Molecular marker related to strain Kosakonia oryzendophyta FY-07, primer and application of molecular marker related to strain Kosakonia oryzendophyta FY-07 and primer related to strain Kosakonia oryzendophyta FY-07

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to a molecular marker related to a strain FY-07, a primer and application. A molecular marker for identifying the strain FY-07 and a bacterial cellulose product synthesized by the strain FY-07 is developed and obtained, the nucleotide sequence of the molecular marker is shown as SEQ ID No.1, and an amplification primer group of the sequence is provided. The molecular marker and the primer group thereof have high specificity and sensitivity when being used for identifying the strain FY-07, and have important significance in protecting production strains, standardizing the market, preventing potential pathogenic substances from being mixed into bacterial cellulose products and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers, and in particular relates to a molecular marker, a primer and an application thereof related to strain FY-07. Background Art

[0002] Microbial exopolysaccharides are a type of polymer synthesized by microorganisms, which usually have the advantages of good biocompatibility, diverse properties, and degradability, so they are widely used. Bacterial cellulose, as a type of microbial exopolysaccharide, is essentially the same as plant cellulose, but in comparison, it has the advantages of high purity, high crystallinity, nano three-dimensional network structure, and high mechanical strength, so it can be widely used in food, cosmetics, papermaking, biomedical materials and other fields.

[0003] A variety of microorganisms can produce bacterial cellulose, such as Gluconacetobacter, Achromobacter, Aerobacter, Agrobacterium, Alcaligenes, Enterobacter, Pseudomonas, Rhizobium, Salmonella, Sarcina, etc., among which there are many potentially pathogenic bacteria. Therefore, it is very important to detect the production strains of bacterial cellulose products to protect the production strains, regulate the market, and prevent the mixing of potential pathogenic substances. The more commonly used microbiological detection method is the coating plate method, which can only be used to detect live bacteria, and this method has problems such as poor accuracy and stability, susceptibility to environmental factors, cumbersome steps, and long detection cycle. In addition, the bacterial cellulose industry is in its early stages of development, and there are no unified and recognized industry standards and related detection methods. Therefore, whether from the perspective of protecting production strains, regulating the market, or preventing potential pathogenic substances from mixing into bacterial cellulose products, it is very necessary to establish a method for quickly identifying production strains from bacterial cellulose products or solid and liquid in the fermentation process.

[0004] Strain FY-07 and strain DSM 15973 are existing strains for producing bacterial cellulose products. However, due to the high purity of bacterial cellulose itself, the components of bacterial cellulose produced by different genera after treatment are basically the same, and the performance is not much different. It is impossible to identify the source of the producing strain only by the structure and performance of the bacterial cellulose product. Therefore, a detection technology with low equipment requirements, good accuracy, low cost, high efficiency and fast detection is needed to achieve rapid identification of bacterial cellulose production strains. Summary of the invention

[0005] In view of the above technical problems, the present invention provides a molecular marker, primer and application related to strain FY-07.

[0006] The technical solution of the present invention is as follows: The present invention provides an application of a molecular marker in identifying a strain FY-07 or a bacterial cellulose product synthesized by the strain FY-07, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID No.1.

[0007] As an embodiment, the bacterial cellulose products include food, cosmetics, papermaking products, biopharmaceutical materials and intermediates of bacterial cellulose products.

[0008] As an embodiment, the intermediate product of the bacterial cellulose product includes seed liquid, fermentation liquid, boiled liquid, aerated liquid, and dried impregnation liquid.

[0009] The present invention also provides a primer set for identifying strain FY-07 or bacterial cellulose products synthesized by strain FY-07, the primer set comprising a forward primer and a reverse primer; the forward primer sequence is shown in SEQ ID No.2; the reverse primer sequence is shown in SEQ ID No.3.

[0010] The present invention also provides a kit comprising the primer set for identifying the strain FY-07 or the bacterial cellulose product synthesized by the strain FY-07.

[0011] As an embodiment, it also includes reagents for PCR amplification.

[0012] The present invention also provides an application of the primer set or the kit in identifying the strain FY-07 or the bacterial cellulose product synthesized by the strain FY-07.

[0013] The present invention also provides a method for identifying strain FY-07 or a bacterial cellulose product synthesized by strain FY-07, comprising the following steps: using the primer set or the kit to perform PCR amplification on the DNA of the strain to be tested or the bacterial cellulose product, and determining the strain type or the synthetic strain of the bacterial cellulose product according to the amplification product; if a 585 bp specific identification band appears in the amplification product, it is determined to be strain FY-07 or a bacterial cellulose product synthesized by strain FY-07.

[0014] As an embodiment, a 25 μL PCR amplification system is also included.

[0015] As an embodiment, the PCR reaction conditions are: pre-denaturation at 95°C for 10 min; 95°C: 30-45s, 50-60°C: 30-45s, 72°C: 45-60s, 35 cycles; extension at 72°C for 10 min.

[0016] Compared with the prior art, the present invention has the following beneficial effects: 1. The molecular marker and primer set of the present invention can identify strain FY-07 from bacterial species or bacterial cellulose products with strong specificity and high sensitivity.

[0017] 2. The identification method of the present invention is fast, accurate, requires less samples, has high efficiency, a wide range of applications, low equipment requirements, and low cost. It is of great significance for protecting production strains, regulating the market, and preventing potential pathogenic substances from mixing into bacterial cellulose products. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Comparison of bacterial cellulose production of wild-type strain FY-07 (left) and O9K67_04420 gene knockout strain (right), where the white flocs are bacterial cellulose; Figure 2 It is the amplification map of PCR products for molecular marker identification, wherein 3 and 15 are molecular weight markers, 1 is based on the genome of strain FY-07 as a template, 2 is based on sterile water as a template, 4 is based on the genome of seed liquid as a template, 5 is based on the genome of fermentation liquid as a template, 6 is based on the genome of liquid after boiling bacterial cellulose product as a template, 7 is based on the genome of liquid treated with alkali as a template, 8 is based on the genome of liquid after one aeration as a template, 9 is based on the genome of liquid after two aerations as a template, 10 is based on the genome of liquid after three aerations as a template, 11 is based on the genome of liquid after four aerations as a template, 12 is based on the genome of liquid after five aerations as a template, 13 is based on the genome of sample after six aeration treatments as a template, 14 is based on the genome of bacterial cellulose fermentation product soaking liquid after drying as a template, 16 is based on the genome of bacterial cellulose dry mask product as a template, and 17 is based on the genome of bacterial cellulose wet mask product as a template; Figure 3 The figure shows the specificity and sensitivity of molecular marker identification, where 2 is a molecular weight marker, 1 is using 10 ng / μL strain DSM 15973 genome as a template, 3 is using 10 ng / μL strain FY-07 genome as a template, 4 is using 1 ng / μL strain FY-07 genome as a template, 5 is using 0.1 ng / μL strain FY-07 genome as a template, 6 is using 0.01 ng / μL strain FY-07 genome as a template, 7 is using 0.001 ng / μL strain FY-07 genome as a template, and 8 is using 0.0001 ng / μL strain FY-07 genome as a template. DETAILED DESCRIPTION

[0019] The present invention provides an application of a molecular marker in identifying strain FY-07 or a bacterial cellulose product synthesized by strain FY-07. The deposit number of strain FY-07 is CGMCC No.6103, and its classification name is Kosakonia oryzendophytica, which has been disclosed in patent CN102690773A. The present invention knocks out the unknown functional gene O9K67_04420, causing the gene to lose its original function, and verifies that the O9K67_04420 gene is essential for the synthesis of bacterial cellulose in strain FY-07. Therefore, the O9K67_04420 gene and the partial sequences of the non-coding regions at both ends are selected as molecular markers, and the molecular marker nucleotide sequence is shown in SEQ ID No.1.

[0020] In the present invention, the bacterial cellulose products include food, cosmetics, papermaking products, biomedical materials and intermediates of bacterial cellulose products. In one embodiment, the food includes fermented bean products, fermented fruit and vegetable products, dietary fiber supplements and functional beverages; the cosmetics include bacterial cellulose facial masks and bacterial cellulose creams; the papermaking products include bacterial cellulose paper; the biomedical materials include bacterial cellulose tissue engineering scaffolds, bacterial cellulose wound dressings and bacterial cellulose drug sustained-release carriers; the intermediates of bacterial cellulose products include seed liquid, fermentation liquid, water-boiled liquid, aerated liquid and dried impregnation liquid.

[0021] The present invention also provides a primer set for identifying strain FY-07 or bacterial cellulose products synthesized by strain FY-07. In the present invention, the primer set includes a forward primer and a reverse primer; the sequence of the forward primer jd1 is shown in SEQ ID No.2; the sequence of the reverse primer jd2 is shown in SEQ ID No.3. In the present invention, the primers shown in SEQ ID No.2 and SEQ ID No.3 are designed based on the nucleotide sequence of the molecular marker shown in SEQ ID No.1 as a template.

[0022] The present invention also provides a kit comprising the above primer set for identifying strain FY-07 or bacterial cellulose products synthesized by strain FY-07. As an embodiment, the kit also includes a PCR amplification reagent. In one embodiment, the PCR amplification reagent is a DNA template, a primer set (jd1 / jd2), a premix Taq polymerase and water.

[0023] The present invention also provides a method for identifying strain FY-07 or a bacterial cellulose product synthesized by strain FY-07, comprising the following steps: using the above-mentioned primer set or the above-mentioned kit to perform PCR amplification on the DNA of the strain to be tested or the bacterial cellulose product, and determining the strain type or the synthetic strain of the bacterial cellulose product according to the amplification product, and if the amplification product has a 585bp specific identification band, it is determined to be strain FY-07 or a bacterial cellulose product synthesized by strain FY-07.

[0024] The present invention also includes a 25 μL PCR amplification system, in which the molar concentration of the primer set sequences shown in SEQ ID No. 2 and SEQ ID No. 3 is 15-30 μM. In one embodiment, the molar concentration of the primer set is 20 μM. In the present invention, the PCR amplification system also includes premix Taq polymerase. In the present invention, the PCR reaction system is: each 25 μL reaction solution contains a DNA template: 1 μL, a 20 μM primer set (jd1 / jd2): 1 μL each, a premix Taq polymerase: 12.5 μL, and water is added to 25 μL.

[0025] In the present invention, the PCR reaction conditions are: pre-denaturation at 95°C for 10 min; 95°C: 30-45s, 50-60°C: 30-45s, 72°C: 45-60s, 35 cycles; and extension at 72°C for 10 min.

[0026] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0027] The materials, reagents, etc. used in the following embodiments, unless otherwise specified, are all commercially available reagents, consumables, etc., and if specific conditions of use are not specified, they are usually carried out under conventional conditions or under conditions recommended by the company.

[0028] Example 1 Molecular markers and identification methods of bacterial cellulose synthesis strain FY-07 1. Molecular markers of bacterial cellulose-producing strain FY-07 The genome sequence of strain FY-07 was analyzed, and a unique gene of unknown function, O9K67_04420, was found in the bacterial cellulose operon on its genome. It was speculated that it might be related to the synthesis of bacterial cellulose. Therefore, gene knockout was performed to explore whether the DNA sequence was suitable for use as a molecular marker.

[0029] In the present invention, the O9K67_04420 gene in strain FY-07 is knocked out so that the gene loses its original function. The specific steps are as follows: (1) Extract the genome of strain FY-07 as a PCR template; (2) Using primer pair KO1U and KO1L (as shown in SEQ ID No. 4 and SEQ ID No. 5) and primer pair KO2U and KO2L (as shown in SEQ ID No. 6 and SEQ ID No. 7) to amplify the upstream and downstream homology arm fragments of O9K67_04420 using the FY-07 genome as a template; SEQ ID No.4: GGAAGCATAAAGTCTCGAGATAAATCGCACATCGATAGCGCCAAAC; SEQ ID No.5: ACGTTCACGGACTTCAAATTCACCGGACATTTTTAGTTTTCCAGC; SEQ ID No.6: GCTGGAAAACTAAAAATGTCCGGTGAATTTGAAGTCCGTGAACGT; SEQ ID No.7: AATTTTTTTAAGGCAGTTATTGGTGCGTGATATAGCCGACCCCAG.

[0030] (3) using primer pair pTSK2GU and pTSK2GL (as shown in SEQ ID No. 8 and SEQ ID No. 9) to perform PCR amplification with plasmid pTSK2 as a template to obtain a linearized pTSK2 vector, which has chloramphenicol resistance; SEQ ID No.8: CACCAATAACTGCCTTAAAAAAATT; SEQ ID No.9: GATTTATCTCGAGACTTTATGCTTCC.

[0031] (4) The DNA fragments obtained in step (2) and step (3) were mixed at a molar ratio of 3:1 and added to 10uL 2XMultiF Seamless Assembly Mix seamless cloning system, followed by reaction at 50°C for 1 hour; (5) Adding the reaction system to the S17 Escherichia coli competent cell solution for heat shock transformation, and screening the transformants on a chloramphenicol resistance plate; (6) The transformants obtained in step (5) are transferred to strain FY-07 by conjugation transfer, and the correct transformants are screened on plates containing chloramphenicol and ampicillin resistance. Strain FY-07 produces bacterial cellulose, which makes it difficult to be transformed normally. In the present invention, S17 Escherichia coli is used as a medium and conjugation transfer is used to complete the transformation; (7) The correct transformants obtained in step (6) were inoculated into LB liquid culture medium and cultured at 37°C overnight. 10uL of the bacterial solution was spread on a plate containing chloramphenicol and ampicillin resistance and cultured at 42°C until colonies appeared; (8) The colonies obtained in step (7) were amplified by colony PCR using primer pair KOY1U and KOY1L (as shown in SEQ ID No. 10 and SEQ ID No. 11) and primer pair KOY2U and KOY2L (as shown in SEQ ID No. 12 and SEQ ID No. 13), respectively, with the FY-07 genome as a template and a reference fragment. When the size of the fragment obtained by one of the two pairs of primers is smaller than the reference fragment and the difference is the size of the knockout fragment, it indicates that a single exchange has occurred; when the sizes of the fragments obtained by both pairs of primers are smaller than the reference fragment and the difference is the size of the knockout fragment, it indicates that a double exchange has occurred; SEQ ID No.10: TCTGGTCCGTCATAACTGATG; SEQ ID No.11: TACCCCGGCATAACAATGTT; SEQ ID No.12: CGGGGTCAGGCAAATACTAT; SEQ ID No.13: GCCGTCAGTTACGTTCAAA.

[0032] The colonies verified as single exchange were selected and transferred into LB liquid medium without resistance and cultured overnight at 30°C, and then transferred to new LB liquid medium with 1% inoculation volume for overnight culture; 2 μL of the obtained overnight culture was spread on an LB plate containing 10% sucrose and cultured at 42°C until colonies appeared; the obtained colonies were picked and PCR was performed using the KOY1U and KOY2L primer pairs, with the FY-07 genome as a template as the reference fragment. When the obtained fragment size was smaller than the reference fragment and the difference size was the size of the knockout fragment, it indicated that double exchange had occurred; (9) The double exchange colony obtained in step (8) was inoculated into LB liquid culture medium containing ampicillin resistance, cultured at 42°C and transferred 2 to 5 times to lose the plasmid. The resulting strain is the O9K67_04420 gene knockout strain.

[0033] The obtained O9K67_04420 gene knockout strain and the wild-type strain FY-07 were inoculated into LB liquid culture medium and cultured overnight at 30°C to observe the production of bacterial cellulose. Figure 1As shown, the O9K67_04420 gene knockout bacteria no longer produce any bacterial cellulose, while the wild-type strain FY-07 can produce a large amount of bacterial cellulose, which indicates that the O9K67_04420 gene is essential for the production of bacterial cellulose in strain FY-07. Therefore, this gene sequence is suitable as a molecular marker for rapid identification of bacterial cellulose products producing strain FY-07.

[0034] 2. Identification of strain FY-07 using molecular markers According to the genome sequence of strain FY-07 and the key genes for bacterial cellulose synthesis, the O9K67_04420 gene and the partial sequences of the non-coding regions at both ends were selected as molecular markers. The specific nucleotide sequence is shown in SEQ ID No. 1, and the total length is 585 bp. The upstream and downstream identification primer sets of the molecular marker sequence are jd1 / jd2, as shown in SEQ ID No. 2 and SEQ ID No. 3.

[0035] SEQ ID No.1: ; SEQ ID No.2: ATGTATGATGATTTAGGTTCTTTGG; SEQ ID No.3: GTTTGTATCATCTTGCACAGAAAATA.

[0036] The specific identification methods are as follows: (1) Extract the genome of strain FY-07 as a DNA template; (2) PCR amplification was performed using DNA as a template. The PCR reaction system was as follows: 1 μL DNA template, 1 μL of 20 μM primer set (jd1 / jd2), 12.5 μL of premix Taq polymerase, and water was added to 25 μL per 25 μL reaction solution. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 10 min, 35 cycles of 95°C for 30-45 s, 50-60°C for 30-45 s, and 72°C for 45-60 s. Extension at 72°C for 10 min. (3) The amplified product was detected by gel electrophoresis using a gel imager, and the target fragment was recovered from the gel to obtain the core conserved sequence, which was then sequenced and verified by a sequencing company. The sequencing result was consistent with the full-length 585bp sequence of the molecular marker, thus obtaining the molecular marker of strain FY-07.

[0037] The electrophoresis results are as follows Figure 2 As shown in lane 1, a clear single DNA band of 585 bp was obtained by using the FY-07 genome as a template for molecular marker detection, indicating that the molecular marker was detected. The results showed that the molecular marker can be used to identify strain FY-07.

[0038] Example 2 Sensitivity and specificity of molecular marker detection The sensitivity and specificity of molecular marker detection determine its application scenarios and scope, so the SEQ ID No.1 sequence was verified. Among them, strain DSM 15973, classified and named Komagataeibacter sucrofermentan, It has high efficiency in bacterial cellulose production. The specific method is as follows: (1) Extract the genomes of strain FY-07 and strain DSM 15973 as PCR templates and detect their DNA concentrations; (2) The concentrations of the genomic DNA of strain FY-07 and strain DSM 15973 were adjusted to 10 ng / μL. The 10 ng / μL genomic DNA of strain FY-07 was used as the stock solution for serial dilution until 0.0001 ng / μL. (3) Take 1uL of each gradient dilution FY-07 bacterial solution sample and 1μL of DSM 15973 bacterial solution as templates for PCR amplification. The PCR amplification system is as follows: each 25μL reaction solution contains 1μL of DNA template, 1μL of 20μM primer pair (jd1 / jd2), 12.5μL of premix Taq polymerase, and add water to 25μL; PCR reaction conditions are as follows: pre-denaturation at 95℃ for 10 min; 95℃: 30-45s, 50-60℃: 30-45s, 72℃: 45-60s, 35 cycles; extension at 72℃ for 10min; (4) Perform electrophoresis on the amplified products using a gel imaging instrument to observe whether each sample obtains a clear, single DNA band of 585 bp in size.

[0039] The electrophoresis results are as follows Figure 3 As shown in the figure, the first lane used the 10 ng / μL bacterial cellulose production strain DSM 15973 genome as a template, and no target band was obtained; the third lane used the 10 ng / μL FY-07 genome as a template, and a bright single target band was obtained, indicating that the molecular marker can specifically identify strain FY-07 and has high specificity. Lanes 3 to 8 used the genome of strain FY-07 diluted in various gradients as templates. When the dilution of the FY-07 genome template was lower than 0.01 ng / μL, no target band could be obtained, indicating that the template detection threshold of the molecular marker was 0.01 ng / μL, and the sensitivity was good.

[0040] Example 3 Detection of the process product of bacterial cellulose fermentation by strain FY-07 using molecular markers - seed liquid 1. Collect seed liquid: (1) Streak the bacterial broth of bacterial cellulose-producing strain FY-07 onto LB solid medium containing 0.1% Congo red and culture at 30°C for 24 h to obtain a single colony of FY-07 with good growth condition; (2) Pick a red and larger single colony of FY-07 and streak it densely on LB solid slant medium, and culture it at 30°C for 24 h to obtain a bacterial cellulose film containing live FY-07 strains; (3) Pick up the bacterial cellulose membrane containing the live FY-07 strain, streak it densely on the LB solid slant medium again, and culture it at 30°C for 24 h to obtain a medium surface containing a large number of live FY-07 strains and bacterial cellulose membranes; (4) Rinse the surface of the culture medium with 100 mL of sterile distilled water until the FY-07 live strain and the bacterial cellulose membrane on the surface of the culture medium are separated into the sterile distilled water, and mix the distilled water containing the FY-07 live strain and the bacterial cellulose membrane to obtain a seed solution.

[0041] 2. PCR identification of seed liquid: Take 2 μL of seed liquid sample as PCR template for PCR identification of molecular markers. The PCR amplification system is as follows: each 25 μL reaction solution contains 2 μL of DNA template, 1 μL of 20 μM primer pair (jd1 / jd2), 12.5 μL of premix Taq polymerase, and add water to 25 μL; PCR reaction conditions are as follows: pre-denaturation at 95°C for 10 min; 95°C: 30-45s, 50-60°C: 30-45s, 72°C: 45-60s, 35 cycles; 72°C extension for 10 min; The amplified product was detected by gel imaging electrophoresis. Figure 2 According to the molecular marker design, when the molecular marker is detected by the above method, it indicates that the process sample comes from the fermentation production process of FY-07, and when the molecular marker is not detected, it indicates that the process sample does not come from the fermentation production process of FY-07.

[0042] Example 4 Detection of the fermentation product of bacterial cellulose produced by strain FY-07 using molecular markers - fermentation broth 1. Collecting Fermentation Broth The seed solution of Example 3 was inoculated into 90 mL of HS-XGK medium at an inoculum size of 1%, and 10 mL of sterile 25% glucose carbon source was added to the medium. The culture was fermented at 30° C. for 24 h to obtain a fermentation broth containing bacterial cellulose membrane.

[0043] 2. PCR identification of fermentation broth: The same identification method as in Example 3, the results are shown in Figure 2 .

[0044] Example 5 Detection of the process product of bacterial cellulose fermentation by strain FY-07 using molecular markers - the treated liquid of the boiled bacterial cellulose product 1. Collect the processed liquid of boiled bacterial cellulose product The bacterial cellulose membrane of Example 4 was fished out from the culture medium, placed in 300 mL of sterile water and treated at 100° C. for 0.5 h to remove most of the bacteria and impurities, thereby obtaining a treated solution of boiled bacterial cellulose product.

[0045] 2. PCR identification of the treated solution: The same identification method as in Example 3, the results are shown in Figure 2 .

[0046] Example 6 Detection of the product of bacterial cellulose fermentation by strain FY-07 using molecular markers - alkali-boiling treatment liquid 1. Collect alkali boiling liquid The treated solution of the water-boiled bacterial cellulose product of Example 5 was treated with 0.5 M NaOH solution at 100° C. for 0.5 h to further remove the bacterial cells and residual culture medium in the bacterial cellulose film, thereby obtaining an alkali-boiled treated solution.

[0047] 2. PCR identification of alkali-boiling liquid: The same identification method as in Example 3, the results are shown in Figure 2 .

[0048] Example 7 Detection of the product of bacterial cellulose fermentation by strain FY-07 using molecular markers - aerated liquid 1. Collect the liquid after one, two, three, four, five, and six aerations The membrane after alkali boiling treatment in Example 6 was placed in sterile water for aeration treatment, the water was changed regularly, and the aeration operation was repeated until the pH value of the bacterial cellulose membrane was neutral to obtain a wet bacterial cellulose membrane, and the liquid after each operation was retained for molecular marker identification; 2. Perform PCR identification on the liquid after each aeration: The same identification method as in Example 3, the results are shown in Figure 2 .

[0049] Example 8 Detection of the fermentation product of bacterial cellulose produced by strain FY-07 using molecular markers - the fermentation product macerate after drying 1. Collect the fermentation product infusion after drying The wet bacterial cellulose film of Example 7 was dried to obtain a dry bacterial cellulose film. A portion of the dry film sample was soaked in sterile water to obtain an impregnation liquid of the dried bacterial cellulose fermentation product.

[0050] 2. PCR identification of the fermentation product soaking liquid after drying: The same identification method as in Example 3, the results are shown in Figure 2 .

[0051] The electrophoresis results of Example 3-8 are as follows Figure 2As shown in lanes 3 to 11, the liquid samples of each process in the production of bacterial cellulose by FY-07 fermentation were used as templates for molecular marker detection, and a clear and single DNA band of 585 bp was obtained, indicating that the molecular marker was detected. Among them, the molecular marker was not detected in lane 7 because the pH value of the sample was too high, resulting in the destruction of the DNA molecules therein, indicating that the molecular marker detection method is not suitable for samples of bacterial cellulose products after alkali boiling; the DNA bands in lanes 13 and 14 were weak, indicating that most of the bacteria and impurities were completely processed, resulting in almost no molecular markers being detected in the treated water and dried samples, but it did not affect the applicability of the molecular markers in the remaining process samples; no DNA bands were detected when sterile water was used as a template. The results show that the molecular marker can be used to identify strain FY-07 and all processed products made with this strain as a production strain and the processing liquid in the production process.

[0052] Example 9 Detection of bacterial cellulose facial mask products produced by fermentation of strain FY-07 using molecular markers (1) Take part of the dry and wet bacterial cellulose mask products produced by FY-07 fermentation and soak them in sterile water, and take part of the soaking liquid as PCR template for amplification; the PCR amplification system is: each 25 μL reaction liquid contains DNA template: 2 μL, 30 μM primer pair (jd1 / jd2): 1 μL each, premix Taq polymerase: 12.5 μL, add water to 25 μL; PCR reaction conditions are: 95℃ pre-denaturation for 10 min; 95℃: 30-45s, 50-60℃: 30-45s, 72℃: 45-60s, 35 cycles; 72℃ extension for 10 min; (2) The amplified product is detected by electrophoresis using a gel imager. According to the molecular marker design, when the molecular marker is detected by the above method, it indicates that the bacterial cellulose mask product is produced by the strain FY-07, and when the molecular marker is not detected, it indicates that the product is not produced by the strain FY-07.

[0053] The experimental results are as follows Figure 2 As shown in the middle lanes 16 and 17, the molecular marker can be detected for the dry and wet bacterial cellulose mask products produced by the strain FY-07, indicating that this molecular marker is suitable for the identification of the production strain of bacterial cellulose mask products.

[0054] In summary, the present invention provides a method for identifying production strains from bacterial cellulose products or solid and liquid fermentation processes using molecular markers. This method is fast, accurate, requires less samples, has high efficiency, a wide range of applications, low equipment requirements, and low cost. It is of great significance for protecting production strains, regulating the market, and preventing potential pathogenic substances from mixing into bacterial cellulose products.

[0055] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. Application of molecular markers in identifying strain FY-07 or bacterial cellulose products synthesized by strain FY-07, characterized in that: The molecular marker nucleotide sequence is shown as SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The bacterial cellulose products include food, cosmetics, papermaking products, biomedical materials and intermediates of bacterial cellulose products.

3. The use according to claim 2, characterized in that: The intermediate products of the bacterial cellulose product include seed liquid, fermentation liquid, water-boiled liquid, aerated liquid and dried impregnated liquid.

4. A primer set for identifying strain FY-07 or a bacterial cellulose product synthesized by strain FY-07, characterized in that: The primer set includes a forward primer and a reverse primer; the forward primer sequence is shown in SEQ ID No.2; the reverse primer sequence is shown in SEQ ID No.

3.

5. A kit for identifying bacterial strain FY-07 or bacterial cellulose products synthesized by strain FY-07, characterized in that: Comprising the primer set according to claim 4.

6. The kit according to claim 5, characterized in that Also included are reagents for PCR amplification.

7. Use of the primer set according to claim 4 or the kit according to claim 5 in identifying strain FY-07 or bacterial cellulose products synthesized by strain FY-07.

8. A method for identifying bacterial cellulose products synthesized by strain FY-07 or strain FY-07, characterized in that: The method comprises the following steps: using the primer set described in claim 4 or the kit described in claim 5 to perform PCR amplification on the DNA of the strain to be tested or the bacterial cellulose product, and determining the strain type or the synthetic strain of the bacterial cellulose product according to the amplified product. If a 585 bp specific identification band appears in the amplified product, it is determined to be strain FY-07 or a bacterial cellulose product synthesized by strain FY-07.

9. The identification method according to claim 8, characterized in that: Also includes a 25 μL PCR amplification system.

10. The identification method according to claim 8, characterized in that: The PCR reaction conditions are: pre-denaturation at 95°C for 10 min; 95°C: 30-45 s, 50-60°C: 30-45 s, 72°C: 45-60 s, 35 cycles; extension at 72°C for 10 min.

Images