Composition for detecting genital tract pathogens as well as preparation method and application of composition

Abstract

The invention provides a composition for detecting genital tract pathogens as well as a preparation method and application of the composition, and belongs to the field of determination or inspection of nucleic acid or microorganisms. The composition comprises a forward primer, a reverse primer and a probe which target seven genital tract pathogens, the forward primer and the reverse primer are used for amplifying target DNA, a blocking group is added between the ith nucleotide and the (i + 1) th nucleotide from the 3'end of the reverse primer, and i is larger than or equal to 4 and smaller than or equal to 8; two ends of the probe are respectively marked with a fluorophore and a second quenching group, the middle of the probe is marked with a first quenching group, and a part of sequence of the probe is the same as a part of sequence of the reverse primer. The composition provided by the invention can realize multiple qualitative detection of seven genital tract pathogens, namely neisseria gonorrhoeae, chlamydia trachomatis, ureaplasma urealyticum, ureaplasma parvum, mycoplasma hominis, mycoplasma genitalium and herpes simplex virus type 2.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid or microorganism determination or testing, and in particular to a composition for detecting reproductive tract pathogens, and a preparation method and application thereof. Background Art

[0002] Sexually transmitted diseases (STD) refer to a group of infectious diseases that are mainly transmitted through sexual contact, similar sexual behaviors and indirectly. There are more than 30 kinds of STD found worldwide, among which the representative ones are: Mycoplasma hominis, Ureaplasma urealyticum, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus type 2, Candida albicans, Haemophilus ducreyi, Trichomonas vaginalis, Mycoplasma genitalium, Treponema pallidum and Carinella vaginalis.

[0003] STDs are a group of common infectious diseases prevalent worldwide. In the past 20 years, they have gradually shown a trend of expanding prevalence, decreasing the age of onset, increasing the number of asymptomatic or mildly symptomatic patients, and increasing the number of drug-resistant strains. They have become a public health issue that all mankind must face together. Sexually transmitted infections often have no obvious symptoms or lack symptoms. Timely detection and diagnosis are conducive to the diagnosis and treatment of the disease. Molecular detection methods have advantages such as zero window period and high sensitivity, and are the gold standard for most pathogen detection.

[0004] Molecular diagnostic methods help improve the speed and accuracy of detecting pathogen genes, which is very meaningful for infection control, prevention and treatment in hospital and community environments. At present, the main molecular diagnostic method is polymerase chain reaction (PCR), including ordinary PCR, allele PCR, real-time fluorescence quantitative PCR, PCR-Sanger sequencing technology, PCR-gene chip technology, PCR flow-through hybridization technology, etc. Among them, real-time fluorescence quantitative PCR can use multiple sets of primers and probes in a single test tube to simultaneously amplify several target DNA sequences. Since its introduction, this technology has been widely used in many fields of nucleic acid detection such as mutation identification, transgenic detection, diagnosis of genetic diseases, and pathogen identification because of its significant advantages in sensitivity and accuracy. However, for the simultaneous detection of multiple pathogens, interference between multiple sets of primers will lead to false positives, affecting detection, and it is impossible to effectively detect or distinguish multiple pathogens; and when constructing a multiplex PCR system, it is usually limited by the number of instrument fluorescence channels; if the construction is carried out separately, the reagent cost will also increase, and the operation will be more troublesome. Summary of the invention

[0005] The invention provides a composition for detecting reproductive tract pathogens and a preparation method thereof, which are used to detect multiple reproductive tract pathogens in a single tube.

[0006] In a first aspect, the present invention provides a composition for detecting reproductive tract pathogens, the composition comprising a first composition for detecting Neisseria gonorrhoeae, a second composition for detecting Chlamydia trachomatis, a third composition for detecting Ureaplasma urealyticum, a fourth composition for detecting Ureaplasma parvum, a fifth composition for detecting Mycoplasma hominis, a sixth composition for detecting Mycoplasma genitalium, and a seventh composition for detecting herpes simplex virus type 2; The first composition, the second composition, the third composition, the fourth composition, the fifth composition, the sixth composition and the seventh composition all include a forward primer, a reverse primer and a probe; The forward primer and the reverse primer are used to amplify the target DNA; a blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide at the 3' end of the reverse primer, 4≤i≤8, and i is a positive integer; The probe meets the following conditions: 1) The probe is a single-stranded nucleic acid molecule; 2) the first nucleotide at the first end of the probe is labeled with a fluorescent group, the nth nucleotide from the first end of the probe is labeled with a first quenching group, and the first nucleotide at the second end of the probe is labeled with a second quenching group, 9≤n≤30, n is a positive integer, and n is less than the total number of nucleotides in the probe; 3) the partial nucleotide sequence of the probe is identical to the nucleotide sequence from the first nucleotide to the i-th nucleotide at the 3' end of the reverse primer; 4) the probe does not bind to the forward primer; 5) The probe does not bind to the reverse primer.

[0007] In the present invention, the target DNA refers to a DNA fragment corresponding to the target nucleic acid fragment, which can be DNA or RNA. The target nucleic acid fragment refers to a nucleic acid fragment that exists in a specific region of the gene of the pathogen to be detected and has a certain amount of nucleic acid that can be used as a detection target. The nucleic acid fragment can be significantly different from other pathogens or the gene sequence of the sample to be detected. For pathogens whose genetic material is DNA, the target nucleic acid fragment is the target DNA; for pathogens whose genetic material is RNA, the target nucleic acid fragment is reverse transcribed to obtain the target DNA.

[0008] In the present invention, the pathogen refers to an organism or substance that can cause a disease in a host (such as humans, animals, plants, etc.), such as viruses, chlamydia, rickettsia, mycoplasma, bacteria, spirochetes, fungi, and other microorganisms and parasites. In a specific embodiment, the pathogen is a microorganism. Furthermore, the genetic material of the microorganism can be DNA.

[0009] In the present invention, the target DNA is double-stranded DNA, the forward primer can specifically bind to one strand of the target DNA, and the reverse primer can specifically bind to the other strand of the target DNA, and an extension reaction is performed with the double-stranded DNA as a template under the action of DNA polymerase. Both the forward primer and the reverse primer are single-stranded DNA.

[0010] In the present invention, the design principles of the forward primer and the reverse primer are the same or similar to the design principles of the conventional forward primer and the reverse primer in the art, the difference being that, in the present invention, a blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide from the 3' end of the reverse primer, 4≤i≤8, and i is a positive integer (i is one of 4, 5, 6, 7, 8), and i is less than the total number of nucleotides in the reverse primer; when the forward primer and the reverse primer are used to perform PCR amplification on the target DNA, the forward primer binds to the template chain of the target DNA and extends, and the extension stops after encountering the blocking group, thereby obtaining a double-stranded amplification product in which the length of one chain is smaller than the other chain.

[0011] Furthermore, the total number of nucleotides of the reverse primer may be 18-35 nucleotides.

[0012] In the present invention, the probe may be a single-stranded DNA molecule.

[0013] In the present invention, the first end may be the 5' end of the probe, and correspondingly, the second end is the 3' end of the probe; the first end may also be the 3' end of the probe, and correspondingly, the second end is the 5' end of the probe.

[0014] In the present invention, n may be any one of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30.

[0015] In the present invention, the partial nucleotide sequence of the probe is identical to the nucleotide sequence between the first nucleotide and the i-th nucleotide from the 3' end of the reverse primer. Further, the nucleotide sequence in the probe identical to the reverse primer should be close to both ends of the probe, so as to bind to the shorter DNA chain in the double-stranded amplification product and improve the binding rate. Furthermore, the nucleotide sequence in the probe identical to the reverse primer is close to the 3' end of the probe, that is, between the nucleotides modified by two quenching groups in the probe.

[0016] In the present invention, the above-mentioned binding means that the probe will not perform PCR amplification with the forward primer or the reverse primer as a template, that is, when no target DNA is added or the sample to be detected does not contain the corresponding pathogen, the probe remains in a curled state, and the fluorescent signal emitted by the fluorescent group marked on the first end of the probe will be absorbed by any quenching group, and then the corresponding fluorescent signal cannot be detected. When there are at least two forward primers and reverse primers in the PCR system, the probe does not bind to the primer pair targeting other target DNA.

[0017] In the composition as described above, the length of the probe is 20-60 nt and the GC content is 40%-60%.

[0018] In the composition as described above, the blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer and C12 Spacer.

[0019] In the composition as described above, the fluorescent group is selected from at least one of FAM (carboxyfluorescein), JOE (carboxydimethylfluorescein), TAMRA (tetramethylrhodamine), ROX (rhodamine X), CY3, CY5, VIC, and HEX (hexachlorofluorescein).

[0020] In the composition as described above, the quenching group is selected from at least one of BHQ1 and BHQ2.

[0021] In a specific embodiment, the first composition comprises a first forward primer, a first reverse primer and a first probe for detecting Neisseria gonorrhoeae; the second composition comprises a second forward primer, a second reverse primer and a second probe for detecting Chlamydia trachomatis; the third composition comprises a third forward primer, a third reverse primer and a third probe for detecting Ureaplasma urealyticum; the fourth composition comprises a fourth forward primer, a fourth reverse primer and a fourth probe for detecting Ureaplasma parvum; the fifth composition comprises a fifth forward primer, a fifth reverse primer and the first probe for detecting Mycoplasma hominis; the sixth composition comprises a sixth forward primer, a sixth reverse primer and the fourth probe for detecting Mycoplasma genitalium; the seventh composition comprises a seventh forward primer, a seventh reverse primer and the second probe for detecting herpes simplex virus type 2; The first forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 1; The second forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 3; The third forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 5; The fourth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:7; The fifth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:9; The sixth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:11; The seventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 13; The general structural formula of the reverse primer is shown in Formula 1: 5'-n(a)-Yn(b)-3' Formula 1 In Formula 1, n(a) and n(b) are polynucleotide fragments with different nucleotide sequences, and Y is a blocking group; In the first reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 2, and the nucleotide sequence of n(b) is GCCCGTA; In the second reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:4, and the nucleotide sequence of n(b) is GCAGGA; In the third reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:6, and the nucleotide sequence of n(b) is AAGACC; In the fourth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:8, and the nucleotide sequence of n(b) is GACGG; In the fifth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 10, and the nucleotide sequence of n(b) is CTTTAC; In the sixth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 12, and the nucleotide sequence of n(b) is GGCCAA; In the seventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 14, and the nucleotide sequence of n(b) is CTCCA; The first probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 17, wherein the first nucleotide of SEQ ID NO: 17 is labeled with a first fluorescent group, the 25th nucleotide is labeled with a first quenching group, and the 45th nucleotide is labeled with a second quenching group; The second probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 18, wherein the first nucleotide of SEQ ID NO: 18 is labeled with a second fluorescent group, the 27th nucleotide is labeled with a third quenching group, and the 46th nucleotide is labeled with a fourth quenching group; The third probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 19, wherein the first nucleotide of SEQ ID NO: 19 is labeled with a third fluorescent group, the 27th nucleotide is labeled with a fifth quenching group, and the 43rd nucleotide is labeled with a sixth quenching group; The fourth probe is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 20, and the first nucleotide of SEQ ID NO: 20 is labeled with a fourth fluorescent group, the 26th nucleotide is labeled with a seventh quenching group, and the 40th nucleotide is labeled with an eighth quenching group.

[0022] In the present invention, the reproductive tract pathogens include Neisseria gonorrhoeae ( Neisseria gonorrhoeae , NG), Chlamydia trachomatis ( Chlamydia trachomatis , CT), Ureaplasma urealyticum ( Ureaplasma urealyticum , UUR), Ureaplasma parvum ( Ureaplasma parvum , UPA), Mycoplasma hominis ( Mycoplasma hominis , Mh), herpes simplex virus type 2 ( Herpes simplex virus type 2 , HSV-2) and Mycoplasma genitalium ( Mycoplasma genitalium , Mg).

[0023] The principles involved in the present invention are as follows Figure 1 As shown, specifically: when the target double-stranded DNA exists, the forward primer and the reverse primer provided by the present invention bind to the target DNA and extend to produce a pre-amplification product, and the pre-amplification product includes a shorter DNA chain and a longer DNA chain; at the same time, the probe can bind to the shorter DNA chain in the pre-amplification product through base complementary pairing, and continue to perform PCR amplification along the 5' to 3' direction of the DNA chain. As the PCR amplification proceeds, the probe structure changes (mainly the change in the distance between the fluorescent group and the quenching group), so that the fluorescent signal emitted by the fluorescent group cannot be absorbed by the quenching group, and the fluorescent signal can be detected by the instrument. When the target double-stranded DNA does not exist, the probe remains in a curled state, and the fluorescent signal emitted by the fluorescent group is absorbed by the quenching group, and the fluorescent signal cannot be detected. By observing whether there is a fluorescent signal, it can be determined whether the target double-stranded DNA exists, and whether the sample to be detected contains the corresponding pathogen. Limited by the number of fluorescence channels of the instrument, the probe provided by the present invention can simultaneously detect two target pathogens, and qualitative detection of the two pathogens can be achieved by melting curve analysis combined with different Tm values ​​of the target PCR products.

[0024] The above detection process is explained by taking Chlamydia trachomatis as an example: the nucleotide sequence of the target DNA for detecting Chlamydia trachomatis provided by the present invention is shown in SEQ ID NO: 22; for the above target DNA, the nucleotide sequence of the forward primer provided by the present invention is 5'-GGTAGATCCGATATCAGCAAAAGTGCTCC -3' (SEQ ID NO: 3), the nucleotide sequence of the reverse primer is 5'-GTGCCACCTTATTTGCTGCAGGA -3' (the first 17 nucleotide sequences are SEQ ID NO: 4), and a blocking group is connected between the 17th nucleotide (T) and the 18th nucleotide (G) from the 5' end, and the nucleotide sequence of the probe is 5'-CCACGCCACGTCAGACAAACGAACGCTG GCAGGA CCACTCCCTCCA -3' (SEQ ID NO: 18), and the first nucleotide (C) from the 5' end is labeled with a fluorescent group, the 27th nucleotide (T) is labeled with a first quenching group, and the 46th nucleotide (A) is labeled with a second quenching group. When the target DNA is PCR amplified using the forward primer and the reverse primer, the obtained pre-amplification product includes a nucleotide sequence of 5'- GGTAGATCCGATATCAGCAAAAGTGCTCCTAAAGGAAGATTCCTTCGGTA TC CTGC -3' DNA chain (SEQ ID NO:29), the 1st to the 6th nucleotides from the 3' end of the DNA chain (as underlined in the above sequence) and the 29th to the 34th nucleotides from the 5' end of the probe (as underlined in the above sequence) are bound by complementary pairing. Since the 3' end of the probe is labeled with a fluorescent quenching group, it cannot trigger the extension reaction of the DNA polymerase. Therefore, the DNA chain acts as a primer, and the probe is used as a template for extension to cause secondary PCR amplification. The second amplification product forms a double-stranded structure with the probe, and the fluorescent signal emitted by the fluorescent group cannot be absorbed by the quenching group. The fluorescent signal is detected, indicating the presence of the target DNA.

[0025] The composition as described above also includes a composition for detecting an internal reference gene. In a specific embodiment, the internal reference gene can be a target DNA corresponding to human β-actin (beta-actin, β-actin). Further, the nucleotide sequence of the target DNA corresponding to human β-actin is SEQ ID NO: 28. Based on the target DNA, the composition for detecting the target DNA corresponding to human β-actin includes an eighth forward primer, an eighth reverse primer and a probe, wherein the nucleotide sequence of the eighth forward primer is SEQ ID NO: 15; the structure of the eighth reverse primer is as shown in Formula 1, and the nucleotide sequence of n(a) is SEQ ID NO: 16, and the nucleotide sequence of n(b) is CACGA; the probe is a third probe.

[0026] In the composition as described above, the molar ratio of the forward primer to the reverse primer is greater than or equal to 3:1, which increases the amplification product chain that can bind to the probe. Further, the molar ratio of the forward primer to the reverse primer is 3:1-10:1, and can specifically be 3:1, 3.5:1, 4:1, 4.5:1, 5:1, 5.5:1, 6:1, 6.5:1, 7:1, 7.5:1, 8:1, 8.5:1, 9:1, 9.5:1, 10:1 or within the range of any two thereof. Furthermore, the molar ratio of the forward primer to the reverse primer is 10:1.

[0027] It should be noted that the forward primer and reverse primer in the present invention refer to a primer pair targeting the same target DNA, for example, the molar ratio of the first forward primer to the first reverse primer is greater than or equal to 3:1, and the molar ratio of the first forward primer to the second reverse primer is not particularly limited in the present invention.

[0028] In the composition as described above, the molar concentration of the forward primer in the composition is 90-1000 nM, specifically 90 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1000 nM or in the range of any two thereof.

[0029] In the composition as described above, the molar concentration of the reverse primer in the composition is 30-100 nM, specifically 30 nM, 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM, 70 nM, 75 nM, 80 nM, 85 nM, 90 nM, 95 nM, 100 nM or within the range of any two thereof.

[0030] In the composition as described above, the molar concentration of the probe in the composition is 100-1000 nM, specifically 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1000 nM or within the range of any two thereof.

[0031] It should be noted that the concentrations of the forward primer, reverse primer and probe are all the concentrations of one primer and probe, that is, the concentration of the first forward primer in the composition is 90-1000 nM, the concentration of the first reverse primer in the composition is 30-100 nM, and the concentration of the first probe in the composition is 100-1000 nM.

[0032] In a second aspect, the present invention provides a method for preparing any of the above-mentioned compositions, comprising: S1. providing the forward primer, reverse primer and probe in the above composition; S2. Combining the forward primer, reverse primer and probe to obtain the composition.

[0033] As described above, the forward primer, reverse primer and probe can be synthesized by conventional methods in the art.

[0034] In a third aspect, the present invention provides a kit for detecting reproductive tract pathogens, comprising any of the above-mentioned compositions.

[0035] In a fourth aspect, the present invention provides an application of any of the above-described compositions and / or kits, wherein the application is selected from any one of A1) to A2): A1) Application in the detection of reproductive tract pathogens; A2) Application in the preparation of products for detecting reproductive tract pathogens.

[0036] In a fifth aspect, the present invention provides a method for detecting reproductive tract pathogens, comprising: Prepare DNA of samples to be tested; Use any of the above-mentioned compositions or kits to perform real-time fluorescence quantitative PCR on the DNA to determine whether the sample to be detected contains reproductive tract pathogens.

[0037] As described above, the DNA can be extracted using a conventional DNA extraction kit in the art.

[0038] According to the method described above, depending on the different fluorescent groups carried by the probe, whether the sample to be detected contains the pathogen to be detected can be first determined by detecting the fluorescent signal. For example, if the corresponding fluorescent signal is detected, it means that the sample to be detected contains the pathogen to be detected. If the corresponding fluorescent signal is not detected, it means that the sample to be detected does not contain the pathogen to be detected. For the determination of Neisseria gonorrhoeae and Mycoplasma hominis, when there is a fluorescent signal with the first probe, it can be determined by the Tm value whether the sample to be detected contains Neisseria gonorrhoeae and / or Mycoplasma hominis.

[0039] The method as described above, the direct purpose of the method may be non-disease diagnosis and / or non-disease treatment purposes. The above application or method is a non-disease diagnosis application or method. The above application or method does not have the direct purpose of obtaining disease diagnosis results or health conditions of living human or animal bodies.

[0040] The above method is an application or method for non-disease treatment purposes. The above method does not have the direct purpose of restoring or obtaining health or reducing pain in a living human or animal body.

[0041] In the method described above, the sample to be detected may be a sample from a non-living human or animal body, such as an environmental sample (such as air), clothing or towels, or animal tissues and / or organs used as food.

[0042] The present invention is based on seven common reproductive tract pathogens, provides forward primers and reverse primers targeting the seven reproductive tract pathogens, and four universal probes. After the target sequence of the amplified product hybridizes with the probe, the conformation of the probe is changed to emit fluorescence, and the presence of pathogens and the type of pathogen are determined in combination with the Tm value. Multiple qualitative detection of seven reproductive tract pathogens is achieved in a single tube, effectively avoiding the problem of false positives in the multiple detection process, and providing technical support for the diagnosis and prevention and control of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is a schematic diagram of the principle of the composition provided by the present invention in PCR amplification; Figure 2 The results of PCR detection of a template plasmid containing Chlamydia trachomatis target DNA using the forward primer, reverse primer and second probe targeted to Chlamydia trachomatis provided in Example 1; Figure 3 The results of PCR detection of a template plasmid containing herpes simplex virus type 2 target DNA using the forward primer, reverse primer and second probe targeted to herpes simplex virus type 2 provided in Example 1; Figure 4 The results of PCR detection of a template plasmid containing Mycoplasma genitalium target DNA using the forward primer, reverse primer and fourth probe targeted to Mycoplasma genitalium provided in Example 1; Figure 5 The results of PCR detection of a template plasmid containing Ureaplasma microtyping target DNA using the forward primer, reverse primer and fourth probe targeted to Ureaplasma microtyping provided in Example 1; Figure 6 The results of PCR detection of a template plasmid containing human β-actin target DNA using the forward primer, reverse primer and third probe targeted to human β-actin provided in Example 1; Figure 7 The results of PCR detection of a template plasmid containing Ureaplasma urealyticum target DNA using the forward primer, reverse primer and third probe targeted to Ureaplasma urealyticum provided in Example 1; Figure 8 The results of PCR detection of a template plasmid containing Neisseria gonorrhoeae target DNA using the forward primer, reverse primer and first probe targeted to Neisseria gonorrhoeae provided in Example 1; Fig. 9 The results of PCR detection of a template plasmid containing Mycoplasma hominis target DNA using the Mycoplasma hominis-targeting forward primer, reverse primer, and first probe provided in Example 1; Fig.10 The results of eight-plex PCR detection of seven template plasmids containing target DNA of reproductive tract pathogens and a template plasmid containing an internal reference gene using the composition provided in Example 1; Fig.11 The results of multiplex PCR detection of negative template plasmids using the composition provided in Example 1; Fig.12 The results of multiplex PCR detection of negative template plasmids using the composition provided in Comparative Example 1; Fig.13 The results of multiplex PCR detection of a positive template plasmid containing Neisseria gonorrhoeae target DNA using the composition provided in Comparative Example 1 are shown. DETAILED DESCRIPTION

[0044] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments, and they should not be understood as limitations on the present invention. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. In the description of the present invention, it should be understood that the terms used are only for descriptive purposes and cannot be understood as indicating or implying relative importance.

[0045] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0046] Example 1: PCR detection of seven reproductive tract pathogens based on the primer-probe combination provided by the present invention Step 1: providing a plasmid containing target DNA, wherein Neisseria gonorrhoeae ( Neisseria gonorrhoeae ,NG) is SEQ ID NO:21; Chlamydia trachomatis ( Chlamydia trachomatis , CT) The nucleotide sequence of the target DNA corresponding to is SEQ ID NO: 22; Ureaplasma urealyticum (Ureaplasma urealyticum , UUR) is SEQ ID NO: 23; Ureaplasma microti ( Ureaplasma parvum , UPA) is SEQ ID NO: 24; Mycoplasma hominis ( Mycoplasma hominis , Mh) is SEQ ID NO: 25; Mycoplasma genitalium ( Mycoplasma genitalium , Mg) is SEQ ID NO: 26; herpes simplex virus type 2 ( Herpes simplex virus type 2, HSV-2) is SEQ ID NO: 27; human β-actin ( beta-actin, β-actin ) The nucleotide sequence of the target DNA corresponding to is SEQ ID NO: 28; SEQ ID NO:21: 5'-CCGTTGGCTGCAAGTGCCGATTTATGCGGGGCTGACTGTTGTACGGGCGATTTGTGCCTATAAG-3'; SEQ ID NO:22: 5'-GGTAGATCCGATATCAGCAAAAGTGCTCCTAAAGGAAGATTCCTTCGGTATCCTGCAGCAAATAAGGTGGCAC-3'; SEQ ID NO:23: 5'-CCAATCTTTGAACAAATCGTAGCAGGTGCTTGTGGTCTTAAGATTCACGAAGACTGAGGGG-3'; SEQ ID NO:24: 5'-GTACCAGGGGCAATTAATTTCGCTAGTGGTGAAATTGTGATGAATGAAGGTAGAGAGGCAAAAGTAATTAGTATTAAAAATACTGGGGACCGTCCTATACAAGTTGGATCACATTTTC-3'; SEQ ID NO:25: 5'-ACATAGGTCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGTTCGTAGGCTGTTTGTT-3'; SEQ ID NO:26: 5'-GCGATTGTAACCCCATCGTTAGTAATTAATGGGTTTGCAAATTTTCTCTCTAAAATAACATTTTGGCCTTTAGGACCTACTGTTACT-3'; SEQ ID NO:27: 5'- ACGGCCAAGTACGTGCGGAACAACATGGAGACCACCGCGTTTCACCGGGACGACCACGAGACCGACATGGAGCTCAAGCCGGCGAAGGT-3'; SEQ ID NO:28: 5'- TGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGAC-3'.

[0047] At the same time, a negative control plasmid is provided. The negative control plasmid does not contain the above target DNA sequence, and the remaining sequences are the same as those of the plasmid containing the target DNA.

[0048] Step 2. Based on the target DNA, a primer-probe combination as shown in Table 1 is provided. According to the reaction system shown in Table 2, the template plasmid containing the target DNA, the forward primer, reverse primer, probe and PCR reaction premix as shown in Table 1 are mixed to obtain a PCR reaction system with a total volume of 25 μL; wherein the PCR reaction premix includes DEPC-treated water, Tris buffer (pH 9.0), dATP, dCTP, dGTP, dUTP, KCl, MgCl2, (NH4)2SO4 and trehalose.

[0049]

[0050]

[0051] In Table 1, iSpC3 indicates that a blocking group C3 spacer is inserted into two adjacent nucleotides of the reverse primer; the sequence corresponding to the reverse primer only includes the sequence located 5' upstream of the C3 spacer. 5'-ROX indicates that the fluorescent group ROX is modified on the first nucleotide at the 5' end of the first probe; T25-BHQ2 indicates that the first quenching group BHQ2 is modified on the 25th nucleotide (T) from the 5' end of the first probe; 3'-BHQ2 indicates that the second quenching group BHQ2 is modified on the first nucleotide at the 3' end of the first probe; the modification descriptions of the second probe, the third probe, and the fourth probe are the same as those of the first probe; FAM indicates 5-carboxyfluorescein; HEX indicates hexachlorofluorescein; ROX indicates carboxy-X-rhodamine; CY5 indicates cyanine dye; BHQ1 and BHQ2 indicate fluorescence quenching groups, respectively.

[0052]

[0053] Step 3. Seal the PCR tube cap and gently mix the sample, then centrifuge briefly and place at room temperature for 5 min. Place the PCR tube in the handheld centrifuge again, centrifuge briefly and transfer to the tray of the real-time fluorescence quantitative PCR instrument, and perform PCR amplification reaction. The PCR amplification program is shown in Table 3:

[0054] Step 4, data analysis: Use SLAN real-time fluorescence quantitative PCR analysis software from Shanghai Hongshi Medical Technology Co., Ltd. to interpret the results based on the Tm value of the melting curve. Figure 2-11 As shown, it can be seen that the composition provided in Table 1 of the present invention performs PCR amplification on a template plasmid containing a target DNA, and different pathogens can be distinguished by fluorescent signals and Tm values ​​without false positives.

[0055] Comparative Example 1 In this comparative example, the negative template plasmid and the template containing only positive Neisseria gonorrhoeae were detected respectively. The detection method was the same as that in Example 1, except that the forward primers used in the composition were the same as those in Example 1, the nucleotide sequences of the reverse primers were the same as those in Example 1, but no C3 spacer modification was used. The probes for detecting Neisseria gonorrhoeae and Mycoplasma hominis are shown in Table 4, and the remaining probes are the same as those in Example 1. The fluorescence quantitative PCR reaction procedure is shown in Table 5.

[0056]

[0057]

[0058] After the PCR amplification reaction is completed, a melting curve analysis is performed. The analysis results are as follows Figure 12-13 As shown, it can be seen that when the reverse primer is not modified with C3 spacer, in the multiplex PCR system, due to the interference between primers, non-specific peaks are likely to appear, and false positives exist. The composition provided by the present invention can well solve the problem of non-specific peaks and false positives, and is suitable for multiplex PCR detection.

[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A composition for detecting reproductive tract pathogens, characterized in that: The composition includes a first composition for detecting Neisseria gonorrhoeae, a second composition for detecting Chlamydia trachomatis, a third composition for detecting Ureaplasma urealyticum, a fourth composition for detecting Ureaplasma parvum, a fifth composition for detecting Mycoplasma hominis, a sixth composition for detecting Mycoplasma genitalium, and a seventh composition for detecting herpes simplex virus type 2; The first composition, the second composition, the third composition, the fourth composition, the fifth composition, the sixth composition and the seventh composition all include a forward primer, a reverse primer and a probe; The forward primer and the reverse primer are used to amplify the target DNA; a blocking group is added between the i-th nucleotide and the (i+1)-th nucleotide at the 3' end of the reverse primer, 4≤i≤8, and i is a positive integer; The probe meets the following conditions: 1) The probe is a single-stranded nucleic acid molecule; 2) the first nucleotide at the first end of the probe is labeled with a fluorescent group, the nth nucleotide from the first end of the probe is labeled with a first quenching group, and the first nucleotide at the second end of the probe is labeled with a second quenching group, 9≤n≤30, n is a positive integer, and n is less than the total number of nucleotides in the probe; 3) the partial nucleotide sequence of the probe is identical to the nucleotide sequence from the first nucleotide to the i-th nucleotide at the 3' end of the reverse primer; 4) the probe does not bind to the forward primer; 5) The probe does not bind to the reverse primer.

2. The composition according to claim 1, characterized in that The first composition comprises a first forward primer, a first reverse primer and a first probe for detecting Neisseria gonorrhoeae; the second composition comprises a second forward primer, a second reverse primer and a second probe for detecting Chlamydia trachomatis; the third composition comprises a third forward primer, a third reverse primer and a third probe for detecting Ureaplasma urealyticum; the fourth composition comprises a fourth forward primer, a fourth reverse primer and a fourth probe for detecting Ureaplasma parvum; the fifth composition comprises a fifth forward primer, a fifth reverse primer and the first probe for detecting Mycoplasma hominis; the sixth composition comprises a sixth forward primer, a sixth reverse primer and the fourth probe for detecting Mycoplasma genitalium; the seventh composition comprises a seventh forward primer, a seventh reverse primer and the second probe for detecting herpes simplex virus type 2; The first forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 1; The second forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 3; The third forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 5; The fourth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:7; The fifth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:9; The sixth forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO:11; The seventh forward primer is a single-stranded DNA having a nucleotide sequence as shown in SEQ ID NO: 13; The general structural formula of the reverse primer is shown in Formula 1: 5'-n(a)-Yn(b)-3' Formula 1 In Formula 1, n(a) and n(b) are polynucleotide fragments with different nucleotide sequences, and Y is a blocking group; In the first reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 2, and the nucleotide sequence of n(b) is GCCCGTA; In the second reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:4, and the nucleotide sequence of n(b) is GCAGGA; In the third reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:6, and the nucleotide sequence of n(b) is AAGACC; In the fourth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO:8, and the nucleotide sequence of n(b) is GACGG; In the fifth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 10, and the nucleotide sequence of n(b) is CTTTAC; In the sixth reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 12, and the nucleotide sequence of n(b) is GGCCAA; In the seventh reverse primer, the nucleotide sequence of n(a) is SEQ ID NO: 14, and the nucleotide sequence of n(b) is CTCCA; The first probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 17, wherein the first nucleotide of SEQ ID NO: 17 is labeled with a first fluorescent group, the 25th nucleotide is labeled with a first quenching group, and the 45th nucleotide is labeled with a second quenching group; The second probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 18, wherein the first nucleotide of SEQ ID NO: 18 is labeled with a second fluorescent group, the 27th nucleotide is labeled with a third quenching group, and the 46th nucleotide is labeled with a fourth quenching group; The third probe is a single-stranded DNA having a nucleotide sequence of SEQ ID NO: 19, wherein the first nucleotide of SEQ ID NO: 19 is labeled with a third fluorescent group, the 27th nucleotide is labeled with a fifth quenching group, and the 43rd nucleotide is labeled with a sixth quenching group; The fourth probe is a single-stranded DNA with a nucleotide sequence of SEQ ID NO: 20, and the first nucleotide of SEQ ID NO: 20 is labeled with a fourth fluorescent group, the 26th nucleotide is labeled with a seventh quenching group, and the 40th nucleotide is labeled with an eighth quenching group.

3. The composition according to claim 1 or 2, characterized in that The molar ratio of the forward primer to the reverse primer is greater than or equal to 3:

1.

4. The composition according to claim 1 or 2, characterized in that The blocking group is at least one of C3 Spacer, C6 Spacer, C9 Spacer and C12 Spacer.

5. The composition according to claim 2, characterized in that The first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are independently selected from one of FAM, JOE, TAMRA, ROX, CY3, CY5, VIC, and HEX, and any two of the first fluorescent group, the second fluorescent group, the third fluorescent group, and the fourth fluorescent group are different; And / or, the first quenching group, the second quenching group, the third quenching group, the fourth quenching group, the fifth quenching group, the sixth quenching group, the seventh quenching group, and the eighth quenching group are independently selected from one of BHQ1 and BHQ2.

6. A method for preparing the composition according to any one of claims 1 to 5, characterized in that: include: S1. providing the forward primer, reverse primer and probe in the above composition; S2. Combining the forward primer, reverse primer and probe to obtain the composition.

7. A kit for detecting reproductive tract pathogens, characterized in that: The invention comprises the composition according to any one of claims 1 to 5.

8. Use of the composition according to any one of claims 1 to 5 and / or the kit according to claim 7, characterized in that: The application is selected from any one of A1) to A2): A1) Application in the detection of reproductive tract pathogens; A2) Application in the preparation of products for detecting reproductive tract pathogens.

9. A method for detecting reproductive tract pathogens, characterized in that: include: Preparing DNA of samples to be tested; The composition according to any one of claims 1 to 5 or the kit according to claim 7 is used to perform real-time fluorescence quantitative PCR on the DNA to determine whether the sample to be detected contains reproductive tract pathogens.

10. The method according to claim 9, characterized in that The reproductive tract pathogen is selected from at least one of Neisseria gonorrhoeae, Chlamydia trachomatis, Ureaplasma urealyticum, Ureaplasma parvum, Mycoplasma hominis, Mycoplasma genitalium, and herpes simplex virus type 2.

Images