Bacterial multiple identification and quantitative detection method and reagent based on functional nucleic acid

Abstract

The invention provides a method and reagent for multiple identification and quantitative detection of bacteria based on functional nucleic acid. The method comprises the following steps: providing a plurality of groups of polystyrene microspheres labeled by fluorescein and a plurality of bacteria specific nucleic acid probes; mixing a group of polystyrene microspheres with a bacterium-specific nucleic acid probe so that the polystyrene microspheres are connected with the bacterium-specific nucleic acid probe to form fluorescence detection microspheres, and mixing multiple groups of generated fluorescence detection microspheres to form a detection reagent; providing a to-be-detected sample, and mixing the to-be-detected sample with the detection reagent for reaction to obtain a to-be-detected solution; the to-be-detected solution is subjected to fluorescence detection through a flow cytometry, the types of bacteria contained in the to-be-detected sample and the concentration of each type of bacteria are determined, semi-quantitative detection of multiple bacteria can be achieved, the flux is high, probe labeling is simple, detection can be completed only through the flow cytometry, and the use method is simple.

Description

Technical Field

[0001] The present application relates to the field of bacterial testing, and in particular to a method and reagent for multiple identification and quantitative detection of bacteria based on functional nucleic acids. Background Art

[0002] In recent years, the rapid identification and quantitative detection of bacteria have become increasingly important in the fields of medicine, food safety, and environmental monitoring. Current clinical bacterial detection methods mainly include culture-based microbial culture identification instruments, protein mass spectrometry, and genetic detection methods. Among them, the culture method is the gold standard method, but due to the limited sensitivity, this method has inherent defects such as long cycle and cumbersome sample pretreatment steps. At the same time, a variety of emerging molecular biology technologies have been developed recently, such as mass spectrometry (protein mass spectrometry), quantitative polymerase chain reaction PCR (FilmArray BCID), sequencing (pathogenic microbial metagenomic sequencing technology), and emerging synthetic biology (CRISPR). Many bacterial identification methods can shorten the detection time to several hours and have a high detection throughput, but these methods usually require expensive equipment and complex sample pretreatment to purify and enrich the target, and the purification may also cause the target to be lost, further reducing the detection sensitivity. In addition, high-throughput and rapid detection methods for pathogens are mostly genetic analysis methods, which can only complete genotyping analysis but cannot achieve phenotypic analysis. It is of great significance to develop new, high-throughput pathogenic bacteria phenotypic analysis methods and detection systems. Summary of the invention

[0003] The embodiments of the present application provide a method and reagent for multiple identification and quantitative detection of bacteria based on functional nucleic acids, which has high throughput, simple probe labeling, can complete the detection using only a flow cytometer, and is simple to use.

[0004] In a first aspect, the present invention provides a method for multiple identification and quantitative detection of bacteria based on functional nucleic acids, the method comprising:

[0005] Step S1: providing multiple groups of polystyrene microspheres labeled with fluorescein and multiple bacteria-specific nucleic acid probes;

[0006] Step S2: mixing a group of the polystyrene microspheres with a bacteria-specific nucleic acid probe so that the polystyrene microspheres and the bacteria-specific nucleic acid probe are connected to form fluorescent detection microspheres, and mixing the generated multiple groups of fluorescent detection microspheres to form a detection reagent;

[0007] Step S3: providing a sample to be tested, mixing the sample to be tested with the detection reagent to react, and obtaining a solution to be tested;

[0008] Step S4: performing fluorescence detection on the solution to be tested by flow cytometry to determine the types of bacteria contained in the sample to be tested and the concentration of each bacteria;

[0009] The polystyrene microspheres are modified with APC fluorescein, and the APC fluorescein intensities of different groups of polystyrene microspheres are different. The bacteria-specific nucleic acid probe is modified with FAM fluorescein.

[0010] In some embodiments, for Escherichia coli, the bacteria-specific nucleic acid probe comprises the following two deoxynucleotide chains:

[0011] EC5:GATGTGCGTCTTGATCGAGACCTGCGT;

[0012] Fs5: ACTCTCCTAGCTaTGGTTCGATCAAGA;

[0013] Among them, for Fs5, the fluorescent group (6FAM) and the quenching group (Dabcyld) are respectively connected to the two Ts in the middle of the base.

[0014] In some embodiments, for Staphylococcus aureus, the bacteria-specific nucleic acid probe comprises the following two deoxynucleotide chains:

[0015] SA6: ATGCCATCCTACCAACCACGAAGTACATTTCAAACTCATAACAATCCATCGGTTAGGTCCTGGTTGG;

[0016] Fs6: CTGGATGATCCTATGAACTGACTaTGACCTCACTACCAAG;

[0017] Among them, for Fs6, the fluorescent group (6FAM) and the quenching group (Dabcyld) are respectively connected to the two Ts in the middle of the base.

[0018] In some embodiments, if the corresponding bacteria are present in the sample to be tested, the quencher group is cleaved off to generate fluorescence, and the fluorescence intensity is related to the intensity of the fluorescent substance attached to the polystyrene microsphere.

[0019] In some embodiments, step S2 specifically includes:

[0020] S21: dissolving the bacteria-specific nucleic acid probe in a binding buffer to obtain a functional nucleic acid probe solution;

[0021] S22: adding the polystyrene microspheres labeled with fluorescein to the functional nucleic acid probe solution, shaking at room temperature to mix evenly, subjecting the obtained solution to magnetic separation or centrifugation, discarding the supernatant and retaining the precipitate;

[0022] S23: washing the precipitate with a washing buffer, and then resuspending the precipitate with a reaction buffer to form a fluorescent detection microsphere solution;

[0023] The polystyrene microspheres are modified with streptavidin, the nucleic acid chain end of the bacteria-specific nucleic acid probe is modified with biotin, the binding buffer is a phosphate buffer containing bovine serum albumin BSA, the washing buffer is a phosphate buffer containing polysorbate tween-20, and the reaction buffer is a phosphate buffer containing MgCl2.

[0024] In some embodiments, step S3 specifically includes:

[0025] S31: dissolving the sample to be tested in a bacterial lysis solution, and shaking to obtain a lysis solution to be tested;

[0026] S32: adding the lysate to be tested to the detection reagent, shaking at room temperature to mix evenly, subjecting the resulting solution to magnetic separation or centrifugation, discarding the supernatant and retaining the precipitate;

[0027] S33: washing the precipitate with a washing buffer, and then resuspending the precipitate with the washing buffer to obtain the solution to be detected.

[0028] In some embodiments, step S4 specifically includes:

[0029] S41: using a flow cytometer to detect the solution to be detected, selecting the APC / FAM channel, and recording the fluorescence intensity;

[0030] S42: Differentiate the types of detected bacteria according to the APC fluorescence of different intensities marked on the polystyrene microspheres, and quantitatively detect the bacterial concentration according to the FAM fluorescence marked on the bacteria-specific nucleic acid probe.

[0031] In some embodiments, the method further comprises:

[0032] Providing standard strains of different concentrations, mixing the standard strains with the detection reagent to react, and performing fluorescence detection on the standard strains after the reaction by flow cytometry, and formulating a standard curve according to the standard strains of different concentrations and the corresponding fluorescence intensities;

[0033] Wherein, step S42 uses the standard curve to determine the bacterial species and bacterial concentration in the sample to be tested.

[0034] In a second aspect, the present application provides a functional nucleic acid-based bacterial multiple identification and quantitative detection reagent, the detection reagent comprising:

[0035] (a) a plurality of groups of bacteria-specific nucleic acid probes; different groups of bacteria-specific nucleic acid probes are different to detect different bacteria;

[0036] (b) Several groups of polystyrene microspheres labeled with fluorescein; different groups of polystyrene microspheres have different fluorescein intensities to produce fluorescence of different intensities.

[0037] In some embodiments, the detection reagent further comprises:

[0038] (c) bacterial lysate;

[0039] (d) a binding buffer, wherein the binding buffer is a phosphate buffer containing bovine serum albumin (BSA);

[0040] (e) a washing buffer, wherein the washing buffer is a phosphate buffer containing tween-20;

[0041] (f) a reaction buffer, wherein the reaction buffer is a phosphate buffer containing MgCl2.

[0042] The present application provides a method and reagent for multiple identification and quantitative detection of bacteria based on functional nucleic acids, which can achieve simultaneous detection of multiple bacteria in a short period of time, overcoming the shortcomings of traditional methods in terms of time and operational complexity. The intuitiveness and simplified operation process of this method make it have broad application prospects in clinical and field detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The schematic diagram of the process of the bacterial multiple identification and quantitative detection method based on functional nucleic acid provided in the present application is shown;

[0044] Figure 2 The schematic diagram shows the principle of the method for multiple identification and quantitative detection of bacteria based on functional nucleic acids provided by the present application;

[0045] Figure 3 There are three types of polystyrene microspheres D1, 2, and 3, each with different intensities of APC fluorescence. One group D1 is modified with Escherichia coli DNAzyme fluorescent probe, D2 is modified with Staphylococcus aureus DNAzyme fluorescent probe, and D3 is not modified. The flow cytometer detection results after adding the Escherichia coli test sample are shown.

[0046] Figure 4There are three types of polystyrene microspheres D1, 2, and 3, each with different intensities of APC fluorescence. One group D1 is modified with Escherichia coli DNAzyme fluorescent probe, D2 is modified with Staphylococcus aureus DNAzyme fluorescent probe, and D3 is not modified. The flow cytometer detection results after adding samples containing Escherichia coli and Staphylococcus aureus are shown. DETAILED DESCRIPTION

[0047] The technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present application. It is to be understood that the specific embodiments described herein are only used to explain the related applications, rather than to limit the present application. It should also be noted that, for ease of description, only the parts related to the related applications are shown in the accompanying drawings.

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein are only for the purpose of describing the embodiments of this application and are not intended to limit this application.

[0049] In the following description, reference is made to “some embodiments”, which describe a subset of all possible embodiments, but it will be understood that “some embodiments” may be the same subset or different subsets of all possible embodiments and may be combined with each other without conflict.

[0050] At present, in the field of bacterial detection, functional nucleic acids (such as deoxyribozymes) have received extensive attention due to their specificity and flexibility. Deoxyribozymes refer to nucleic acid molecule fragments with special structures and functions obtained by in vitro screening, i.e., systematic evolution of ligands by exponential enrichment (SELEX), mainly including aptamers with specific recognition of target substances, deoxyribozymes with catalytic ability, and aptamer ribozymes with both target substance recognition and catalytic functions. Among them, the biological recognition function of deoxyribozymes is very similar to that of antibodies, and has many advantages such as a wide target range, high stability, and easy chemical modification and synthesis. After deoxyribozymes are bonded to fluorescent molecules, molecular beacons can be formed for detecting targets. Therefore, it has been rapidly developed as a recognition molecule for biosensing, and is widely used in the recognition and detection of nucleic acids, proteins, bioactive molecules, and disease markers, and shows good application prospects. CBA (cytometric bead array), also known as flow cytometric microsphere technology, is a multiplex protein quantitative detection method based on a flow cytometric detection system, which can simultaneously detect multiple indicators in a single sample. CBA is an advanced version of flow cytometry, which uses tiny, dispersed particles to capture liquid analytes, and uses a flow cytometer to detect the fluorescence emitted by the "sandwich"-like particles - "capture microspheres-analytes-detection antibody sandwich complexes" to determine the number of analytes. This method requires less sample volume and is faster and more accurate. Polystyrene fluorescently encoded microspheres (i.e., polystyrene microspheres labeled with different fluoresceins) are used as solid phase carriers to effectively capture and enrich target bacteria, thereby improving the sensitivity and accuracy of detection. Most of the existing multi-target detection methods rely on a single detection channel, which makes it difficult to achieve simultaneous detection of multiple bacteria, limiting their extensiveness in practical applications.

[0051] Overall, although the sensitivity and specificity of bacterial detection technology have been improved, there are still some shortcomings. First, traditional methods often require a long detection time and cannot meet the needs of rapid detection. Secondly, the existing multi-target detection technology also has certain limitations in operational complexity and cost, which limits its application in clinical and field testing. In addition, the existing technology is still insufficient in the ability to simultaneously detect multiple bacteria, and it is difficult to meet the needs of multiple detection in practical applications.

[0052] Based on this, it is particularly important to provide a new type of bacterial multiple identification and quantitative detection method based on functional nucleic acids. The RNA shearing fluorescent deoxyribozyme technology naturally contains the combined functions of recognition and fluorescent signal response, which is very suitable for combining with flow cytometry technology to jointly develop a multiple bacterial identification method and kit using flow cytometry technology and functional nucleic acid probes.

[0053] The embodiments of the present application will be described in detail below with reference to the accompanying drawings.

[0054] In one embodiment, see Figure 1 , which provides a schematic flow chart of a method for multiple identification and quantitative detection of bacteria based on functional nucleic acids. Figure 1 As shown, the method includes:

[0055] Step S1: providing multiple groups of polystyrene microspheres labeled with fluorescein and multiple bacteria-specific nucleic acid probes.

[0056] Step S2: Mix a group of polystyrene microspheres with a bacteria-specific nucleic acid probe so that the polystyrene microspheres and the bacteria-specific nucleic acid probe are connected to form fluorescent detection microspheres, and mix the generated multiple groups of fluorescent detection microspheres to form detection reagents.

[0057] It should be noted that the polystyrene microspheres are modified with APC fluorescein, and the APC fluorescein intensities of the polystyrene microspheres in different groups are different. The polystyrene microspheres in the same group are labeled with the same fluorescein intensity, and may be referred to as polystyrene fluorescently coded microspheres hereinafter.

[0058] It should be noted that the bacteria-specific nucleic acid probe includes a functional nucleic acid for identifying target bacteria, which can bind to a target protein secreted by the target bacteria in the sample to be tested, and the functional nucleic acid is labeled with a proximal fluorescent group (F) and a quenching group (Q). The bacteria-specific nucleic acid probe is modified with FAM fluorescein.

[0059] If the corresponding bacteria are present in the sample to be tested, the quenching group is cut off to produce fluorescence, and the fluorescence intensity is related to the intensity of the fluorescein on the connected polystyrene microspheres. In other words, if the target bacteria are not present in the sample to be tested, the fluorescence is in a quenched state; if the corresponding bacteria are present in the sample to be tested, the corresponding deoxynucleotide chain is cut into short chains, and the quenching group (Q) falls into the solution, releasing the fluorescence of the probe fluorescent group (F) on the microspheres.

[0060] In the embodiment of the present application, the polystyrene microspheres are modified with APC, the bacteria-specific nucleic acid probes are modified with FAM, and the ends of the bacteria-specific nucleic acid probes are modified with biotin, and the surface of the polystyrene microspheres is modified with streptavidin, and then connected with the biotin-modified bacteria-specific nucleic acid probes. In this way, after the detection reagent is mixed with the sample to be tested, the types of detected bacteria are distinguished according to the different intensities of APC fluorescence marked on the polystyrene microspheres, and the concentration of bacteria is quantitatively detected according to the intensity of FAM fluorescence marked on the functional nucleic acid.

[0061] Here, the bacterial species detected by the bacteria-specific nucleic acid probe include but are not limited to: Escherichia coli, Staphylococcus aureus, Klebsiella pneumoniae, and Helicobacter pylori.

[0062] Taking E. coli as an example, the applicant found that the selected bacteria-specific nucleic acid probe RFD-EC can effectively identify E. coli, using a functional nucleic acid probe with a specific structure as a sensing molecule. The molecule of RFD-EC includes two base-complementary paired deoxynucleotide chains: EC5 and Fs5, and its sequence is shown in Table 1. The principle of the overall reaction is as follows Figure 2 As shown, in Figure 2 In, MB refers to polystyrene microspheres with APC fluorescent labeling, and polystyrene microspheres are coupled with biotin-labeled bacteria-specific nucleic acid probes respectively; Fluorescent groups (F) and quenching groups (Q) are bonded simultaneously on FS5, and when there is no Escherichia coli-specific secretory protein, RFD-EC is in a fluorescence quenching state, and under laser irradiation, a lower fluorescence detection background is formed; when Escherichia coli-specific secretory protein is detected, the deoxynucleotide chain of FS5 is cut to a short chain, and the distance between the fluorescent group (F) and the quenching group (Q) in the molecule is increased, and fluorescence can be restored under the irradiation of excitation light to generate a strong fluorescence signal. The same type of probes have been preliminarily realized in the detection of Klebsiella pneumoniae, Staphylococcus aureus, etc., and the feasibility of the method has been verified. However, due to the limitation of fluorescent group modification, each type of probe needs to use the same fluorescence wavelength, and high-throughput simultaneous detection cannot be performed. In order to solve this problem, the embodiment of the present application combines magnetic fluorescence encoding microsphere technology, and it is possible to realize the same reaction system to detect multiple different bacteria at the same time.

[0063] Table 1

[0064]

[0065]

[0066] In some embodiments, step S2 specifically includes:

[0067] S21: Dissolve the bacteria-specific nucleic acid probe in a binding buffer to obtain a functional nucleic acid probe solution.

[0068] Here, the binding buffer is phosphate buffered saline containing bovine serum albumin (BSA).

[0069] S22: adding the polystyrene microspheres labeled with fluorescein to the functional nucleic acid probe solution, shaking at room temperature to mix evenly, subjecting the resulting solution to magnetic separation or centrifugation, discarding the supernatant and retaining the precipitate;

[0070] S23: washing the precipitate with a washing buffer, and then resuspending the precipitate with a reaction buffer to form a fluorescent detection microsphere solution;

[0071] Here, the washing buffer was phosphate buffer containing polysorbate tween-20, and the reaction buffer was phosphate buffer containing MgCl2.

[0072] Step S3: providing a sample to be tested, mixing the sample to be tested with a detection reagent to react, and obtaining a solution to be tested.

[0073] Here, the sample to be tested may be a standard and may include but is not limited to the patient's blood, body fluid, urine, etc. The sample to be tested needs to undergo some pretreatment, such as centrifugation, concentration, etc.

[0074] In a specific embodiment, step S3 specifically includes:

[0075] S31: dissolving the sample to be tested in a bacterial lysis solution, and shaking to obtain a lysis solution to be tested;

[0076] S32: adding the lysate to be tested to the detection reagent, shaking at room temperature to mix evenly, subjecting the resulting solution to magnetic separation or centrifugation, discarding the supernatant and retaining the precipitate;

[0077] S33: Wash the precipitate with a washing buffer, and then resuspend the precipitate with the washing buffer to obtain a solution to be detected.

[0078] Step S4: Perform fluorescence detection on the solution to be tested by flow cytometry to determine the types of bacteria contained in the sample to be tested and the concentration of each bacteria.

[0079] In a specific embodiment, step S4 specifically includes:

[0080] S41: Use a flow cytometer to detect the solution for on-machine detection, select the APC / FAM channel, and record the fluorescence intensity;

[0081] S42: Differentiate the types of detected bacteria according to the APC fluorescence of different intensities marked on the polystyrene microspheres, and quantitatively detect the bacterial concentration according to the FAM fluorescence marked on the bacteria-specific nucleic acid probe.

[0082] In addition, for the detection method of the embodiment of the present application, it is also necessary to establish a reaction system using a standard strain to determine the positive standard and the concentration control standard. Therefore, the method also includes:

[0083] Step S0: providing standard strains of different concentrations, mixing the standard strains with the detection reagent for reaction, and performing fluorescence detection on the standard strains after the reaction by flow cytometry, and formulating a standard curve according to the standard strains of different concentrations and the corresponding fluorescence intensities.

[0084] Accordingly, in step S42, the standard curve is used to determine the bacterial species and bacterial concentration in the sample to be tested.

[0085] In summary, the present application provides a multi-target synchronous functional nucleic acid probe identification and detection method based on flow microsphere technology, which can realize the simultaneous detection of multiple bacteria in the same sample using different coded microspheres and the same fluorescent group series probes. The polystyrene microspheres are labeled with APC fluorescent markers of different intensities, and then respectively coupled with biotin-labeled functional nucleic acids to form fluorescent detection microspheres. The bacteria-specific nucleic acid probes are labeled with adjacent fluorescent groups (F) and quenching groups (Q), and the fluorescence is in a quenched state. After the fluorescent detection microspheres and the sample to be tested are mixed, if the corresponding bacteria are present, the deoxynucleotide chain of the probe is cut into short chains, and the quenching group (Q) segment falls into the solution, releasing the fluorescence of the probe fluorescent group (F) on the microsphere. The FAM fluorescence intensity is measured by flow cytometry, as well as a known bacterial positive control, to comprehensively judge the type of bacteria in the sample to be tested and the concentration of each bacteria. In this way, since different bacteria-specific nucleic acid probes in the embodiments of the present application are combined with polystyrene microspheres labeled with fluorescein of different intensities, different target bacteria correspond to different fluorescence intensities, thereby enabling one-time detection of multiple bacteria. Moreover, based on the number of fluorescent spots corresponding to different target bacteria, the bacterial content can also be inferred, thereby enabling semi-quantitative detection of multiple bacteria.

[0086] In another embodiment of the present application, a functional nucleic acid-based bacterial multiple identification and quantitative detection reagent is provided, characterized in that the detection reagent comprises:

[0087] (a) a plurality of groups of bacteria-specific nucleic acid probes; different groups of bacteria-specific nucleic acid probes are different to detect different bacteria;

[0088] (b) Several groups of polystyrene microspheres labeled with fluorescein; different groups of polystyrene microspheres have different fluorescein intensities to produce fluorescence of different intensities.

[0089] In some embodiments, the detection reagent further comprises:

[0090] (c) bacterial lysate;

[0091] (d) a binding buffer, wherein the binding buffer is a phosphate buffer containing bovine serum albumin (BSA);

[0092] (e) a washing buffer, wherein the washing buffer is a phosphate buffer containing tween-20;

[0093] (f) a reaction buffer, wherein the reaction buffer is a phosphate buffer containing MgCl2.

[0094] In another embodiment of the present application, the aforementioned detection method and detection reagent are described in detail in combination with specific scenarios and experimental parameters. Overall, the embodiment of the present application specifically includes the following steps:

[0095] (1) Preparation of fluorescent detection microspheres: by combining polystyrene microspheres labeled with APC fluorescent pigments of different intensities with bacterial-specific nucleic acid probes corresponding to target bacteria, fluorescent detection microspheres with different specificities and fluorescence intensities are formed to facilitate subsequent bacterial detection.

[0096] (2) Prepare bacterial positive controls and select standard strains for dispersion and counting to ensure the accuracy and reliability of the test.

[0097] (3) Constructing a detection reaction system by mixing the fluorescent detection microspheres with the sample to be tested and utilizing the specific cutting effect of the probe to release the fluorescent signal, thereby achieving detection of the target bacteria.

[0098] (4) The fluorescence intensity of the sample to be tested is detected by flow cytometry, and the type of bacteria in the sample to be tested is determined by combining it with a known bacterial positive control.

[0099] The following description is made by taking the target bacteria as Escherichia coli (it may also be Staphylococcus aureus, Klebsiella pneumoniae, Helicobacter pylori, etc.) as an example.

[0100] The E. coli-specific DNAzyme probe (i.e., the bacterial-specific nucleic acid probe corresponding to E. coli) is coated on the magnetic fluorescent coding microspheres (i.e., polystyrene microspheres labeled with fluorescein) to form E. coli-specific fluorescent detection microspheres for subsequent bacterial detection (other bacteria are coated in the same way). The specific coating method is that the biotin-modified DNAzyme probe is combined with the streptavidin on the surface of the polystyrene microspheres.

[0101] In this example, Escherichia coli was isolated from a clinical strain culture dish and its concentration was tested by turbidimeter. The required bacterial concentration was 10 3 ~10 8 , by adding lysis solution and vortexing to obtain the bacterial lysis solution of the sample to be tested, thereby obtaining the Escherichia coli sample to be tested as the standard strain.

[0102] The fluorescence detection results are two fluorescence signals in the flow analysis system. APC qualitatively distinguishes different fluorescence-encoded microspheres to determine what kind of bacterial detection system is present. FAM in the flow cytometer qualitatively identifies whether it is this type of bacteria, and the fluorescence intensity qualitatively distinguishes the bacterial content (the standard curve is obtained by diluting and detecting the laboratory standard strain Escherichia coli ATCC25922).

[0103] Clinical flow cytometers with dual-color fluorescence detection channels can complete the test. BioCore Bio can provide magnetic fluorescent coded microspheres (i.e., polystyrene microspheres labeled with APC) that meet the test requirements. Multiple bacteria-specific nucleic acid probes can be used in one test. The bacteria-specific nucleic acid probes are modified as necessary for detection, and multiple bacteria can be identified and their concentrations determined simultaneously. Combination bacterial identification kits can be made according to intestinal / common, etc.

[0104] In the examples of the present application, the specific detection kit comprises: bacteria-specific nucleic acid probe powder, polystyrene microspheres, bacterial lysis solution, binding buffer, reaction buffer, and washing buffer.

[0105] Specific synthesis steps and parameters are provided below.

[0106] The overall detection reagent includes: (a) modified bacteria-specific nucleic acid probe powder (for Escherichia coli, the powder contains EC5 and Fs5); (b) polystyrene microspheres modified with fluorescent substances of different intensities; (c) bacterial lysis solution; (d) binding buffer; (e) reaction buffer; and (f) washing buffer.

[0107] (1) Preparation of fluorescence detection microspheres

[0108] Objective To synthesize polystyrene microspheres labeled with APC fluorescein with different fluorescence intensities. Functional nucleic acid probes need to be designed according to the specificity of target bacteria.

[0109] Operation steps:

[0110] 1. Add an appropriate amount of polystyrene microspheres (e.g. 100 μL) to the diluted bacteria-specific nucleic acid probe solution. The concentration should be optimized according to the characteristics of the probe (usually in the range of 10-100 nM).

[0111] 2. Vortex at room temperature for 30 minutes to ensure that the bacteria-specific nucleic acid probe is evenly coated on the surface of the microspheres.

[0112] 3. Remove unbound probes through centrifugation and washing steps to obtain fluorescent detection microspheres with different specificities and fluorescence intensities.

[0113] The specific parameters for E. coli are as follows:

[0114] a. Use 100uL of binding buffer to dissolve the bacteria-specific nucleic acid probe powder corresponding to E. coli, with a theoretical final concentration of 1uM.

[0115] b. Vortex the suspension of APC-modified polyethylene microspheres D1, take 500,000 (10,000 / uL, 50 microliters) coded microspheres D1 with a pipette and place them in a centrifuge tube, add 100uL of Escherichia coli DNA enzyme probe solution under vortexing, shake at room temperature for 30 minutes (speed is 1200rpm), magnetic separation or centrifugation (2000g, 1 minute), discard the supernatant, wash 3 times with washing buffer, and finally resuspend with 100uL reaction buffer to produce a fluorescent detection microsphere solution.

[0116] (2) Preparation of bacterial positive control

[0117] Material preparation: Select ATCC standard Escherichia coli ATCC25922 bacterial sample.

[0118] Operation steps:

[0119] a. Use standard physiological saline (such as 0.9% NaCl solution) to disperse the selected bacterial sample to ensure that the bacteria are evenly distributed.

[0120] b. Perform bacterial counts to ensure that the bacterial concentration of each sample is within a predetermined range (e.g., 1×10^6 CFU / mL).

[0121] c. The dispersed bacterial samples are lysed and stored under appropriate conditions (such as -20°C freezing), which is to mark the bacterial samples for subsequent use.

[0122] (3) Construction of detection reaction system

[0123] Material preparation: fluorescence detection microsphere solution, standard strain (used for control experiments to determine the positive result interval or mapping relationship) or sample to be tested, reaction buffer solution.

[0124] Operation steps:

[0125] 1. Take 10 μL of fluorescent detection microsphere solution and add it to 90 μL of reaction system, which includes bacterial positive control or test sample and reaction buffer solution.

[0126] 2. In the reaction system, the functional nucleic acid probe modified on the surface of the polystyrene microspheres is labeled with adjacent fluorescent groups (F) and quenching groups (Q). When not bound to the target bacteria, the fluorescence is in a quenched state.

[0127] 3. Incubate the mixed reaction system at 37°C for 30 minutes to promote the binding of the probe to the target bacteria.

[0128] 4. The mixed system was centrifuged at 8000 rpm for 10 minutes, the supernatant was removed, and the mixture was resuspended in reaction buffer.

[0129] 5. Take a spot from the throat swab and place it on a culture dish to isolate bacteria. Dissolve it in bacterial lysis buffer and shake it for 3 minutes to fully lyse it. Then take 100uL and add it to the coded microsphere-Escherichia coli DNAzyme probe solution. Shake it at room temperature for 30 minutes (1200rpm), separate it magnetically or centrifuge it (2000g, 1min), discard the supernatant, wash it 3 times with washing buffer, and finally resuspend it with 100uL washing buffer.

[0130] (4) Testing of samples to be tested

[0131] Equipment preparation: flow cytometer.

[0132] Operation steps:

[0133] 1. Detect the reacted samples by flow cytometry, select the APC / FAM channel, and record the fluorescence intensity (MFI).

[0134] 2. By comparing the fluorescence intensity with that of the known bacterial positive control (i.e., standard strain), determine whether the target bacteria exists in the sample to be tested and determine its type.

[0135] 3. On-machine detection: The principle of this detection method is to detect E. coli by detecting the fluorescence intensity of the coated probe bound to the polystyrene microspheres in the detection solution. The fluorescence intensity detected is different depending on the content of the detected bacteria bound to the microspheres.

[0136] Figure 3-4 This is the experimental result diagram under the above parameters. Specifically:

[0137] Figure 3 There are three types of polystyrene microspheres D1, 2, and 3, each with different intensities of APC fluorescence. One group D1 is modified with Escherichia coli DNAzyme fluorescent probe, D2 is modified with Staphylococcus aureus DNAzyme fluorescent probe, and D3 is not modified. The flow cytometer detection results after adding the Escherichia coli test sample.

[0138] Figure 4 There are three types of polystyrene microspheres D1, 2, and 3, each with different intensities of APC fluorescence. One group D1 is modified with Escherichia coli DNAzyme fluorescent probe, D2 is modified with Staphylococcus aureus DNAzyme fluorescent probe, and D3 is not modified. The flow cytometer detection result diagram after adding the samples containing Escherichia coli and Staphylococcus aureus to be tested is used to qualitatively detect the bacterial identification results. After drawing the standard curve based on the standard, the bacterial concentration can be quantitatively detected.

[0139] for Figure 3 and Figure 4 , FAM-H refers to the fluorescence intensity of FAM, and APC-H refers to the fluorescence intensity of APC.

[0140] Through the above implementation scheme, the present invention provides an efficient, sensitive and specific bacterial multiple identification and quantitative detection method, which can realize the simultaneous detection of multiple bacteria in a short time, overcoming the shortcomings of traditional methods in terms of time and operational complexity. The advantages of this invention include at least: (1) high throughput, currently there are 38 kinds of microspheres of the same type available for use, and more can be developed in the future; (2) simple early probe labeling, the probe itself has both primary antibody recognition and secondary antibody fluorescence functions, and no antibody sandwich method is required; (3) clinical fit, direct use of clinical flow cytometer, design and invent new multiple identification and detection methods based on flow detection ideas. The intuitiveness and simplified operation process of this method give it a wide range of application prospects in clinical and on-site testing.

[0141] Details not disclosed in the embodiments of the present application may be understood by referring to the description of the aforementioned embodiments.

[0142] The above are only preferred embodiments of the present application and are not intended to limit the protection scope of the present application.

[0143] It should be noted that, in this application, the terms "include", "comprises" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "includes a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0144] The serial numbers of the above-mentioned embodiments of the present application are for description only and do not represent the advantages or disadvantages of the embodiments.

[0145] The methods disclosed in several method embodiments provided in this application can be arbitrarily combined without conflict to obtain new method embodiments.

[0146] The features disclosed in several product embodiments provided in this application can be arbitrarily combined without conflict to obtain new product embodiments.

[0147] The features disclosed in several method or device embodiments provided in this application can be arbitrarily combined without conflict to obtain new method embodiments or device embodiments.

[0148] The above is only a specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any person skilled in the art who is familiar with the present technical field can easily think of changes or substitutions within the technical scope disclosed in the present application, which should be included in the protection scope of the present application. Therefore, the protection scope of the present application should be based on the protection scope of the claims.

Claims

1. A method for multiple identification and quantitative detection of bacteria based on functional nucleic acids, characterized in that: The method comprises: Step S1: providing multiple groups of polystyrene microspheres labeled with fluorescein and multiple bacteria-specific nucleic acid probes; Step S2: mixing a group of the polystyrene microspheres with a bacteria-specific nucleic acid probe so that the polystyrene microspheres and the bacteria-specific nucleic acid probe are connected to form fluorescent detection microspheres, and mixing the generated multiple groups of fluorescent detection microspheres to form a detection reagent; Step S3: providing a sample to be tested, mixing the sample to be tested with the detection reagent to react, and obtaining a solution to be tested; Step S4: performing fluorescence detection on the solution to be tested by flow cytometry to determine the types of bacteria contained in the sample to be tested and the concentration of each bacteria; The polystyrene microspheres are modified with APC fluorescein, and the APC fluorescein intensities of different groups of polystyrene microspheres are different. The bacteria-specific nucleic acid probe is modified with FAM fluorescein.

2. The method according to claim 1, characterized in that: For Escherichia coli, the bacteria-specific nucleic acid probe includes the following two deoxynucleotide chains: EC5:GATGTGCGTCTTGATCGAGACCTGCGT; Fs5: ACTCTCCTAGCTaTGGTTCGATCAAGA; Among them, for Fs5, the fluorescent group (6FAM) and the quenching group (Dabcyld) are respectively connected to the two Ts in the middle of the base.

3. The method according to claim 1, characterized in that For Staphylococcus aureus, the bacteria-specific nucleic acid probe includes the following two deoxynucleotide chains: SA6: ATGCCATCCTACCAACCACGAAGTACATTTCAAACTCATAAC AATCCATCGGTTAGGTCCTGGTTGG; Fs6: CTGGATGATCCTATGAACTGACTaTGACCTCACTACCAAG; Among them, for Fs6, the fluorescent group (6FAM) and the quenching group (Dabcyld) are respectively connected to the two Ts in the middle of the base.

4. The method according to claim 2 or 3, characterized in that: If the corresponding bacteria exist in the sample to be tested, the quenching group is cleaved off to generate fluorescence, and the fluorescence intensity is related to the intensity of the fluorescent substance on the connected polystyrene microsphere.

5. The method according to claim 4, characterized in that Step S2 specifically includes: S21: dissolving the bacteria-specific nucleic acid probe in a binding buffer to obtain a functional nucleic acid probe solution; S22: adding the polystyrene microspheres labeled with fluorescein to the functional nucleic acid probe solution, shaking at room temperature to mix evenly, subjecting the obtained solution to magnetic separation or centrifugation, discarding the supernatant and retaining the precipitate; S23: washing the precipitate with a washing buffer, and then resuspending the precipitate with a reaction buffer to form a fluorescent detection microsphere solution; The polystyrene microspheres are modified with streptavidin, the nucleic acid chain end of the bacteria-specific nucleic acid probe is modified with biotin, the binding buffer is a phosphate buffer containing bovine serum albumin BSA, the washing buffer is a phosphate buffer containing polysorbate tween-20, and the reaction buffer is a phosphate buffer containing MgCl2.

6. The method according to claim 5, characterized in that The step S3 specifically includes: S31: dissolving the sample to be tested in a bacterial lysis solution, and shaking to obtain a lysis solution to be tested; S32: adding the lysate to be tested to the detection reagent, shaking at room temperature to mix evenly, subjecting the resulting solution to magnetic separation or centrifugation, discarding the supernatant and retaining the precipitate; S33: washing the precipitate with a washing buffer, and then resuspending the precipitate with the washing buffer to obtain the solution to be detected.

7. The method according to claim 6, characterized in that The step S4 specifically includes: S41: using a flow cytometer to detect the solution to be detected, selecting the APC / FAM channel, and recording the fluorescence intensity; S42: Differentiate the types of detected bacteria according to the APC fluorescence of different intensities marked on the polystyrene microspheres, and quantitatively detect the bacterial concentration according to the FAM fluorescence marked on the bacteria-specific nucleic acid probe.

8. The method according to claim 6, characterized in that The method further comprises: Providing standard strains of different concentrations, mixing the standard strains with the detection reagent to react, and performing fluorescence detection on the standard strains after the reaction by flow cytometry, and formulating a standard curve according to the standard strains of different concentrations and the corresponding fluorescence intensities; Wherein, step S42 uses the standard curve to determine the bacterial species and bacterial concentration in the sample to be tested.

9. A bacterial multiple identification and quantitative detection reagent based on functional nucleic acid, characterized in that: The detection reagent comprises: (a) a plurality of groups of bacteria-specific nucleic acid probes; different groups of bacteria-specific nucleic acid probes are different to detect different bacteria; (b) Several groups of polystyrene microspheres labeled with fluorescein; different groups of polystyrene microspheres have different fluorescein intensities to produce fluorescence of different intensities.

10. The method according to claim 1, characterized in that The detection reagent also includes: (c) bacterial lysate; (d) a binding buffer, wherein the binding buffer is a phosphate buffer containing bovine serum albumin (BSA); (e) a washing buffer, wherein the washing buffer is a phosphate buffer containing tween-20; (f) a reaction buffer, wherein the reaction buffer is a phosphate buffer containing MgCl2.

Images