Multiple detection method for vibrio parahaemolyticus, white spot syndrome virus and enterocytozoon hepatopenaei based on RAA technology

Abstract

The invention provides a multiple detection method for vibrio parahaemolyticus, white spot syndrome virus and enterocytozoon hepatopenaei based on RAA, and the detection method comprises the following steps: respectively carrying out target sequence screening according to a vibrio parahaemolyticus TLH gene segment, a white spot syndrome virus VP28 gene segment and an enterocytozoon hepatopenaei 18S rRNA gene segment; a pair of specific RAA primers and a probe as shown in SEQ ID NO: 1-9 are respectively designed and screened for three pathogens, DNA in a tissue sample is extracted, a fluorescent RAA reaction system is constructed, and fluorescent RAA detection is carried out. The method for detecting the vibrio parahaemolyticus, the white spot syndrome virus and the enterocytozoon hepatopenaei based on the recombinase polymerase amplification technology, provided by the invention, can be used for combined detection of the three pathogens, has the characteristics of rapidness, high specificity and high sensitivity, and can meet the requirements of disease monitoring and screening.

Description

Technical Field

[0001] The invention relates to the technical field of molecular detection, and in particular to a multiplex detection method for Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatoenteroides based on recombinase-mediated amplification technology. Background Art

[0002] The vannamei shrimp is native to the eastern Pacific Ocean and was introduced to my country in the late 1980s. It has a fast growth rate, delicious meat, strong reproductive capacity, and high economic value. It has become an important aquaculture species in my country. According to statistics from the Food and Agriculture Organization (FAO), the total production of vannamei shrimp in my country reached 2.0986 million tons in 2022. However, in recent years, my country's vannamei shrimp farming industry has been deeply poisoned by three pathogens: Vibrio parahaemolyticus, white spot syndrome virus, and shrimp hepatoenterozoa, causing certain economic losses. Vibrio parahaemolyticus (Vp) is a halophilic Gram-negative bacterium. In 2010, acute hepatopancreatic necrosis (AHPND) of Penaeus vannamei caused by Vibrio parahaemolyticus was first discovered. It is the most important pathogen of bacterial diseases in Penaeus vannamei farming. It is also a pathogen that causes disease in humans and fisheries. Once it enters the human body, it can cause foodborne poisoning and acute diarrhea, which seriously threatens public health and safety. White spot syndrome virus (WSSV) belongs to the genus White spot virus of the family Myloviridae. It is a highly virulent pathogen that is prevalent in major farming areas in Asia. The mortality rate of infected animals can reach 100%, and it has become one of the most harmful diseases in shrimp farming worldwide. Enterocytozoon hepatopenaei (EHP) is an obligate intracellular parasitic protozoan and a microsporidian that was first discovered in sluggish-growing Penaeus monodon in aquaculture ponds in Thailand in 2009. In recent years, the prevalence of EHP in farmed shrimp in my country has remained high, and it has become one of the important pathogens that endanger farmed shrimp in my country.

[0003] Therefore, there is an urgent need in this field for a rapid, accurate and sensitive method for detecting Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatoenteric cysts, which can avoid the drawbacks of pathogen microscopy, serological antibody detection and polymerase chain reaction (PCR), detect the target genes of Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatoenteric cysts and meet the needs of disease detection and screening.

[0004] In recent years, the rapidly developing isothermal amplification technology has greatly reduced its dependence on instruments and equipment, improved the timeliness of the reaction, and got rid of the limitations of experimental conditions in nucleic acid amplification by its high-efficiency amplification of nucleic acids by certain enzymes under constant temperature conditions. Among them, recombinase-mediated amplification (RAA) technology has the advantages of high sensitivity and high specificity. It does not require expensive experimental equipment and consumables, has a wider range of applications, and is simpler to operate. Its rapid amplification of DNA or RNA can be achieved at a lower temperature, with a fast reaction speed, and the amplified product can be obtained within 5-30 min. Based on the above advantages, RAA technology has shown great potential in pathogen detection. However, multiple detection of three pathogens, Vibrio parahaemolyticus, white spot syndrome virus, and shrimp hepatoenteroides, still faces many challenges. First, RAA technology requires a short amplified fragment (90-300 bp), which limits the range of selectable target genes. In order to achieve accurate detection of the three pathogens, it is necessary to conduct a comprehensive analysis of the gene sequences of the three pathogens and screen out highly conserved and species-specific target fragments to achieve the detection requirements of high amplification efficiency and strong specificity. Secondly, multiple detection requires the simultaneous amplification of the three pathogens in the same reaction system, which puts higher requirements on the compatibility of the primer-probe combination. In addition, this study innovatively introduced specific fluorescent probes in the multiple detection system to ensure the independent identification of different pathogen signals. The present invention overcomes the technical bottlenecks of RAA technology in target screening, multiple primer probe design and complex sample detection, and establishes a RAA-based method for detecting three pathogens, namely Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatoenteroides, providing an innovative solution for the rapid and accurate detection of Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatoenteroides. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a multiple detection method for Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatoenteroides based on RAA technology. The detection method is designed according to the gene fragment of Vibrio parahaemolyticus with accession number JQ929914.1, the gene fragment of white spot syndrome virus with accession number KR057961.1 and the gene fragment of shrimp hepatoenteroides with accession number KX981865.1, and a pair of specific RAA primers and a probe are screened for each pathogen, a positive plasmid is synthesized, and a fluorescent RAA reaction system is constructed to perform fluorescent RAA detection.

[0006] The technical solution of the present invention is as follows: The first object of the present invention is to provide a primer-probe combination for detecting three pathogens of Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatocellular carcinoma by recombinase-mediated amplification, wherein the primer-probe combination comprises: (1) Specific recombinase-mediated amplification primers and probes for detecting Vibrio parahaemolyticus: Forward Primer VP-F: 5'-CTTCATGTTGATGACACTGCCAGATGCGACGAA-3', as shown in SEQ ID NO.1; Reverse Primer VP-R: 5'-TTAGCGTCTCGAACAAGGCGTGAGTATCAAAC-3', as shown in SEQ ID NO.2; Probe VP-P: SEQ ID NO.7-iROXdT-T-idSp-G-iBHQ2dT- SEQ ID NO.8-C3-spacer connected in sequence from 5' to 3'; 5'-AGTACTCAACACAAGAAGAGATCGACAAAA-iROXdT-T-idSp-G-iBHQ2dT-GCGAAAGTGCTTGAG-C3-spacer-3'; Among them, "iROXdT" is a dT nucleotide labeled with ROX (maleimide) fluorescence, "idSp" refers to base deletion, "iBHQ2dT" is a dT nucleotide labeled with a BHQ2 quencher group, and "C3-spacer" refers to 3' hydroxyl blocking.

[0007] (2) Specific recombinase-mediated amplification primers and probes for detecting white spot syndrome virus: Forward Primer: WSSV-F: 5'-CATCGAAACCCACACAGGCAATATCGAGACA-3', as shown in SEQ ID NO. 3; Reverse Primer: WSSV-R: 5'-GATCCGCATCTTCTTCCTTCATCTGTGCATC-3', as shown in SEQ ID NO. 4; Probe WSSV-P: SEQ ID NO.9-iHEXdT-G-idSp-A-iBHQ1dT- SEQ ID NO.10-C3-spacer connected in sequence from 5' to 3'; 5'-AAACCTCCGCATTCCTGTGACTGCTGAGGT-iHEXdT-G-idSp-A-iBHQ1dT-CAGGCTACTTCAAGA-C3-spacer-3'.

[0008] Among them, "iHEXdT" is a dT nucleotide labeled with HEX (hexachlorofluorescein) fluorescence, "idSp" refers to base deletion, "iBHQ1dT" is a dT nucleotide labeled with a BHQ1 quencher group, and "C3-spacer" refers to 3' hydroxyl blocking.

[0009] (3) Specific recombinase-mediated amplification primers and probes for detecting shrimp hepatocellular carcinoma: Forward Primer: EHP-F: 5'-AGACACCGCTGTAGTTCTAGCAGTAAACTATGCC-3', as shown in SEQ ID NO. 5; Reverse Primer: EHP-R: 5'-CCGCGTTGAGTTAAATTAAGCAGCACAATCCAC-3', as shown in SEQ ID NO. 6; Probe EHP-P: SEQ ID NO.11-i6FAMdT-idSp-iBHQ1dT- SEQ ID NO.12-C3-spacer connected in sequence from 5' to 3'; 5'-ACAATGCTGGGTGTTGCGAGAGCGATGCTTGG-i6FAMdT-idSp-iBHQ1dT-GGGAGAAATCTTAGT-C3-spacer-3'.

[0010] Among them, "i6FAMdT" is a dT nucleotide labeled with FAM (carboxyfluorescein) fluorescence, "idSp" refers to base deletion, "iBHQ1dT" is a dT nucleotide labeled with a BHQ1 quencher group, and "C3-spacer" refers to 3' hydroxyl blocking.

[0011] The second object of the present invention is to provide the use of the above primer-probe combination in the preparation of a reagent or a kit for the detection of three pathogens, namely, Vibrio parahaemolyticus, White Spot Syndrome Virus and Enterocytosis of shrimp, by recombinase-mediated amplification.

[0012] The third object of the present invention is to provide a kit for detecting three pathogens, namely, Vibrio parahaemolyticus, White Spot Syndrome Virus and Enterocytosis spp., by recombinase-mediated amplification. The kit comprises the aforementioned primer-probe combination.

[0013] Furthermore, the kit also includes a recombinase-mediated amplification reagent, a buffer, deionized water and an activator.

[0014] Furthermore, the recombinase-mediated amplification reagent includes a recombinase, a DNA polymerase, a single-stranded DNA binding protein, dNTPs and an exonuclease; In a specific embodiment, the recombinase-mediated amplification reagent was purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd. (product model: WLE8202KIT).

[0015] The buffer solution is a PEG solution with a volume percentage of 20%; the activator is magnesium acetate with a molar concentration of 280 mM.

[0016] The fourth object of the present invention is to provide a multiplex detection method for three pathogens of Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatocystis based on RAA. The detection method performs target sequence screening according to gene fragments of Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatocystis, respectively, designs and screens a pair of specific RAA primers and a probe, constructs a fluorescent RAA reaction system, and performs fluorescent RAA detection. Specifically, the Vibrio parahaemolyticus gene fragment is a Vibrio parahaemolyticus TLH gene fragment, the white spot syndrome virus gene fragment is a white spot syndrome virus VP28 gene fragment, and the shrimp hepatocystis gene fragment is a shrimp hepatocystis 18S rRNA gene fragment.

[0017] The method comprises the following steps: S1, extracting total DNA from the tissue sample to be tested to obtain a DNA template; S2. Construction of fluorescent recombinase-mediated amplification reaction system: adding the aforementioned forward primer, reverse primer and probe to a recombinase-mediated amplification reaction unit containing a recombinase-mediated amplification reagent, and then adding the DNA template, buffer, deionized water and activator obtained in S1 to the recombinase-mediated amplification reaction unit to construct a fluorescent recombinase-mediated amplification reaction system; S3. Fluorescent recombinase-mediated amplification detection: Place the constructed recombinase-mediated amplification reaction system in a fluorescent quantitative PCR instrument to perform fluorescent recombinase-mediated amplification detection.

[0018] Furthermore, the system of fluorescent recombinase-mediated amplification detection in S3 is 50 μL, comprising: 2 μL of the forward primer, 2 μL of the reverse primer, 29.4 μL of buffer, 0.6 μL of the probe, 6 μL of the DNA template and 2.5 μL of the activator, which is supplemented to 50 μL with deionized water, mixed and transferred to the recombinase-mediated amplification reaction unit containing the recombinase-mediated amplification reagent.

[0019] Furthermore, in the fluorescent recombinase-mediated amplification detection system described in S3, the concentrations of the forward primer, reverse primer and probe are 10 μM.

[0020] Furthermore, the conditions of the fluorescent recombinase-mediated amplification detection described in S3 are: each reaction cycle is set to 30 seconds, the temperature is kept constant at 39° C., a total of 40 cycles are set, and the total reaction time is 20 minutes.

[0021] After the fluorescent recombinase-mediated amplification reaction system described in S2 is constructed, the reaction unit is inverted several times to fully mix the solution and centrifuge it. After the centrifugation, the fluorescent recombinase-mediated amplification detection is quickly performed.

[0022] The beneficial effects of the present invention are: The detection technology of Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatocellular carcinoma established by the present invention has certain advantages over the qPCR technology which is also a molecular detection technology. The present method can complete the whole detection process within 20 minutes, which greatly shortens the detection time; the minimum detection limit can reach 10 2 The method is based on constant temperature amplification technology, which overcomes the equipment limitations of traditional nucleic acid detection, simplifies the operation process, and is conducive to the detection of the three pathogens at the grassroots level, on-site or in resource-limited environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a graph showing the results of a primer specificity experiment on Vibrio parahaemolyticus in Example 3; Figure 2 This is a graph showing the results of a primer specificity experiment for white spot syndrome virus in Example 3; Figure 3 This is a graph showing the results of the shrimp hepatocellular carcinoma primer specificity experiment in Example 3; Figure 4 This is a graph showing the results of a multiplex detection experiment of three pathogens in Example 4; Figure 5 This is a graph showing the sensitivity detection results of the Vibrio parahaemolyticus gene in Example 5; Figure 6 This is a graph showing the sensitivity test results of the white spot syndrome virus gene in Example 5; Figure 7 This is a graph showing the sensitivity detection results of shrimp hepatocellular carcinoma genes in Example 5. DETAILED DESCRIPTION

[0024] The present invention is further explained below with reference to the examples, but the examples do not limit the present invention in any form.

[0025] The technical scheme of the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work belong to the scope of protection of the present invention. The materials, instruments and reagents used in the following examples, unless otherwise specified, can be obtained from commercial sources. The technical means used in the embodiments, unless otherwise specified, are conventional means well known to those skilled in the art.

[0026] The embodiments are described: RAA refers to: Recombinase Aided Amplification (RAA); PCR means: Polymerase Chain Reaction (PCR); AHPND refers to: Acute Hepatopancreatic Necrosis Disease (AHPND); EHP refers to: Enterocytozoon Hepatopenaei (EHP); HLV refers to: Highly Lethal Vibrio (HLV); TSV refers to: Taura Syndrome Virus (TSV); WSSV refers to: White Spot Syndrome Virus (WSSV); VP refers to: Vibrio Parahaemolyticus (VP); Recombinase-mediated amplification reagents were purchased from: Anpu Future (Changzhou) Biotechnology Co., Ltd., product number WLE8202KIT.

[0027] Example 1 Acquisition of specific RAA primers and probes and template DNA 1. Design of specific RAA primers and probes: The present invention selects target sequences through the TLH gene fragment of Vibrio parahaemolyticus, the VP28 gene fragment of white spot syndrome virus and the 18S rRNA gene fragment region of shrimp hepatocellular carcinoma respectively, uses software Oligo7 and SnapGene Viewer, and according to the primer design principle of RAA, the primer length is longer than that of conventional PCR primers, and also in order to avoid the appearance of dimers caused by too long primers, generally selected between 30-35bp. In addition, the CG base content at both ends of the primer is adjusted to avoid a large amount of G aggregation at the 5' end, increase the CG ratio at the 3' end, and complete the primer design in combination with manual work.

[0028] The names and sequences of the multiple RAA primers are as follows. The directions of the following sequences are all 5'-3': VP-F: CTTCATGTTGATGACACTGCCAGATGCGACGAA (SEQ ID NO. 1); VP-R: TTAGCGTCTCGAACAAGGCGTGAGTATCAAAC (SEQ ID NO. 2); The size of the VP amplification product is 190 bp.

[0029] WSSV-F: CATCGAAACCCACACAGGCAATATCGAGACA (SEQ ID NO.3); WSSV-R:GATCCGCATCTTCTTCCTTCATCTGTGCATC (SEQ ID NO.4); The size of the WSSV amplified product was 185 bp.

[0030] EHP-F: AGACACCGCTGTAGTTCTAGCAGTAAACTATGCC (SEQ ID NO. 5); EHP-R: CCGCGTTGAGTTAAATTAAGCAGCACAATCCAC (SEQ ID NO. 6); The size of the EHP amplification product was 191 bp.

[0031] The multiple RAA probe sequences and names are as follows. The following sequence directions are all 5'-3': VP-P: SEQ ID NO.7-iROXdT-T-idSp-G-iBHQ2dT- SEQ ID NO.8-C3-spacer; SEQ ID NO.7: AGTACTCAACACAAGAAGAGATCGACAAAA; SEQ ID NO.8: GCGAAAGTGCTTGAG; The VP-P sequence is: AGTACTCAACACAAGAAGAGATCGACAAAA-iROXdT-T-idSp-G-iBHQ2dT-GCGAAAGTGCTTGAG-C3-spacer; WSSV-P: SEQ ID NO.9-iHEXdT-G-idSp-A-iBHQ1dT- SEQ ID NO.10-C3-spacer; SEQ ID NO.9: AAACCTCCGCATTCCTGTGACTGCTGAGGT; SEQ ID NO.10: CAGGCTACTTCAAGA; The WSSV-P sequence is: AAACCTCCGCATTCCTGTGACTGCTGAGGT-iHEXdT-G-idSp-A-iBHQ1dT-CAGGCTACTTCAAGA-C3-spacer; EHP-P: SEQ ID NO.11-i6FAMdT-idSp-iBHQ1dT- SEQ ID NO.12-C3-spacer; SEQ ID NO.11:ACAATGCTGGGTGTTGCGAGAGCGATGCTTGG; SEQ ID NO.12: GGGAGAAATCTTAGT; The EHP-P sequence is: ACAATGCTGGGTGTCGAGAGCGATGCTTGG-i6FAMdT-idSp-iBHQ1dT-GGGAGAAATCTTAGT-C3-spacer.

[0032] 2. Obtaining template DNA: The DNA template used in the experiment was obtained by extracting the tissue samples of Penaeus vannamei using an aquatic animal nucleic acid extraction kit (Xingchun Biotechnology Co., Ltd.).

[0033] Example 2 Establishment of a triple detection method based on RAA The multiple RAA system is as follows: buffer 29.4 μL; ddH2O 7.5 μL; VP-F 0.6 μL; VP-R 0.6 μL; WSSV-F 0.9 μL; WSSV-R 0.9 μL; EHP-F 0.5 μL; EHP-R 0.5 μL; VP-P 0.2 μL; WSSV-P 0.2 μL; EHP-P 0.2 μL; VP DNA template 2 μL; WSSV DNA template 2 μL; EHP DNA template 2 μL and activator 2.5 μL, total volume 50 μL.

[0034] The concentration of forward primer, reverse primer and probe was 10 μM.

[0035] The above solution was added to the freeze-dried powder tube and gently blown and shaken to mix, centrifuged, and inverted several times to mix the liquid in the tube evenly for fluorescent RAA detection. The reaction was set to 30 seconds per cycle, the temperature was kept constant at 39°C, a total of 40 cycles were set, and the total reaction time was 20 minutes.

[0036] Example 3 RAA-based detection method specificity experiment 1. Vibrio parahaemolyticus specificity test DNA of AHPND, TSV, EHP, HLV, and WSSV were used as templates, and primers shown in SEQ ID NO.1 and SEQ ID NO.2 and VP-P probe were used for RAA amplification to detect the specificity of primers of Vibrio parahaemolyticus. The RAA system of Vibrio parahaemolyticus is as follows: buffer 29.4 μL; ddH2O 11.5 μL; VP-F 2 μL; VP-R 2 μL; VP-P 0.6 μL; VP DNA template 2 μL and activator 2.5 μL, total volume 50 μL.

[0037] The concentration of forward primer, reverse primer and probe was 10 μM.

[0038] The above solution was added to the freeze-dried powder tube and gently blown and shaken to mix, centrifuged, and inverted several times to mix the liquid in the tube evenly for fluorescent RAA detection. The conditions for recombinase-mediated amplification detection were: the reaction was set to 30 s per cycle, the temperature was kept constant at 39°C, a total of 40 cycles were set, and the total reaction time was 20 min.

[0039] The results are as follows Figure 1 As shown, 1 is the positive reference, 2 is AHPND, 3 is TSV, 4 is EHP, 5 is HLV, and 6 is WSSV. It can be seen that the five samples except the positive sample did not produce peaks after fluorescent RAA amplification. This result shows that the established method has good specificity.

[0040] 2. White spot syndrome virus specificity test The DNA of AHPND, TSV, EHP, HLV, and VP were used as templates, and the primers shown in SEQ ID NO.3 and SEQ ID NO.4 and the WSSV-P probe were used for RAA amplification to detect the specificity of the white spot syndrome virus primers. The white spot syndrome virus RAA system is as follows: buffer 29.4μL; ddH2O 11.5μL; WSSV-F 2μL; WSSV-R 2μL; WSSV-P 0.6μL; WSSV DNA template 2μL and activator 2.5μL, total volume 50μL.

[0041] The concentration of forward primer, reverse primer and probe was 10 μM.

[0042] The above solution was added to the freeze-dried powder tube and gently blown and shaken to mix, centrifuged, and inverted several times to mix the liquid in the tube evenly for fluorescent RAA detection. The conditions for recombinase-mediated amplification detection were: the reaction was set to 30 s per cycle, the temperature was kept constant at 39°C, a total of 40 cycles were set, and the total reaction time was 20 min.

[0043] The results are as follows Figure 2 As shown, 1 is the positive reference, 2 is AHPND, 3 is TSV, 4 is EHP, 5 is HLV, and 6 is VP. It can be seen that the five samples except the positive sample did not produce peaks after fluorescent RAA amplification. This result shows that the established method has good specificity.

[0044] 3. Shrimp hepatocellular carcinoma specificity test AHPND, TSV, HLV, VP, and WSSV DNA were used as templates for RAA amplification to detect the specificity of the shrimp hepatocystis primers. The shrimp hepatocystis RAA system is as follows: buffer 29.4μL; ddH2O 11.5μL; EHP-F 2μL; EHP-R 2μL; EHP-P 0.6μL; EHP DNA template 2μL and activator 2.5μL, total volume 50μL.

[0045] The concentration of forward primer, reverse primer and probe was 10 μM.

[0046] The above solution was added to the freeze-dried powder tube and gently blown and shaken to mix, centrifuged, and inverted several times to mix the liquid in the tube evenly for fluorescent RAA detection. The conditions for recombinase-mediated amplification detection were: the reaction was set to 30 s per cycle, the temperature was kept constant at 39°C, a total of 40 cycles were set, and the total reaction time was 20 min.

[0047] The results are as follows Figure 3As shown, 1 is the positive reference, 2 is AHPND, 3 is TSV, 4 is HLV, 5 is VP, and 6 is WSSV. It can be seen that the five samples except the positive sample did not produce peaks after fluorescent RAA amplification. This result shows that the established method has good specificity.

[0048] Example 4 Feasibility verification of multiple detection technology developed by the present invention After mixing the nucleic acids of the three pathogens VP, WSSV, and EHP, the nucleic acids of AHPND, TSV, and HLV were added as templates at the same time, and the multiple RAA system described in Example 2 was used for amplification reaction to verify the feasibility of simultaneous detection of the three pathogens and to verify the specificity of multiple detection.

[0049] The results are as follows Figure 4 As shown, 1 is VP, 2 is WSSV, 3 is EHP, 4 is AHPND, 5 is TSV, and 6 is HLV. This system can simultaneously amplify the three corresponding RAA products of VP, WSSV, and EHP. This result shows that the established method has good specificity.

[0050] Example 5 Sensitivity test of the multiple detection technology developed by the present invention 1. Sensitivity test of Vibrio parahaemolyticus In order to explore the minimum detection limit of fluorescent RAA for Vibrio parahaemolyticus, the reaction was carried out using Vibrio parahaemolyticus genomic DNA diluted with deionized water, and the concentration of genomic DNA was measured and converted into copy number.

[0051] The DNA of Vibrio parahaemolyticus was diluted to 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 A total of 6 concentrations of 100 copies / μL were used for sensitivity experiments.

[0052] The detection system and detection conditions are the same as those in Example 4 to verify the feasibility of multiple detection of the technology developed by the present invention.

[0053] like Figure 5 As shown, curves 1-6 represent 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1copies / μL of DNA sample and 7 as negative reference.

[0054] The results showed that this method can detect as low as 10 2 The genomic DNA of 10 copies / μL has excellent sensitivity and higher diagnostic value for low-density infections.

[0055] 2. Sensitivity test of white spot syndrome virus In order to explore the minimum detection limit of fluorescent RAA for white spot syndrome virus, the reaction was carried out using white spot syndrome virus genomic DNA diluted with deionized water, and the concentration of genomic DNA was measured and converted into copy number.

[0056] The white spot syndrome virus DNA was diluted to 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 A total of 6 concentrations of copies / μL were used for sensitivity experiments.

[0057] The detection system and detection conditions are the same as those in Example 4 to verify the feasibility of multiple detection of the technology developed by the present invention.

[0058] like Figure 6 As shown, curves 1-6 represent 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 copies / μL of DNA sample and 7 as negative reference.

[0059] The results showed that this method can detect as low as 10 2 The genomic DNA of 10 copies / μL has excellent sensitivity and higher diagnostic value for low-density infections.

[0060] 3. Sensitivity detection of shrimp hepatocellular carcinoma In order to explore the minimum detection limit of fluorescent RAA for shrimp hepatoenteric cysts, the genomic DNA of shrimp hepatoenteric cysts diluted with deionized water was used for the reaction, and the concentration of genomic DNA was measured and converted into copy number.

[0061] Dilute the DNA of shrimp hepatocystis to 106 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 A total of 6 concentrations of 100 copies / μL were used for sensitivity experiments.

[0062] The detection system and detection conditions are the same as those in Example 4 to verify the feasibility of multiple detection of the technology developed by the present invention.

[0063] like Figure 7 As shown, curves 1-6 represent 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL and 10 1 copies / μL of DNA sample and 7 as negative reference.

[0064] The results showed that this method can detect as low as 10 2 The genomic DNA of 10 copies / μL has excellent sensitivity and higher diagnostic value for low-density infections.

[0065] Copy number and concentration conversion formula: .

[0066] Example 6 Detection of on-site samples by fluorescence RAA method 100 samples of Litopenaeus vannamei tissues infected with Vibrio parahaemolyticus, white spot syndrome virus, and shrimp hepatoenterozoa were collected for fluorescence quantitative PCR amplification and RAA amplification. The instrument used was a fluorescence quantitative PCR instrument LC96. The fluorescence quantitative PCR reaction system and reaction conditions were as follows: the reaction system was 20 μL in total, including 10 μL of PCR mix; 5 μL of probe primers; and 5 μL of DNA template. The reaction conditions were first 37℃ contamination digestion for 2 minutes; then 95℃ pre-denaturation for 1 minute; and finally 95℃ 5s, 60℃ 30s as one cycle, for a total of 45 cycles.

[0067] The following table 1 is statistically obtained based on the test results of the fluorescence RAA method and the fluorescence quantitative PCR method: Table 1 Results of the 100 samples tested by fluorescence quantitative PCR and fluorescence RAA Detection Methods Fluorescence quantitative PCR VP positive Fluorescence quantitative PCR WSSV positive Fluorescence quantitative PCR EHP positive Fluorescence quantitative PCR negative Fluorescent RAA VP positive 42 1 6 2 Fluorescent RAA WSSV positive 1 10 2 0 Fluorescent RAA EHP positive 6 2 28 0 Fluorescent RAA negative 0 0 0 18 In summary, the detection results of the two methods were highly consistent, and there was no statistical difference in the detection rate. There were only 2 samples with inconsistent test results, which showed that the fluorescence RAA method was more sensitive and could detect samples with lower concentrations.

[0068] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination for recombinase-mediated amplification detection of three pathogens: Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatocellular carcinoma, characterized in that: The primer-probe combination comprises: (1) Specific recombinase-mediated amplification primers and probes for detecting Vibrio parahaemolyticus: Forward Primer: 5'-CTTCATGTTGATGACACTGCCAGATGCGACGAA-3'; Reverse Primer: 5'-TTAGCGTCTCGAACAAGGCGTGAGTATCAAAC-3'; Probe: 5'-AGTACTCAACACAAGAAGAGATCGACAAAA-iROXdT-T-idSp-G-iBHQ2dT-GCGAAAGTGCTTGAG-C3-spacer-3'; (2) Specific recombinase-mediated amplification primers and probes for detecting white spot syndrome virus: Forward Primer: 5'-CATCGAAACCCACACAGGCAATATCGAGACA-3'; Reverse Primer: 5'-GATCCGCATCTTCTTCCTTCATCTGTGCATC -3'; Probe: 5'-AAACCTCCGCATTCCTGTGACTGCTGAGGT-iHEXdT-G-idSp-A-iBHQ1dT-CAGGCTACTTCAAGA-C3-spacer-3'; (3) Specific recombinase-mediated amplification primers and probes for detecting shrimp hepatocellular carcinoma: Forward Primer: 5'-AGACACCGCTGTAGTTCTAGCAGTAAACTATGCC-3'; Reverse Primer: 5'-CCGCGTTGAGTTAAATTAAGCAGCACAATCCAC-3'; Probe: 5'-ACAATGCTGGGTGTTGCGAGAGCGATGCTTGG-i6FAMdT-idSp-iBHQ1dT-GGGAGAAATCTTAGT-C3-spacer-3'.

2. Use of the primer-probe combination according to claim 1 in the preparation of a reagent or a kit for detecting three pathogens, namely, Vibrio parahaemolyticus, White Spot Syndrome Virus and Enterocytosis of Shrimp by recombinase-mediated amplification.

3. A kit for detecting three pathogens, namely, Vibrio parahaemolyticus, white spot syndrome virus and shrimp hepatocellular carcinoma, by recombinase-mediated amplification, characterized in that: The kit comprises the primer-probe combination according to claim 1.

4. The kit according to claim 3, characterized in that The kit also includes a recombinase-mediated amplification reagent, a buffer, deionized water and an activator.

5. The kit according to claim 4, characterized in that The recombinase-mediated amplification reagent comprises recombinase, DNA polymerase, single-stranded DNA binding protein, dNTP and exonuclease; the buffer is a PEG solution with a volume percentage of 20%; and the activator is magnesium acetate with a molar concentration of 280mM.

Images