Primer group for goat mycoplasma detection and detection method thereof

Abstract

The TaqMan fluorescent quantitative PCR method for detecting the mycoplasma capricolum provided by the invention has very high specificity, sensitivity and stability, can be used for screening and detecting positive samples of the mycoplasma capricolum in various clinical samples, and has the characteristics of simplicity and convenience in operation, short detection period and high detection efficiency.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a primer set for detecting goat mycoplasma and a detection method thereof. Background Art

[0002] Mycoplasma capricolum subsp. Capripneumoniae (Mccp) belongs to the filamentous mycoplasma cluster and can cause goat contagious caprine pleuropneumonia (CCPP) pathogens. It was first isolated by Kenyan scholars MacOwan and others, and then successively isolated in Chad, Eritrea, Ethiopia, Niger, Oman, Sudan, Tanzania, Tunisia, Turkey, Uganda, and the United Arab Emirates. In 2007, Chinese scholars Xin Jiuqing and others isolated Mccp from goat pneumonia samples for the first time and confirmed it as the pathogen of CCPP. However, the isolation and culture of Mccp is very difficult, and other mycoplasmas in the samples, such as Mycoplasma ovis pneumonia (MO), grow rapidly, which often masks the growth of Mccp, thus mistakenly believing that MO is the main pathogen of CCPP. Mccp, as one of the main members of the Mycoplasma myciodes cluster, has very similar biochemical and serological properties to other Mycoplasma myciodes cluster members (MmmSC, MmmLC, Mmc, Mcc and ML), and these mycoplasmas can cause goats to have symptoms similar to CCPP. Therefore, it is easy to confuse CCPP with diseases caused by other mycoplasmas, or to mistakenly classify goat respiratory diseases caused by Mmc / MmmLC as CCPP. Therefore, rapid detection of Mycoplasma capricoposterior pneumonia subspecies is extremely important.

[0003] In the prior art, because the liquid culture of mycoplasma is completely transparent and presents a clear and transparent red color, it is impossible to count it by turbidimetry. Since mycoplasma solid culture is very difficult, it is not easy to count it by CFU method. Therefore, a special counting method is needed, namely color change unit method (CCU method). CCU method is a common indicator for measuring viable titer in mycoplasma culture, which can directly reflect the number of viable bacteria of bacteria through the color change of culture medium. This method has a strong correlation with bacterial content and protein concentration. However, the CCU method has a long detection cycle, is time-consuming and labor-intensive, and can also cause identification and counting errors. It is easy to be contaminated during the experiment, and there are problems such as unstable results and volatility in counting. Therefore, it is particularly important to establish a TaqMan probe real-time fluorescence quantitative PCR method for specific, sensitive and rapid detection of Mccp.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The present invention aims to provide a primer set, a detection method and application of TaqMan fluorescent quantitative PCR (qPCR) for detecting mycoplasma caprae.

[0006] In order to achieve the above object, according to one aspect of the present invention, a primer set for detecting Mycoplasma capricolum TaqMan fluorescent quantitative PCR is provided, wherein the primer combination is a first combination or a second combination;

[0007] The upstream primer sequence in the first combination is shown in SEQ ID NO.4, the downstream primer sequence is shown in SEQ ID NO.5; the probe sequence is shown in SEQ ID NO.8;

[0008] The upstream primer sequence in the second combination is shown in SEQ ID NO.6, the downstream primer sequence is shown in SEQ ID NO.7; the probe sequence is shown in SEQ ID NO.8;

[0009] Preferably, the primer combination is a first combination.

[0010] Furthermore, the 5' end of the probe sequence is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0011] Furthermore, the fluorescent reporter group includes a FAM group, a CY5 group or a HEX group, and the fluorescent quencher group is a TAMRA group, a BHQ1 group or a BHQ2 group.

[0012] Preferably, the fluorescent reporter group is a CY5 group, and the fluorescent quencher group is a BHQ2 group.

[0013] According to another aspect of the present invention, a method for detecting goat mycoplasma for purposes other than disease diagnosis and treatment is provided, wherein a qPCR reaction system including the above-mentioned detection primer set is used to amplify and detect a sample containing goat mycoplasma.

[0014] The detection method has good specificity and sensitivity for goat mycoplasma and can perform qualitative and / or quantitative detection of the number of live bacteria and total protein content of goat mycoplasma.

[0015] The specific qualitative evaluation process is as follows:

[0016] In qualitative detection, a PCR reaction system including the above primer-probe combination is used to amplify and detect samples that may contain goat mycoplasma. When the test sample has a CT value, the test result is positive, and it can be determined that the sample contains goat mycoplasma; when the test sample has no CT value, the test result is negative, and it can be determined that the sample does not contain goat mycoplasma.

[0017] The method can quantify the number of viable bacteria in the sample to be tested, and the specific method steps are: a) using a standard of known concentration for gradient dilution to obtain standard solutions of multiple concentrations, using the above-mentioned qPCR reaction system and reaction program to amplify the standard solutions of each concentration and draw a standard curve; b) according to the established standard curve, calculating the copy number of the sample to be tested; c) substituting the copy number into the regression equation, lgCFU=0.1957×lgcopy+7.2931, to calculate the number of viable bacteria in the sample.

[0018] The method can also quantify the total protein amount in the sample to be tested, and the specific method steps are: a) using a standard of known concentration for gradient dilution to obtain standard solutions of multiple concentrations, using the above-mentioned qPCR reaction system and reaction program to amplify the standard solutions of each concentration and draw a standard curve; b) according to the established standard curve, calculate the copy number of the sample to be tested; c) substituting the copy number into the regression equation, total protein amount = 32.605×lgcopy-293.4, and calculating the total protein amount of the sample.

[0019] In the above method steps, the gradient dilution of the standard sample adopts a 10-fold gradient dilution; the "lgcopy" in the regression equation is the logarithm of the copy number of the sample to be tested.

[0020] In some optional embodiments, the working concentration of the upstream primer is 0.12 to 0.36 μM, preferably 0.20 μM;

[0021] The working concentration of the downstream primer is 0.12-0.36 μM, preferably 0.20 μM;

[0022] The working concentration of the probe is 0.06-0.22 μM, preferably 0.10 μM.

[0023] It should be noted that, in the present invention, the working concentrations of primers and probes refer to the concentrations of primers and probes in the amplification reaction system.

[0024] In the present invention, the primer pairs and probe concentrations in the real-time fluorescence quantitative PCR reaction system are further optimized and adjusted, which is more conducive to the PCR reaction.

[0025] Preferably, the qPCR reaction system further comprises Premix Ex Taq, a DNA template and deionized water.

[0026] Furthermore, the qPCR amplification reaction program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 10 s; annealing at 57.7-63.9°C for 30 s; extension at 72°C for 20 s, with a cycle number of 35-45.

[0027] Preferably, the amplification reaction program is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 10 s; annealing at 60.2°C for 30 s; extension at 72°C for 20 s, and the number of cycles is 40.

[0028] According to another aspect of the present invention, a kit for detecting goat mycoplasma is provided, the kit comprising: a qPCR reaction system containing the above-mentioned detection primer set.

[0029] Furthermore, the kit also includes a positive control substance and / or a negative control substance.

[0030] Preferably, the positive control substance is a recombinant plasmid containing a caprine mycoplasma gene, and the negative control substance is deionized water.

[0031] According to another aspect of the present invention, there is provided use of the above-mentioned kit for detecting goat mycoplasma.

[0032] Beneficial effects of the present invention:

[0033] (1) The primers and probes of the present invention have good specificity and sensitivity to caprine mycoplasma and can effectively detect caprine mycoplasma.

[0034] (2) The detection method of the present invention can perform qualitative and quantitative detection of goat mycoplasma; the presence or absence of CT value of the sample to be tested can be used to determine whether the sample contains goat mycoplasma; at the same time, the number of viable bacteria and the total protein content in the sample to be tested can be calculated according to the regression equation.

[0035] (3) The detection method of the present invention has good specificity, repeatability and stability, a minimum detection limit of 12.5 copies / μL, high sensitivity, short detection cycle, accurate quantitative detection of viable counts and total protein, and can effectively solve the problems of long detection cycle, low detection efficiency and inaccurate detection results of existing quantitative bacterial concentration methods (CCU method and CFU method) of caprine mycoplasma. The method established by the present invention is of great significance for the rapid quantitative detection of caprine mycoplasma culture and vaccine semi-finished products. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0037] Figure 1The results of primers (SEQ ID NO.1, SEQ ID NO.2) detecting the amplification of Mccp bacterial solution. 1 to 6 in the figure are 6 repetitions of the same sample;

[0038] Figure 2 The results of amplification of the recombinant plasmid PUC57-MccG_0012 detected by primers (SEQ ID NO.6, SEQ ID NO.5), 1 to 4 in the figure are 4 repetitions of the same sample;

[0039] Figure 3 1 is the amplification curve of the four primer-probe combinations in Example 1 when detecting the same PUC57-MccG_0012 sample;

[0040] Figure 4 1×10 in Example 5 9 ~1×10 1 Amplification curves of the concentration gradient standard of copies / μL, A and B are the amplification curves of the first and second groups respectively;

[0041] Figure 5 1-2 are the amplification curves of different pathogens in Example 8, wherein 1-2 are Mycoplasma capricolum 87001 strain, 3-14 are the amplification curves of Mycoplasma capricolum subspecies, Mycoplasma ovipneumoniae Y98, Mycoplasma mycoides subspecies capricolum PG3, Mycoplasma agalactiae PG2, Mycoplasma bovis, Mycoplasma hyopneumoniae, Mycoplasma hyorhinis, Escherichia coli, Pasteurella mitis, Mannheimia spp., Haemophilus parasuis HPS, Staphylococcus aureus, etc.;

[0042] Figure 6 The results of the conventional PCR method in Example 9 on 58 clinical samples.

[0043] Figure 7 There is a linear correlation between the total protein content and the number of viable bacteria of goat mycoplasma. DETAILED DESCRIPTION

[0044] The embodiments of the present invention will be described in detail below in conjunction with the embodiments and examples, but it will be appreciated by those skilled in the art that the following embodiments and examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. If specific conditions are not specified, proceed according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0045] The main reagents and their manufacturers used in the following examples are shown in Table 1:

[0046] Table 1 Main reagents and their manufacturers

[0047]

[0048] The present invention is further described below by means of specific examples and comparative examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0049] Example 1 Screening of primers and probes

[0050] The MccG_0012 gene belongs to the RpiR transcriptional regulatory factor. The RpiR family members include GlaR (formerly known as YugA), ClaR (formerly known as YebF), GntR, YecA, YfeA, YidA, YljC and YleF. Its members are involved in the metabolism of different carbon sources as regulatory factors. Therefore, the MccG_0012 gene sequence was downloaded from NCBI (accession number CP006959.1, 10591-11412) for sequence alignment, primer probe design (see Table 2), and recombinant plasmid construction. According to the alignment results, the target sequence was selected and sent to Beijing Bomed Company to synthesize the recombinant plasmid PUC57-MccG_0012.

[0051] The primer sequence of the Mycoplasma capricolum MccG_0012 gene is:

[0052] MccG_0012-F:5'-AATATTACCTTTTTAGCATCCAT-3'(SEQ ID NO.1)

[0053] MccG_0012-R:5'-TTAAAACTTTAAAGATCGATTAA-3'(SEQ ID NO.2)

[0054] A primer pair for constructing the standard plasmid PUC57-MccG_0012 was constructed, and the primer sequences were MccG_0012-F2 (SEQ ID NO.6) and MccG_0012-R1 (SEQ ID NO.5).

[0055] The sequence of the standard plasmid PUC57-MccG_0012 is shown in SEQ ID NO.3:

[0056] ATGGATGCTAAAAAGGTAATATTTAAACTTGATCAACTAGCAAAAGAGCGTGGCACAACAATTGGAAATATTAGTAAAGTTATTTTAAATAATTTAGAACTTATTACTAATTTAACAATTTATAAAGTTGCTGATCTTTGTTTTGTTTCTCCTTCAACAATCACTAGGGTTTGTCAAAAATATTTAGATATTTCTGGATT TAGTGAATTACAAATTTTAATAAGAGTATATTTAAATGAACAAGAAAAACAAGACAAAGATGAAAAAGAAGGTAAAAAAATTTCTAAATTTACTGAAATTAAAGATGCTATTAATGTTACTGATGCATTAATTGATATTGCTGAGGTTGATAAAATAGTTAGAACTCTTTATAGTACTAAAACTGTTGCCCTAATTTCTT

[0057] Table 2 Primer information

[0058]

[0059] Reaction system: Premix Ex Taq 12.5μL, upstream and downstream primers 0.5μL each, probe 0.25μL, DNA template 2μL, add deionized water to the total reaction system of 25μL. Reaction program: 95℃2min; 95℃10s, 60℃30s, 72℃20s, 40 cycles.

[0060] Table 3 CT values ​​of primer-probe combinations

[0061]

[0062] The above primers and probes were combined and the CT values ​​of each combination were compared. The results are shown in Table 3 and Figures 1 to 3 Among them, the fluorescence intensity of the first combination was the highest and the CT value was the lowest, which was 11.26, indicating that its specificity and sensitivity had obvious advantages; the CT value of the second combination was less than 20, which was slightly different from the first combination and was also a better primer set.

[0063] Example 2 Optimal Tm value screening

[0064] This example is to screen the optimal annealing temperature, select the optimal primer-probe combination (first combination) in Example 1, and select the Tm value with a lower CT value from the range of 55°C to 65°C. The reaction system is as follows: Premix Ex Taq 12.5μL, 0.5μL of upstream and downstream primers, 0.25μL of probe, 2μL of DNA template, and add deionized water to a total reaction system of 25μL. The reaction procedure is as follows: 95℃2min; 95℃10s, Tm (55℃~65℃)30s, 72℃20s, 40 cycles.

[0065] It was found during the experiment that when the cycle number was 35-45, it could be used for the detection of goat mycoplasma in the present invention, and when the cycle number was 40, the amplification reached a plateau, so 40 cycles were preferred in the present invention.

[0066] Table 4 CT values ​​corresponding to each Tm value

[0067]

[0068]

[0069] It can be seen from Table 4 that the lowest CT value is 15.19, and its corresponding Tm value is 60.2°C, so it can be determined that the optimal Tm value is 60.2°C. The CT value of 57.7-63.9°C Tm value is slightly different from the optimal Tm value and can also be used for goat mycoplasma detection.

[0070] Example 3 Screening of the optimal amount of primers added

[0071] The optimal primer set (first combination) in Example 1 was selected to screen the optimal amount of primer addition. In this embodiment, the concentrations of the upstream primer solution and the downstream primer solution were both 10 μmol / L, the screening volume range was 0.1 to 1.5 μL, and a combination with a lower CT value was selected. Reaction system: Premix Ex Taq 12.5 μL, primers 0.1 to 1.5 μL, probes 0.20 μL, DNA templates 2 μL, deionized water was added to a total reaction system of 25 μL. Reaction procedure: 95°C pre-denaturation for 2 min; 95°C denaturation for 10 s, 60°C annealing for 30 s, 72°C extension for 20 s, 40 cycles. The contents of the upstream primer and the downstream primer and their corresponding CT values ​​are shown in Table 5.

[0072] Table 5 The amount of primers added and their corresponding CT values

[0073]

[0074] It can be seen that the lowest CT value is 17.53, and the corresponding primer addition amount is 0.5μL / each (i.e. 0.20μM). Therefore, the optimal addition amount of the upstream primer and the downstream primer in the qPCR reaction system is 0.5μL / each (i.e. 0.20μM). The difference between the primer addition amount of 0.3-0.9μL / each (i.e. 0.12-0.36μM) and the optimal addition amount is small, and it can also be used for goat mycoplasma detection.

[0075] Example 4 Screening of the Optimal Addition Amount of Probe

[0076] The optimal primer set (first combination) in Example 1 was selected to screen the optimal amount of probe addition. The concentration of the probe solution in this embodiment was 10 μmol / L, the screening volume range was 0.0-1.0 μL, and a combination with a lower CT value was selected. The reaction system is as follows: Premix Ex Taq 12.5 μL, 0.5 μL of upstream and downstream primers, 0.05-0.95 μL of probe, 2 μL of DNA template, and deionized water was added to a total reaction system of 25 μL. The reaction procedure is as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 20 s, and 40 cycles. The contents of the probes and their corresponding CT values ​​are shown in Table 6.

[0077] Table 6 Probe addition amount and its corresponding CT value

[0078]

[0079] It can be seen that the lowest CT value is 16.98, and the corresponding probe addition amount is 0.25μL (i.e. 0.10μM). Therefore, the optimal probe addition amount in the qPCR reaction system is 0.25μL (i.e. 0.10μM). The difference between the probe addition amount of 0.15-0.55μL (i.e. 0.06-0.22μM) and the optimal addition amount is small, and it can also be used for goat mycoplasma detection.

[0080] Example 5 Linear Range Verification

[0081] In this example, eight groups of concentration gradient standard PUC57-MccG_0012 were diluted 10 times for amplification, and the results were repeated 4 times to verify whether the linear relationship between the amplification concentration and the CT value and the amplification efficiency met the requirements, as shown in Table 7 and Figure 4 As shown:

[0082] Table 7 Linear relationship verification results

[0083]

[0084]

[0085] Through Table 7 and Figure 4 It can be seen that the standard curve R of each group of standards 2 All of them are greater than 0.99, indicating that the linear relationship of each group meets the requirements. At the same time, the amplification efficiency E of each group reaches more than 95%, indicating that the amplification efficiency also meets the requirements. In addition, the experimental results of this embodiment also show that when the concentration of the standard is reduced to 10 copies / μL, each group cannot be detected.

[0086] Example 6 Minimum Detection Limit Verification

[0087] Use plasmid dilution to add 1×10 2 The copies / μL standard was diluted 2-fold, and each concentration was repeated 20 times. The positive test results for more than 19 times were defined as the minimum detection limit of the method. Therefore, based on Example 5, this example specifically set the concentrations of 25 copies / μL, 12.5 copies / μL, and 6.25 copies / μL to further determine the specific detection limit. The CT values ​​of each experimental group are shown in Table 8.

[0088] Table 8 Minimum detection limit verification results

[0089]

[0090] The results of the minimum detection limits of the primer sets of the first combination, the second combination, and the third combination are shown in Table 8, wherein the primer sets of the first combination and the second combination can detect CT values ​​at 25 copies / μL and 12.5 copies / μL, and 13 and 19 sets respectively cannot detect CT values ​​at 6.25 copies / μL. Therefore, it can be determined that the minimum detection limit of the present invention is 12.5 copies / μL.

[0091] Example 7 Repeatability Verification

[0092] Select standard (1×10 9 ~1×10 3 The results of the first combination of primers and the second combination of primers are shown in Table 9. The CV values ​​of each standard product within and between groups are less than 5%, indicating that the repeatability and stability of this method are good.

[0093] Table 9 Repeatability verification results

[0094]

[0095] Example 8 Specificity Verification

[0096] This example uses a variety of common pathogens to verify the specificity of the method of the present invention. The pathogens used are: Mycoplasma capricolum 87001, Mycoplasma capricolum subspecies, Mycoplasma ovipneumoniae Y98, Mycoplasma mycoides subspecies capricolum PG3, Mycoplasma agalactiae PG2, Mycoplasma bovis, Mycoplasma hyopneumoniae, Mycoplasma hyorhinis, Escherichia coli, Pasteurella mitis, Mannheimia, Haemophilus parasuis HPS, and Staphylococcus aureus. The CT values ​​detected by each pathogen solution are shown in Table 10, and the specific detection results are shown in Table 10. Figure 5 shown.

[0097] Table 10 Pathogen solutions and their CT values

[0098]

[0099] Table 10 and Figure 5 It can be seen that, using the detection method of the present invention, the first combination and the second combination of primer sets only have fluorescence amplification signals for detecting capric mycoplasma 87001 strain, and no CT values ​​are detected for other pathogens, indicating that the two primer sets screened by the present invention have good specificity for detecting capric mycoplasma.

[0100] Example 9 Fluorescence quantitative PCR and live bacteria linearity verification

[0101] 9.1 Linear establishment

[0102] Take the goat mycoplasma bacterial liquid harvested at different times, set 3 parallel samples for each sample to be tested, and extract the genome. And use the 10-fold gradient dilution of the standard plasmid as a template to perform fluorescent quantitative PCR, and calculate the copy number of the sample to be tested according to the established standard curve; take the bacterial liquid of each sample to be tested for CFU viable bacteria count, and calculate the viable bacteria count of the sample to be tested according to the dilution and the plate viable bacteria. The viable bacteria count of the goat mycoplasma culture harvested at different times and the results of the fluorescent quantitative PCR method are shown in Table 11.

[0103] Table 11 Results of viable bacterial count and fluorescence quantitative PCR detection of Mycoplasma ovipneumoniae

[0104]

[0105]

[0106] It can be seen from Table 11 that the results of the CFU method and the fluorescence quantitative PCR method for the detection of goat mycoplasma have a very significant linear correlation (R 2 =0.9531), and the regression equation between the two was established as lgCFU=0.1957×lgcopy+7.2931.

[0107] 9.2 Linear Verification

[0108] Twelve cultures of Mycoplasma capricolum harvested at 4 different times (16, 20, and 24 hours) were obtained, and fluorescent quantitative PCR and viable bacteria counts were performed according to step 9.1 of Example 9. The viable bacteria counts and fluorescent quantitative PCR test results of Mycoplasma capricolum cultures harvested from different batches are shown in Table 12.

[0109] Table 12 Repeated verification of linear relationship

[0110]

[0111] It can be seen from Table 12 that the theoretical value and the actual value of lgCFU / mL are not significantly different (P>0.05). This shows that the method of the present invention can be used for rapid quantitative detection of goat mycoplasma culture and vaccine semi-finished products.

[0112] 9.3 Verification of detection rate of clinical samples

[0113] The real-time fluorescence quantitative PCR, conventional PCR (i.e., amplification using the same primers as those of the present invention, followed by gel electrophoresis to detect the amplified product) and separation and culture methods established in this study were used to test 58 clinical samples. The results are shown in Tables 13 and Figure 6 shown.

[0114] Table 13 Results of conventional PCR and real-time fluorescence quantitative PCR detection of clinical samples

[0115]

[0116] pass Figure 6 As can be seen from Table 13, the positive rate of fluorescent quantitative PCR detection results was 89.66% (52 / 58, CT value between 15 and 20), the positive rate of common PCR detection results was 51.72% (30 / 58), and the positive rate of traditional isolation and culture was 5.17% (3 / 58). This shows that fluorescent quantitative PCR can not only significantly improve the detection rate of goat mycoplasma, but also quantify the number of viable bacteria.

[0117] Example 10 Fluorescence quantitative PCR and total protein linearity verification

[0118] 10.1 Linear Establishment

[0119] Take the Mycoplasma capricolum bacterial solution harvested at different times, and set 3 parallel samples for each sample to be tested. Fluorescence quantitative PCR is performed according to the steps described in 9.1 of Example 9; take 1 ml of the bacterial solution of each sample to be tested, centrifuge at 12000 r / min for 30 min, discard the supernatant, draw an equal volume of buffer solution to blow the precipitate to suspend and mix, centrifuge at 12000 r / min for 30 min, wash twice in the same way, discard the supernatant after centrifugation, suspend the precipitate with 1 ml of buffer solution, and finally use the BCA protein quantitative analysis kit to determine the total protein amount at the corresponding time point. The total protein amount of the Mycoplasma capricolum culture harvested at different times and the results of the fluorescence quantitative PCR method are shown in Table 14.

[0120] Table 14 Results of total protein and fluorescence quantitative PCR detection of Mycoplasma ovipneumoniae

[0121]

[0122] It can be seen from Table 14 that the total protein content of goat mycoplasma has a very significant linear correlation with the detection results of fluorescent quantitative PCR (R 2 =0.9666), and the regression equation between the two was established as total protein amount = 32.605 × lgcopy-293.4.

[0123] 10.2 Linear Validation

[0124] Twelve cultures of Mycoplasma capricolum harvested from 5 batches at different times (16, 20, and 24 hours) were obtained, and fluorescence quantitative PCR and total protein detection were performed according to step 10.1 in Example 10. The total protein amount of Mycoplasma capricolum cultures harvested from different batches and the results of fluorescence quantitative PCR detection are shown in Table 15.

[0125] Table 15 Repeated verification of linear relationship

[0126]

[0127] It can be seen from Table 15 that there is no significant difference between the theoretical value and the actual value of total protein (P>0.05). Figure 7 It can be seen that the review of the data found that the number of viable bacteria and the total protein content also showed a linear correlation (R 2 =0.9362, and the regression equation is total protein amount=136.14×1gCFU-1215.4). This shows that the established fluorescence quantitative PCR method can be used for the rapid quantitative detection of total protein amount in goat Mycoplasma culture and vaccine semi-finished products.

[0128] In summary, the method established by the present invention can realize the qualitative and quantitative detection of Mycoplasma ovipneumoniae, and can effectively solve the problems of the existing quantitative bacterial concentration methods (CCU method and CFU method) of Mycoplasma goatii, such as long detection cycle, cumbersome detection steps, and only relying on naked eye observation when judging the results, without sufficient reliable basis, which affects the accuracy of the experiment.

[0129] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A detection primer set for detecting goat mycoplasma, characterized in that: The primer-probe combination is a first combination or a second combination; The upstream primer sequence in the first combination is shown in SEQ ID NO.4, the downstream primer sequence is shown in SEQ ID NO.5; the probe sequence is shown in SEQ ID NO.8; The upstream primer sequence in the second combination is shown in SEQ ID NO.6, the downstream primer sequence is shown in SEQ ID NO.7; the probe sequence is shown in SEQ ID NO.8; Preferably, the primer-probe combination is a first combination.

2. The detection primer set according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; preferably, the fluorescent reporter group is a FAM group, a CY5 group or a HEX group, and the fluorescent quencher group is a TAMRA group, a BHQ1 group or a BHQ2 group; more preferably, the fluorescent reporter group is a CY5 group, and the fluorescent quencher group is a BHQ2 group.

3. A method for detecting Mycoplasma caprae, characterized in that: A qPCR reaction system comprising the primer set described in claim 1 or 2 is used to amplify and detect a sample containing caprine mycoplasma.

4. The detection method according to claim 3, characterized in that: The reaction procedure for amplification using the qPCR reaction system is 95°C pre-denaturation for 2 min; 95°C denaturation for 10 s; 57.7-63.9°C annealing for 10 s; 72°C extension for 20 s, with a cycle number of 35-45; Preferably, the reaction procedure for amplification in the qPCR reaction system is pre-denaturation at 95°C for 2 min; denaturation at 95°C for 10 s; annealing at 60.2°C for 10 s; extension at 72°C for 20 s, with 40 cycles.

5. The detection method according to claim 3, characterized in that: The working concentration of the upstream primer is 0.12-0.36 μM, preferably 0.20 μM; The working concentration of the downstream primer is 0.12-0.36 μM, preferably 0.20 μM; The working concentration of the probe is 0.06-0.22 μM, preferably 0.10 μM.

6. A fluorescent quantitative PCR kit comprising the primer set for detecting caprine mycoplasma according to claim 1.

7. The kit according to claim 6, characterized in that: The kit also includes a positive control substance and / or a negative control substance; preferably, the positive control substance is a recombinant plasmid containing a caprine mycoplasma gene, and the negative control substance is deionized water.

8. Use of the kit according to claim 6 or 7 in detecting Mycoplasma caprae.

Images