PCR primer, kit and detection method for rapidly identifying whether sugarcane contains chromosome 3 of erianthus spp.

Abstract

The application discloses a PCR primer, a kit and a detection method for rapidly identifying whether sugarcane contains Chromosome 3 of Eremochloa ophiuroides. The PCR primer is TaChr03-F / R, and the nucleotide sequences of the primer are shown as SEQ ID NO:1-2. The PCR primer can be used to rapidly detect whether sugarcane material contains Chromosome 3 of Eremochloa ophiuroides by using common PCR technology. The detection method has high efficiency, good stability and simple operation, and has strong practicability and generalization.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology technology, and particularly relates to a PCR primer, kit and detection method for rapidly identifying whether sugarcane contains Chromosome 3 of Erianthus arundinaceum. BACKGROUND

[0002] Sugarcane is an important sugar crop and energy crop, and its yield and quality are of great significance to global sugar industry and bioenergy production. As a wild relative of sugarcane, Erianthus arundinaceum has high biomass, wide adaptability, drought tolerance, disease and pest resistance, vigorous growth, and good ratooning ability, and is considered as an important germplasm resource for creating new sugarcane germplasm and breeding new sugarcane varieties. However, the precise composition and chromosome inheritance of Erianthus arundinaceum in the offspring of sugarcane and Erianthus arundinaceum hybridization are still unclear. In the hybridization breeding process of sugarcane and Erianthus arundinaceum, Erianthus arundinaceum chromosomes and sugarcane chromosomes cannot completely pair, and there is a phenomenon of chromosome loss. With the increase of backcross generations, Erianthus arundinaceum chromosomes will gradually decrease. Therefore, it is of great application value to establish a rapid and efficient method for identifying Erianthus arundinaceum genetic material in the hybridization breeding of sugarcane and Erianthus arundinaceum.

[0003] Traditional chromosome identification methods, such as cytogenetic techniques, can provide detailed chromosome structure information, but they are complex, time-consuming and require professional equipment and personnel. In recent years, with the rapid development of molecular biology technology, polymerase chain reaction (PCR) technology has gradually become the preferred method for identifying specific chromosomes or genes due to its high sensitivity, specificity and rapidity. However, no PCR identification method for sugarcane containing Erianthus arundinaceum Chromosome 3 has been developed yet. Therefore, it is of great theoretical and practical significance to develop a rapid, accurate and easy-to-operate PCR primer, kit and detection method for improving sugarcane breeding efficiency and accelerating the breeding of excellent varieties. SUMMARY

[0004] The purpose of the present application is to provide a PCR primer, kit and detection method for rapidly identifying whether sugarcane contains Erianthus arundinaceum Chromosome 3. The present application can stably detect whether sugarcane material contains Erianthus arundinaceum Chromosome 3 through a conventional ordinary PCR reaction program, and the effect is remarkable.

[0005] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0006] The present application provides a PCR primer for rapidly identifying whether sugarcane contains Erianthus arundinaceum Chromosome 3, and the sequence of the PCR primer is:

[0007] TaChr03-F: GCTCATCATTGCTAATAGTGGATGC;

[0008] TaChr03-R: CGCCAATAGGAAATCATTCAAGCAC.

[0009] The application further provides a kit for rapidly identifying whether sugarcane contains Chromosome 3 of Eremochloa ophiuroides, which comprises the PCR primer.

[0010] The application further provides application of the PCR primer and the kit in rapid identification of whether sugarcane contains Chromosome 3 of Eremochloa ophiuroides.

[0011] The application further provides application of the PCR primer and the kit in sugarcane breeding.

[0012] A method for rapidly identifying whether sugarcane contains Chromosome 3 of Eremochloa ophiuroides, comprising the following steps:

[0013] (1) Extracting genomic DNA of a leaf of sugarcane material by a CTAB method;

[0014] (2) PCR amplification: taking the genomic DNA obtained in step (1) as a template, performing PCR amplification by using the primers TaChr03-F and TaChr03-R, and identifying whether the sugarcane contains Chromosome 3 of Eremochloa ophiuroides according to a result of agarose gel electrophoresis detection.

[0015] Further, a reaction system of the PCR amplification is 2x PCR Mix 12.5 μL, 2 μL TaChr03-F, 2 μL TaChr03-R, 100 ng / μL genomic DNA 2 μL and 6.5 μL ddH2O.

[0016] Further, a reaction procedure of the PCR amplification is: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 2 min, cycling for 35 times; 72 °C terminal extension for 3 min, and 4 °C preservation.

[0017] Further, when the agarose gel electrophoresis result presents a 1650 bp band, it indicates that the sugarcane contains Chromosome 3 of Eremochloa ophiuroides, and if the agarose gel electrophoresis result does not present a 1650 bp band, it indicates that the sugarcane does not contain Chromosome 3 of Eremochloa ophiuroides.

[0018] The application has the following beneficial effects:

[0019] (1) High efficiency: the method of the application can rapidly detect whether sugarcane material contains Chromosome 3 of Eremochloa ophiuroides by only extracting leaf DNA of seedlings.

[0020] (2) Good stability: with the use of Eremochloa in sugarcane breeding, no stable molecular marker for identifying the authenticity of the offspring of the cross between the higher generation of sugarcane and Eremochloa has been found, but the method can stably detect whether the sugarcane material contains Eremochloa chromosome 3 through the previous test.

[0021] (3) Low cost and simple operation: the common PCR technology can be used to detect whether the sugarcane material contains Eremochloa chromosome 3, and only the genomic DNA needs to be extracted through the common PCR amplification detection in the early stage, which has strong practicability and good popularization. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 Figure 4 is the result of chromosome identification of Eremochloa offspring 1849-10 by using GISH and Oligo-FISH; wherein a: red Chr1 and green Chr2; b: red Chr3 and green Chr4; c: red Chr5 and green Chr6; d: red Chr7 and green Chr8; e: red Chr9 and green Chr10; f: Eremochloa and Saccharum spontaneum; the size of the scale is 5 μm.

[0023] Figure 2 Figure 5 is the result of specific detection of TaChr03-F / R; wherein 1-10 correspond to different templates, M: 2000bpMarker; 1: 1723-13; 2: 1849-09; 3: 1849-29; 4: 1891-27; 5: 1891-71; 6: Hainan92-77; 7: Yunnan82-114; 8: Badila; 9: ROC22; 10: ddH2O

[0024] Figure 3 Figure 6 is the stability detection of TaChr03-F / R primer, wherein 1-24 correspond to different templates, 1: 1723-02; 2: 1723-13; 3: 1723-28; 5: 1723-39; 5: 1723-42; 6: 1849-09; 7: 1849-10; 8: 1849-14; 9: 1849-32; 10: 1849-54; 11: 1891-06; 12: 1891-12; 13: 1891-16; 14: 1891-20; 15: 1891-67; 16: Hainan92-77; 17: Hainan92-105; 18: Yunnan82-114; 19: Yunnan82-110; 20: Badila; 21: Hecheliuben; 22: ROC22; 23: Liucheng05-136; 24: ddH2O. DETAILED DESCRIPTION

[0025] In order to make the content of the present application more convenient to understand, the technical solutions of the present application are further described below in combination with specific examples. The examples are intended to exemplarily describe the present application, rather than limit the present application in any form.

[0026] Example 1

[0027] 1. Detection materials

[0028] Table 1 is a total of 9 sugarcane materials including Hsw 1, Hsw 2, Hsw 3, Hsw 4, Hsw 5, Hsw 6, Hsw 7, Hsw 8, and Hsw 9, for detecting the specificity of primers TaChr03-F / R in Hsw and sugarcane materials.

[0029] Table 2 is a total of 23 sugarcane materials including Hsw 1, Hsw 2, Hsw 3, Hsw 4, Hsw 5, Hsw 6, Hsw 7, Hsw 8, Hsw 9, Hsw 10, Hsw 11, Hsw 12, Hsw 13, Hsw 14, Hsw 15, Hsw 16, Hsw 17, Hsw 18, Hsw 19, Hsw 20, Hsw 21, Hsw 22, and Hsw 23, for detecting the stability of primers TaChr03-F / R in Hsw and sugarcane materials.

[0030] It has been detected by previous GISH and Oligo-FISH results whether the Hsw hybrid offspring possesses the 3rd Hsw chromosome. For example, 1849-10, the specific detection technology effect is shown in Table 3. Figure 1

[0031] Table 1 Specificity detection materials

[0032]

[0033] Table 2 Stability detection materials

[0034]

[0035] 2. Detection steps

[0036] (1) Extraction of gDNA of sugarcane materials: The genomic DNA of the sugarcane leaves in Table 1 and Table 2 is extracted by CTAB method. The extracted genomic DNA is detected by a microplate reader, and the OD260 / OD280 ratio should be between 1.8-2.0, and is stored in a -20℃ refrigerator for use.

[0037] (2) PCR amplification and detection: The sequences of the PCR primers are as follows:

[0038] TaChr03-F: GCTCATCATTGCTAATAGTGGATGC (SEQ ID NO: 1);

[0039] TaChr03-R: CGCCAATAGGAAATCATTCAAGCAC (SEQ ID NO: 2).

[0040] ​PCR amplification was performed using the above primers, and the total reaction system was 25 μl. The specific reaction system was as follows: 2x PCR Mix 12.5 μl, 2 μl TaChr03-F, 2 μl TaChr03-R, 100 ng / μl genomic DNA 2 μl, and 6.5 μl ddH2O. The preparation of the reaction system was performed on ice. The PCR reaction program was as follows:

[0041] 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, 55 °C annealing for 30 s, 72 °C extension for 2 min, 35 cycles; 72 °C final extension for 3 min, 4 °C storage. Detection was performed by 1.5% agarose gel electrophoresis, and photographic analysis was performed by using a gel imaging instrument. The sample material that could amplify the target fragment was the material containing the 3rd chromosome of Saccharum spontaneum.

[0042] (3) Analysis of gel electrophoresis results

[0043] The PCR amplification results of 9 sugarcane materials in Table 1 are shown in Figure 2 It was found that TaChr03-F / R had specificity, and the material containing the 3rd chromosome of Saccharum spontaneum produced a clear target band at 1650 bp (TaChr03, SEQ ID NO: 3).

[0044] The PCR amplification results of 23 sugarcane materials and water in Table 2 are shown in Figure 3 The results showed that the specific fragment (SEQ ID NO: 3) was amplified in Saccharum spontaneum, but not in the sugarcane materials without Saccharum spontaneum blood relationship, indicating that the specificity of the Saccharum spontaneum specific molecular marker TaChr03-F / R was good, and it could be used as a Saccharum spontaneum specific molecular marker to determine whether the sugarcane material contained the 3rd chromosome of Saccharum spontaneum.

[0045] The nucleotide sequence of TaChr03 is as follows:

[0046]

[0047] The above description is only the preferred embodiment of the present application, and any equivalent change and modification made according to the scope of the present application should be included in the scope of the present application.

Claims

1. A PCR primer for rapid identification of whether sugarcane contains chromosome 3 of Imperata cylindrica, characterized in that: The sequence of the PCR primer is: TaChr03-F: GCTCATCATTGCTAATAGTGGATGC; TaChr03-R: CGCCAATAGGAAATCATTCAAGCAC.

2. A kit for rapid identification of the presence of Chromosome 3 of Erianthus arundinaceus in sugarcane, characterized by: The kit comprises the primer of claim 1.

3. The PCR primer of claim 1 or the kit of claim 2 is applied to rapidly identify whether the sugarcane contains the chromosome 3 of Erianthus arundinaceum.

4. The PCR primer of claim 1 or the kit of claim 2 is applied to the breeding of sugarcane.

5. A method for rapid identification of sugarcane plants containing Chromosome 3 of Eragrostis plana, characterized by: The method comprises the following steps: (1) Extracting the genomic DNA of the leaf of the sugarcane material by the CTAB method; (2) PCR amplification: taking the genomic DNA obtained in step (1) as the template, and performing PCR amplification by using the primers TaChr03-F and TaChr03-R, and identifying whether the sugarcane contains the chromosome 3 of Erianthus arundinaceum according to the detection result of the agarose gel electrophoresis; the sequence of the primers TaChr03-F and TaChr03-R is: TaChr03-F: GCTCATCATTGCTAATAGTGGATGC; TaChr03-R: CGCCAATAGGAAATCATTCAAGCAC.

6. The method for rapid identification of sugarcane plants containing Chromosome 3 of E. arundinacea according to claim 5, characterized by the fact that: The reaction system of the PCR amplification is 2x PCR Mix 12.5 μL, 2 μL TaChr03-F, 2 μL TaChr03-R, 100 ng / μL genomic DNA 2 μL and 6.5 μL ddH2O.

7. The method for rapid identification of sugarcane plants containing Chromosome 3 of E. arundinacea according to claim 5, characterized by the fact that: The reaction procedure of the PCR amplification is: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 2 min, cycling for 35 times; 72°C terminal extension for 3 min, and 4°C preservation.

8. The method for rapid identification of sugarcane plants containing Chromosome 3 of E. arundinacea according to claim 5, characterized by the fact that: When the agarose gel electrophoresis result presents a 1650 bp band, it indicates that the sugarcane contains the chromosome 3 of Erianthus arundinaceum, and if the agarose gel electrophoresis result does not present a 1650 bp band, it indicates that the sugarcane does not contain the chromosome 3 of Erianthus arundinaceum.

Images