] The above has specifically described the preferred embodiments of the present application, but the present application is not limited to the above-mentioned embodiments, and those skilled in the art can make various equivalent modifications or replacements without departing from the spirit of the present application. These equivalent modifications or replacements are all included in the scope defined by the claims of the present application.
Claims
1. The use of reagents for detecting the expression level of phosphoglycerate dehydrogenase (PHGDH) gene or protein as a biomarker in the preparation of products for detecting PHGDH levels in samples obtained from subjects to perform disseminated tumor cell (DTC) typing, identification of immune-escape DTCs, screening of immune-escape DTCs, prediction of cancer metastasis and colonization, or assessment of cancer treatment prognosis; wherein, The DTC typing is based on the PHGDH level in the sample obtained from the subject, classifying DTCs into immune-escape DTCs or non-immune-escape DTCs. The identification of immune escape DTCs is based on the PHGDH level in samples obtained from the subject. The screening for immune-escape DTCs is based on the PHGDH level in samples obtained from the subject. The cancer metastasis and colonization prediction is based on the PHGDH level in a sample obtained from the subject to predict the likelihood of the subject developing cancer metastasis and colonization. The cancer treatment prognostic assessment is based on the PHGDH levels in samples obtained from the subjects, evaluating those with cancer who have received treatment as having a good or poor prognosis; and The subjects are: those suspected of having primary cancer; those who have primary cancer but have not yet received treatment for primary cancer; those who have primary cancer and have received treatment for primary cancer; those who have primary cancer and have received treatment for primary cancer but have not yet received cancer metastasis prevention treatment; or those who have primary cancer and have received treatment for primary cancer and have received cancer metastasis prevention treatment.
2. The use as described in claim 1, wherein, In the DTC genotyping, if the PHGDH level in the sample obtained from the subject is higher than the reference level, the DTC is classified as immune-escape DTC, and if the PHGDH level is lower than the reference level, the DTC is classified as non-immune-escape DTC. In the identification of immune-escaped DTCs, if the PHGDH level in the sample obtained from the subject is higher than the reference level, the DTC in the sample is identified as an immune-escaped DTC. In the screening of immune-escaped DTCs, if the PHGDH level in the sample obtained from the subject is higher than the reference level, the DTC in the sample will be screened as immune-escaped DTCs. In the cancer metastasis and colonization prediction, if the PHGDH level in the sample obtained from the subject is higher than the reference level, the subject is more likely to develop cancer metastasis and colonization; while if the PHGDH level is lower than the reference level, the subject is less likely to develop cancer metastasis and colonization. In the cancer treatment prognostic assessment, if the PHGDH level in the sample obtained from the subject is higher than the reference level, the subject is assessed as having a poor prognosis; while if the PHGDH level is lower than the reference level, the subject is assessed as having a good prognosis.
3. As described in claim 2, in the cancer treatment prognostic assessment, the subject suffering from cancer and having received treatment is either a subject suffering from primary cancer and having received treatment for the primary cancer, or a subject suffering from primary cancer and having received treatment for the primary cancer and receiving cancer metastasis prevention treatment.
4. The use as described in claim 1, wherein, The PHGDH gene expression level includes the mRNA expression level.
5. The use as described in claim 4, wherein, The mRNA expression level was determined by real-time quantitative PCR (qRT-PCR), RNA-Seq, quantitative polymerase chain reaction (qPCR), reverse transcription PCR (RT-PCR), multiplex qPCR or RT-qPCR, gene expression sequence analysis (SAGE), MassARRAY technology, in situ hybridization, gene expression profile analysis, gene expression sequence analysis, and microarray analysis.
6. The use as described in claim 5, wherein, The qRT-PCR used the forward primer ATGGCCTTCGCAAATCTGC (SEQ ID NO: 4) and the reverse primer AGTTCAGCTATCAGCTCCTCC (SEQ ID NO: 5).
7. The use as described in claim 1, wherein, The expression level of the PHGDH protein was determined by mass spectrometry (MS), immunoassay, immunohistochemical staining (IHC), or proteomics techniques.
8. The use as described in claim 7, wherein, The immunohistochemical staining (IHC) includes immunofluorescence, radioimmunoassay, enzyme-linked immunosorbent assay (ELISA), and immunogold-silver immunoassay.
9. The use as described in claim 8, wherein, The immunoenzyme labeling method uses PHGDH antibody for direct detection.
10. The use as described in claim 1, wherein, The expression level of the PHGDH protein was determined by immunohistochemical staining (IHC) scoring.
11. The use as described in claim 10, wherein, The immunohistochemical staining (IHC) score = immunohistochemical staining intensity score × immunohistochemical staining area score.
12. The use as described in claim 11, wherein, The immunohistochemical staining intensity scores are as follows: no staining is 0 points, light brown is 1 point, brown is 2 points, and dark brown is 3 points.
13. The use as described in claim 11, wherein, The immunohistochemical staining area score is as follows: no staining positive is 0 points, <25% is 1 point, ≥25% to <50% is 2 points, ≥50% to <75% is 3 points, and ≥75% is 4 points.
14. The use as described in claim 1, wherein, The expression level of the PHGDH gene or protein in the sample obtained from the subject is the median, average, or standard value of the gene or protein expression level measured in the sample obtained from the subject using statistical methods.
15. The use as described in claim 2, wherein, The reference level is: (1) The median, mean, or standard value determined by statistical methods of the expression level of PHGDH gene or protein in samples obtained from the subject at a prior time point; (2) The median, mean, or statistically determined standard value of PHGDH gene or protein expression levels in the reference population; or (3) Pre-specified PHGDH gene or protein expression level.
16. The use as described in claim 15, wherein, The pre-specified PHGDH level is the pre-specified immunohistochemical staining (IHC) score.
17. The use as described in claim 2, wherein, The PHGDH level in the sample obtained from the subject is higher than the reference level if the PHGDH level in the sample obtained from the subject is greater than or equal to 1% higher than (1) the median, mean, or statistically determined standard value of the gene or protein expression level of PHGDH in the sample obtained from the subject at a prior time point or (2) the median, mean, or statistically determined standard value of the gene or protein expression level of PHGDH in the reference population.
18. The use as described in claim 2, wherein, The PHGDH level in the sample obtained from the subject is higher than the reference level if the PHGDH level in the sample obtained from the subject is greater than or equal to 1 times higher than (1) the median, mean, or statistically determined standard value of the gene or protein expression level of PHGDH in the sample obtained from the subject at a prior time point or (2) the median, mean, or statistically determined standard value of the gene or protein expression level of PHGDH in the reference population.
19. The use as described in claim 2, wherein, The PHGDH level in the sample obtained from the object is higher than the reference level when the PHGDH level in the sample obtained from the object is higher than a pre-specified PHGDH level value.
20. The use as described in claim 19, wherein, The pre-specified PHGDH level value is the pre-specified immunohistochemical staining (IHC) score value.
21. The use as described in claim 20, wherein, The pre-specified immunohistochemical staining (IHC) score is 6.
22. The use as described in claim 1, wherein, The PHGDH is the genomic DNA, cDNA, mRNA, or protein of PHGDH.
23. The use as described in claim 22, wherein, The genomic DNA of the PHGDH is the sequence shown in SEQ ID NO:
1.
24. The use as described in claim 22, wherein, The mRNA of the PHGDH is the sequence shown in SEQ ID NO:
2.
25. The use as described in claim 22, wherein, The protein of PHGDH has the sequence shown in SEQ ID NO:
3.
26. The use as described in claim 1, wherein, The object is a mammal or rodent.
27. The use as described in claim 26, wherein, The mammals referred to are human or non-human primates.
28. The use as described in claim 26, wherein, The rodents are rats, mice, or guinea pigs.
29. The use as described in claim 1, wherein, The subjects referred to are those suspected of having metastatic colonization based on their past medical history and imaging examination results.
30. The use as claimed in claim 29, wherein, The imaging results were determined by CT or MRI.
31. The use as described in claim 1, wherein, The sample is tissue obtained from the object.
32. The use as described in claim 31, wherein, The tissue obtained from the object is a fresh sample, a frozen sample, or a fixed sample.
33. The use as described in claim 32, wherein, The fixed sample is a formalin-fixed sample or a paraffin-embedded sample.
34. The use as described in claim 31, wherein, The tissue obtained from the subject is a biopsy tissue suspected of having metastatic colonization based on the subject's past medical history and imaging examination results.
35. The use as described in claim 1, wherein, The primary cancers mentioned are hepatocellular carcinoma, cholangiocarcinoma, prostate cancer, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, bladder cancer, breast cancer, uterine cancer, salivary gland cancer, kidney cancer, vulvar cancer, thyroid cancer, melanoma, or cervical cancer.
36. The use as described in claim 1, wherein the primary cancer is hepatocellular carcinoma, breast cancer, colorectal cancer, or lung adenocarcinoma.
37. The use as described in claim 1, wherein, The subject has primary cancer and is either suspected of having metastases from the primary cancer or is at risk of having metastases from the primary cancer.
38. The use as described in claim 37, wherein, The suspected cancer metastasis caused by the primary cancer refers to metastasis to the lungs, bones, brain, or lymph nodes caused by the primary cancer.
39. The use as described in claim 38, wherein, The lung metastasis caused by the primary cancer mentioned refers to liver cancer lung metastasis.
40. The use as described in claim 38, wherein, The lymph node metastasis caused by the primary cancer refers to lymph node metastasis from liver cancer.
41. The use as described in claim 1, wherein, The product in question is a reagent kit.
42. The use as described in claim 41, wherein, The kit contains reagents and testing equipment.
43. The use as described in claim 1, wherein, The product contains reagents, instruments, or equipment for determining the expression level of the PHGDH gene or protein in a sample.
44. The use as described in claim 43, wherein, The reagents used to determine the expression level of the PHGDH gene or protein in the sample are probes, gene chips, primers, antibodies, protein chips, and small chemical molecules that have specificity for detecting PHGDH.
45. The use as described in claim 43, wherein, The product is used to determine the expression level of the PHGDH gene or protein in the sample by real-time quantitative reverse transcription PCR, biochip detection, DNA blotting, RNA blotting, in situ hybridization, immunofluorescence, immunohistochemical staining, RNA blotting, or in situ hybridization.
46. The use as described in claim 43, wherein, The reagents used to determine the expression level of the PHGDH gene or protein in the sample are directly or indirectly labeled with a detectable tag.
47. The use as described in claim 46, wherein, The detectable tags are radioactive isotopes, fluorescent groups, chemiluminescent components, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, or ligands.
Citation Information
Patent Citations
Application of PHGDH inhibitor in prevention and / or treatment of colorectal cancer metastasis
CN115969975A
Novel prognostic and predictive biomarkers (tumor markers) for human breast cancer
EP2669682A1
Methods and compositions for the diagnosis and treatment of cellular proliferative disorders
WO2011150256A2
Biomarkers for cancer
WO2017009261A1
Biomarkers for cancer
US11035008B2