Universal reference gene, primer probe and kit for fish pathogen nucleic acid amplification detection and application of universal reference gene, primer probe and kit

Abstract

The invention discloses a universal reference gene for fish pathogen nucleic acid amplification detection. The universal reference gene is a true bone total target tRNA gene. The invention also provides a primer probe for detecting the general reference gene, a kit comprising the primer probe, and application of the primer probe in preparation of a fish pathogen nucleic acid amplification detection reagent. The detection primer probe provided by the invention overcomes the defect that a common reference gene primer can only adapt to one kind of fish, is universal to various kinds of fish and various tissues, is not interfered by other nucleic acids of a genome, simplifies the detection process, greatly improves the detection efficiency, and saves the development cost of a reagent.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological detection, and particularly relates to a universal internal reference gene, a primer probe, a kit and applications thereof for nucleic acid amplification detection of fish pathogens. Background Art

[0002] Fish pathogen infection not only has a significant impact on aquaculture, but many zoonotic pathogens also endanger human health. In order to prevent and treat pathogenic diseases, PCR technology is widely used in the field of animal disease detection. In order to improve the detection quality of PCR, it is necessary to introduce internal reference gene detection.

[0003] Since the PCR detection process involves many experimental processes, including clinical sample collection, sample storage and transportation, nucleic acid extraction, and PCR reaction, any operation error in any step may lead to nucleic acid degradation or excessive inhibitors causing amplification reaction failure, which may lead to false negative experiments. If endogenous reference genes are detected, the nucleic acid of endogenous genes in the sample can be detected while PCR is diagnosing pathogens. This can effectively control the quality of the entire experimental process, including clinical sample collection, sample storage and transportation, nucleic acid extraction, and PCR reaction, and eliminate experimental operation errors, reagent failures, and reaction failures. False negatives can be avoided to a certain extent, and the reliability of diagnostic results can be improved.

[0004] Many pathogens can use a variety of fish as hosts, such as rhabdovirus, neuronecrosis virus, herpes virus, Vibrio, Nocardia, etc. Therefore, when conducting fish pathogen PCR monitoring, it may be necessary to test samples from a variety of fish. Internal reference primers that can be applied to a variety of fish have strong practical value.

[0005] It is easy to design dedicated internal reference primers for PCR testing of specific fish species. For example, the recognized 18s RNA gene is highly conserved in multiple species, and appropriate regions can be selected to design DNA internal reference gene primers for specific species. However, these genes may not be applicable to other fish. Designing specific internal reference primer probes for each fish is time-consuming and labor-intensive, increasing various costs.

[0006] At present, the commonly used internal reference quality control method is to add exogenous genes or pseudoviruses containing exogenous genes after the sample is transported to the laboratory, before nucleic acid extraction or before PCR. This method cannot effectively monitor the upstream sample collection, transportation and storage, and nucleic acid extraction process, and it adds additional experimental operation steps and material costs. Summary of the invention

[0007] In view of the above technical problems to be solved, one object of the present invention is to provide a universal internal reference gene suitable for nucleic acid amplification detection of fish pathogens, which can be used for a variety of fish and a variety of tissues, is not interfered by other nucleic acids in the genome, and has a high detection efficiency.

[0008] Another object of the present invention is to provide a primer probe for detecting the universal internal reference gene.

[0009] Another object of the present invention is to provide a kit comprising the primer probe.

[0010] Another object of the present invention is to provide application of the primer probe.

[0011] In order to achieve the above invention objectives, the present invention provides a universal internal reference gene for nucleic acid amplification detection of fish pathogens, wherein the universal internal reference gene is a tRNA gene of the Euostriatus order.

[0012] On the other hand, the present invention also provides a primer probe for detecting the universal internal reference gene, the primer probe comprising:

[0013] Upstream primer: 5′-CCTCGTTAGTATAGTGGACAGT-3′;

[0014] Downstream primer: 5′-CGTCGGGGAATCGAACC-3′;

[0015] Probe: 5'-VIC-CGCCTGTCACGCGGAAGACCG-BHQ1-3'.

[0016] On the other hand, the present invention also provides the use of the primer probe in preparing a fish pathogen nucleic acid amplification detection kit.

[0017] Preferably, the fish includes any one or more of sea bass, California sea bass, grouper, mandarin fish, crucian carp, grass carp, snakehead fish, koi, tilapia, yellow catfish, golden pomfret, salmon, eel, and channel catfish.

[0018] Preferably, the pathogens include any one or more of viruses, bacteria, and parasites.

[0019] Preferably, the pathogen is any one or more of rhabdovirus, infectious spleen and kidney necrosis virus, neuronecrosis virus, herpes virus, iridovirus, Luohu virus, reovirus, infectious hematopoietic necrosis virus, viral hemorrhagic septicemia virus, infectious pancreatic necrosis virus, epidemic hematopoietic necrosis virus, carp spring virus, carp edema virus, salmon alphavirus, calicivirus, descaling virus, Vibrio, Flavobacterium columnaris, Nocardia, Yersinia ruckeri, Pseudomonas proteus, Cryptocaryon irritans, Ichthyophthirius, Wheelworm, and Botoworm.

[0020] Preferably, in the application, the reaction system for nucleic acid amplification detection is 25 μL: 5×Probe qPCR Buffer 5 μL, 10×HA buffer 2.5 μL, High Affinity HotStart Taq Enzyme 0.4 μL, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, 10 μM probe 0.4 μL, nuclease-free water 10.7 μL, and DNA template 5 μL.

[0021] Preferably, in the application, the reaction conditions for nucleic acid amplification detection are: denaturation at 95°C for 5 min; 95°C for 15 s, 61°C for 30 s, and 45 cycles.

[0022] On the other hand, the present invention also provides a kit for nucleic acid amplification detection of fish pathogens, the kit comprising the primer probe according to the present invention.

[0023] Preferably, the nucleic acid amplification detection is DNA pathogen detection or RNA pathogen amplification detection.

[0024] Preferably, the nucleic acid amplification detection is any one of real-time fluorescence quantitative PCR detection, conventional PCR detection, loop-mediated isothermal amplification detection, nucleic acid sequence-dependent amplification detection, rolling circle amplification detection, single primer isothermal amplification detection, helicase-dependent DNA isothermal amplification, recombinase polymerase amplification, and chain replacement amplification.

[0025] Preferably, the kit is used to amplify nucleic acids extracted from fish tissues.

[0026] The internal reference gene selected by the present invention is the tRNA (transfer RNA) of the order Teleostei. Because tRNA has sequence conservation: tRNA molecules have a well-defined sequence conservation, which reflects the need to maintain their structure and function during the translation process. Although there are a large number of tRNA genes, specific tRNA sequence motifs are highly conserved in multicellular eukaryotes; tRNA has evolutionary conservation: evolutionary studies of tRNA sequences have shown that tRNA sequences are conserved during evolution, which may be related to their key functions in protein synthesis. The order Teleostei belongs to a superorder in the subclass Actinopterygii, is the highest species in the subclass Actinopterygii, and is also the superorder with the largest number and the highest economic value among the existing fish in the world today. The internal and external structures of teleost fish have perfect aquatic adaptation structures. Since the Cretaceous period, they have developed along many radiation adaptation routes, making them the inhabitants of all waters on the surface of the earth. Almost all bony fishes belong to the ancient bony fishes, including the common black carp, grass carp, silver carp, carp, yellow croaker, seahorse, sardines, mandarin fish, and sea bass.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] (1) The present invention proposes to establish a universal internal reference gene in the PCR detection of fish nucleic acid pathogens, and uses the true bone total target tRNA gene as a universal internal reference gene for PCR detection of fish pathogen nucleic acid.

[0029] (2) The detection primer probe for the universal reference gene proposed in the present invention overcomes the defect that the common reference gene primers can only be adapted to one type of fish, so that the kit using the primers is universal for multiple fish and multiple tissues, is not interfered by other genomic nucleic acids, and can be applied to the detection of multiple fish internal references, which greatly increases the sample application range, improves the detection efficiency, and saves the reagent development cost.

[0030] (3) The present invention uses endogenous reference gene detection, which does not require the addition of exogenous genes or pseudoviruses containing exogenous genes before nucleic acid extraction or before PCR, thereby simplifying the experimental operation process and reducing material costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The test results of the amplification efficiency of the first set of primer probes designed in Example 2 are shown.

[0032] Figure 2 The test results of the amplification efficiency of the second set of primer probes designed in Example 2 are shown.

[0033] Figure 3 The test results of the amplification efficiency of the third set of primer probes designed in Example 2 are shown.

[0034] Figure 4 The test results of the amplification efficiency of the fourth set of primer probes designed in Example 2 are shown.

[0035] Figure 5 The test results of the amplification efficiency of the fifth set of primer probes designed in Example 2 are shown.

[0036] Figure 6 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acid extracted from sea bass muscle tissue is shown.

[0037] Figure 7 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from muscle tissue of California seabass are shown.

[0038] Figure 8 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from grouper muscle tissue is shown.

[0039] Fig. 9 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acid extracted from muscle tissue of mandarin fish is shown.

[0040] Fig.10 The amplification pattern of the first group of primer probes and the second group of primer probes in Example 3 for qPCR detection of nucleic acid extracted from crucian carp muscle tissue is shown.

[0041] Fig.11 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acid extracted from grass carp muscle tissue is shown.

[0042] Fig.12 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from the muscle tissue of Channa argus are shown.

[0043] Fig.13 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from koi muscle tissue are shown.

[0044] Fig.14 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acid extracted from tilapia muscle tissue is shown.

[0045] Fig.15 The amplification pattern of the first group of primer probes and the second group of primer probes in Example 3 for qPCR detection of nucleic acid extracted from muscle tissue of yellow catfish is shown.

[0046] Fig.16 The amplification map of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acid extracted from muscle tissue of golden pomfret is shown.

[0047] Fig.17 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from salmon and trout muscle tissues are shown.

[0048] Fig.18 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from eel muscle tissue are shown.

[0049] Fig.19 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from channel catfish muscle tissue are shown.

[0050] Fig. 20The amplification pattern of qPCR detection of nucleic acids extracted from the gills, liver, kidney and spleen tissues of mandarin fish in Example 4 is shown.

[0051] Fig.21 The amplification pattern of qPCR detection of carp herpesvirus (KHV) challenge samples in Example 5 is shown.

[0052] Fig. 22 The amplification pattern of RT-qPCR detection of infectious hematopoietic necrosis virus (IHNV) samples in Example 5 is shown.

[0053] Fig.23 The amplification pattern of RT-qPCR detection of viral hemorrhagic septicemia virus (VHSV) samples in Example 5 is shown. DETAILED DESCRIPTION

[0054] In order to more clearly illustrate the technical solution of the present invention and make the above-mentioned purposes, features and advantages of the embodiments of the present invention more obvious and understandable, the following will be described in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to illustrate the present invention, and are not used to limit the scope of the present invention.

[0055] Unless otherwise specified, the materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels.

[0056] Example 1 - Candidate gene screening

[0057] The present invention downloads various tRNA sequences of teleosts from NCBI, and first compares the reference gene databases of sea bass, California bass, grouper, mandarin fish, crucian carp, grass carp, snakehead, koi, tilapia, yellow catfish, golden pomfret, salmon, eel, and channel catfish by bioinformatics methods to screen out highly conservative tRNA gene fragments, and highly conservative tRNA sequences with a consistency rate greater than 97% in the database can be used as candidate genes, and finally 5 target genes are screened out. The nucleotide sequences of the 5 candidate genes are shown in Table 1 below.

[0058] Table 1. Nucleotide sequences of candidate genes

[0059]

[0060] Example 2 - Primer screening and testing

[0061] According to the five candidate internal reference genes screened in Example 1, upstream and downstream primers were designed. In addition to meeting the general requirements for primer design, it was also required that the primer probes had no more than one base mismatch with the gene sequences of various fish. One set of primer probes was designed for each gene. The sequences of the five sets of primer probes are shown in Table 2 below.

[0062] Table 2. Primer probes for 5 candidate genes

[0063]

[0064] The specific probe of the candidate internal reference gene carries a VIC fluorescent reporter group and a BHQ1 fluorescent quencher group at its 5' end and 3' end, respectively.

[0065] The primer probes and plasmids to be screened were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the plasmids were used for amplification efficiency testing. The synthesized plasmid was 5 μg, and its total copy number was calculated according to the following formula:

[0066]

[0067] In this example, the total plasmid copy number was determined by the above method, and then the plasmid copy number was calibrated by a 10-fold gradient dilution method. 0 copies / μL to 1×10 5 The copies / μL plasmid copy number was used as a template to determine the amplification efficiency of each primer probe.

[0068] qPCR amplification was performed using the High Affinity HotStart Taq kit (Tiangen, ET108-02). A 25 μL reaction system was prepared according to the instructions: 5 μL 5×Probe qPCR Buffer, 2.5 μL 10×HA buffer, 0.4 μL High Affinity HotStart Taq Enzyme, 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), 0.4 μL probe (10 μM), 10.7 μL nuclease-free water, and 5 μL DNA template.

[0069] The reaction was carried out on an ABI7500 real-time fluorescence quantitative PCR instrument (Applied Biosystems, USA) under the following reaction conditions: denaturation at 95°C for 5 min, 95°C for 15 s, 61°C for 30 s, and 45 cycles.

[0070] The results are as follows Figures 1 to 5 shown. Figure 1 The results of the amplification efficiency test of the first set of primer probes (primer-1) are shown. Figure 2 The results of the amplification efficiency test of the second set of primer probes (primer-2) are shown. Figure 3 The results of the amplification efficiency test of the third set of primer probes (primer-3) are shown. Figure 4 The results of the amplification efficiency test of the 4th set of primer probes (primer-4) are shown. Figure 5The results of the amplification efficiency test of the fifth set of primer probes (primer-5) are shown. The results show that the amplification efficiency of the five pairs of primer probes is between 90% and 110%, R 2 The values ​​were all above 0.99, meeting the preliminary screening requirements for PCR primers and probes.

[0071] Example 3-Testing of primer probes in different fish species

[0072] The five sets of primer probes selected according to Example 2 were further tested to verify their amplification effects in different fish species.

[0073] The muscle tissues of sea bass, California sea bass, grouper, mandarin fish, crucian carp, grass carp, snakehead fish, koi, tilapia, yellow catfish, golden pomfret, salmon, eel, and channel catfish were cut into pieces, homogenized with nucleic acid pretreatment solution, and nucleic acid was extracted using a nucleic acid extraction kit (TIANGEN DNA / RNA AllPrep Kit, catalog number DP422).

[0074] The High Affinity HotStart Taq (Tiangen, ET108-02) kit was used for qPCR amplification. A 25 μL reaction system was prepared according to the instructions: 5 μL 5×Probe qPCR Buffer, 2.5 μL 10×HA buffer, 0.4 μL High Affinity HotStart Taq Enzyme, 0.5 μL forward primer (10 μM), 0.5 μL reverse primer (10 μM), 0.4 μL probe (10 μM), 10.7 μL nuclease-free water, and 5 μL DNA template.

[0075] The reaction was carried out on a fluorescent quantitative PCR instrument (Macrostone, SLAN-48P) under the following conditions: denaturation at 95°C for 5 min; 95°C for 15 s, 61°C for 30 s, and 45 cycles.

[0076] The final amplification analysis results are as follows Figures 6 to 19 shown. Figures 6 to 19 The amplification patterns of qPCR detection of nucleic acids extracted from muscle tissues of sea bass, California sea bass, grouper, mandarin fish, crucian carp, grass carp, snakehead carp, koi, tilapia, yellow catfish, golden pomfret, salmon, eel, and channel catfish using primer probes designed according to candidate gene 1 and candidate gene 2 are shown respectively.

[0077] The primer probe of candidate gene 1 is marked as 1, and the primer probe of candidate gene 2 is marked as 2. It can be seen that the two sets of primer probes 1 and 2 designed according to candidate gene 1 and candidate gene 2 have good amplification effects on the muscle tissues of various common fish such as sea bass, California bass, grouper, mandarin fish, crucian carp, grass carp, black snakehead, koi, tilapia, yellow catfish, golden pomfret, salmon, eel, channel catfish, etc. The amplification results of the other three candidate genes are relatively poor, not as good as candidate gene 1 and candidate gene 2 (not shown in the figure). Therefore, the two sets of primer probes of candidate gene 1 and candidate gene 2 are selected for subsequent testing.

[0078] Example 4 - Tests in different tissues of mandarin fish

[0079] The experimental conditions of Example 3 were adopted, and DNA was extracted from the gills, liver, kidney and spleen tissues of mandarin fish using the two sets of primer probes of candidate gene 1 and candidate gene 2, and then qPCR detection was performed, with 2 replicates for each sample.

[0080] Test results such as Fig. 20 As shown. Fig. 20 It can be seen that these two sets of primer probes can amplify DNA extracted from the gills, liver, kidney and spleen tissues of mandarin fish. The Ct value range of the primer probe of candidate gene 1 is 19.5-23.5, and the Ct value range of the primer probe of candidate gene 2 is 17.5-21.5. These two sets of primer probes can amplify nucleic acids from different organs and tissues of mandarin fish. In comparison, the Ct value of the primer probe pair of candidate gene 2 is smaller. In order to meet the subsequent applicability to different tissues of various fish, the primer probe of candidate gene 2 is preferred for subsequent testing.

[0081] Example 5 - Tests on samples challenged with carp herpesvirus (KHV), infectious hematopoietic necrosis virus (IHNV), and viral hemorrhagic septicemia virus (VHSV)

[0082] This embodiment takes carp herpesvirus (KHV), infectious hematopoietic necrosis virus (IHNV), and viral hemorrhagic septicemia virus (VHSV) as examples to test the detection effect of carp herpesvirus KHV, infectious hematopoietic necrosis virus (IHNV), viral hemorrhagic septicemia virus (VHSV) and fish internal reference genes. The primer probes of carp herpesvirus KHV, infectious hematopoietic necrosis virus (IHNV), and viral hemorrhagic septicemia virus (VHSV) are from the "WOAH Aquatic Animal Disease Diagnostic Test Manual" (8th Edition) (Compiled by the World Organization for Animal Health, China Agriculture Press, 2022), and the sequences are as follows:

[0083] Carp Herpes Virus (KHV):

[0084] KHV upstream primer: GACGCCGGAGACCTTGTG;

[0085] KHV downstream primer: CGGGTTCTTATTTTTGTCCTTGTT;

[0086] KHV probe: FAM-CTTCCTCTGCTCGGCGAGCACG-TAMRA.

[0087] Infectious Hematopoietic Necrosis Virus (IHNV):

[0088] IHNV upstream primer: AGAGCCAAGGCACTGTGCG;

[0089] IHNV downstream primer: TTCTTTGCGGCTTGGTTGA;

[0090] IHNV probe: FAM-TGAGACTGAGCGGGACA-MGBNFQ.

[0091] Viral hemorrhagic septicemia virus (VHSV):

[0092] VHSV upstream primer: AAACTCGCAGGATGTGTGCGTCC;

[0093] VHSV downstream primer: TCTGCGATCTCAGTCAGGATGAA;

[0094] VHSV probe: FAM-TAGAGGGCCTTGGTGATCTTCTG-BHQ1.

[0095] The crucian carp samples infected with carp herpesvirus KHV were from the School of Life Sciences of Sun Yat-sen University, and the infectious hematopoietic necrosis virus (IHNV) samples and viral hemorrhagic septicemia virus (VHSV) samples were from Shenzhen Customs. After receiving these diseased fish samples, the liver, spleen, kidney and muscle samples of the diseased fish were mixed and cut into pieces, and 0.1g of the mixed tissue was added to 1ml of sample pretreatment solution (TIANGEN DNA / RNA AllPrep Kit, product number DP422), and qPCR detection was performed after homogenization using the following experimental conditions.

[0096] The following two PCR-mixes were prepared.

[0097] The first PCR-mix contains primer probes of carp herpesvirus KHV and the above-mentioned preferred candidate gene 2 internal reference gene, primer probes of infectious hematopoietic necrosis virus (IHNV) and the above-mentioned preferred candidate gene 2 internal reference gene, and primer probes of viral hemorrhagic septicemia virus (VHSV) and the above-mentioned preferred candidate gene 2 internal reference gene. The DNA reaction system is configured with primer probes of carp herpesvirus KHV and the above-mentioned preferred candidate gene 2 internal reference gene, and is configured using Tiangen High Affinity HotStart Taq (Cat. No. ET108-02) reagent; the RNA reaction system is configured with primer probes of infectious hematopoietic necrosis virus (IHNV) and the above-mentioned preferred candidate gene 2 internal reference gene, and primer probes of viral hemorrhagic septicemia virus (VHSV) and the above-mentioned preferred candidate gene 2 internal reference gene, and is configured using Vazyme's one-step RT-PCR amplification reagent (AccurSTART U+One Step RT-qPCR Super PreMix (ONE TUBE), Cat. No. Q621, wherein U + One Step RT-qPCR Probe 5×Master Mix was used as the reaction solution.

[0098] The system configurations are as follows:

[0099] Components Reactant volume 5×Probe qPCR Buffer 5μL 10×HA buffer 2.5μL High Affinity HotStart Taq Enzyme 0.4μL KHV upstream primer (10 μM) 0.6μL KHV downstream primer (10 μM) 0.6μL KHV probe (10 μM) 0.5μL tRNA-F2 (10 μM) 0.3μL tRNA-R2 (10 μM) 0.3μL tRNA-P2 (10 μM) 0.2μL DEPC water 9.6μL Total volume 20μL

[0100]

[0101]

[0102] Components Reactant volume U+One Step RT-qPCR Probe 5×Master Mix 5μL VHSV upstream primer 10 μM) 0.6μL VHSV downstream primer (10μM) 0.6μL VHSV probe (10μM) 0.5μL tRNA-F2 (10 μM) 0.3μL tRNA-R2 (10 μM) 0.3μL tRNA-P2 (10 μM) 0.2μL DEPC water 12.5μL Total volume 20μL

[0103] The second PCR-mix contains primers and probes for carp herpesvirus (KHV), infectious hematopoietic necrosis virus (IHNV), and viral hemorrhagic septicemia virus (VHSV).

[0104] The configuration system is as follows:

[0105] Components Reactant volume 5×Probe qPCR Buffer 5μL 10×HA buffer 2.5μL High Affinity HotStart Taq Enzyme 0.4μL KHV upstream primer (10 μM) 0.6μL KHV downstream primer (10 μM) 0.6μL KHV probe (10 μM) 0.5μL DEPC water 10.4μL Total volume 20μL

[0106] Components Reactant volume U+One Step RT-qPCR Probe 5×Master Mix 5μL IHNV upstream primer (10 μM) 0.6μL IHNV downstream primer (10 μM) 0.6μL IHNV probe (10 μM) 0.5μL DEPC water 13.3μL Total volume 20μL

[0107] Components Reactant volume U+One Step RT-qPCR Probe 5×Master Mix 5μL VHSV upstream primer (10 μM) 0.6μL VHSV downstream primer (10μM) 0.6μL VHSV probe (10μM) 0.5μL DEPC water 13.3μL Total volume 20μL

[0108] After preparing the amplification system, replicate each system twice, add 5 μL of the corresponding lysed pathogen sample to each system, mix well, and then perform PCR and RT-PCR amplification.

[0109] The amplification program containing KHV primer-probe mix was as follows: denaturation at 95°C for 5 min; 95°C for 15 s, 61°C for 30 s, for 45 cycles.

[0110] The amplification procedure for the primer probe containing infectious hematopoietic necrosis virus (IHNV) or viral hemorrhagic septicemia virus (VHSV) is:

[0111] Reverse transcription at 50°C for 30 min; denaturation at 95°C for 5 min; 95°C for 15 s, 61°C for 30 s, for 45 cycles.

[0112] The amplification results are as follows Figure 21 to Figure 23 shown.

[0113] Fig.21 The amplification pattern of qPCR detection of carp herpesvirus KHV challenge samples in Example 5 is shown. The internal reference gene and carp herpesvirus KHV gene can be amplified simultaneously. The FAM channel is the amplification result of the carp herpesvirus KHV gene, and the VIC channel is the amplification result of the internal reference gene. The first PCR mix containing primer probes for carp herpesvirus KHV and the internal reference gene can detect KHV and the internal reference gene at the same time, and compared with the second PCR mix without the internal reference gene primer, the Ct value of KHV amplification is almost unchanged, and the fluorescence intensity decreases by about 10%.

[0114] Fig. 22 The amplification pattern of RT-qPCR detection of the infectious hematopoietic necrosis virus (IHNV) sample in Example 5 is shown. The internal reference gene and the infectious hematopoietic necrosis virus (IHNV) gene can be amplified simultaneously. The FAM channel is the amplification result of the infectious hematopoietic necrosis virus (IHNV) gene, and the VIC channel is the amplification result of the internal reference gene. The first PCR mix containing primers and probes for infectious hematopoietic necrosis virus (IHNV) and the internal reference gene can detect IHNV and the internal reference gene simultaneously, and compared with the second PCR mix without the internal reference gene primer, the Ct value of IHNV amplification is almost unchanged, and the fluorescence intensity is not reduced.

[0115] Fig.23 The amplification pattern of RT-qPCR detection of viral hemorrhagic septicemia virus (VHSV) samples in Example 5 is shown. The internal reference gene and the viral hemorrhagic septicemia virus (VHSV) gene can be amplified simultaneously. The FAM channel is the amplification result of the viral hemorrhagic septicemia virus (VHSV) gene, and the VIC channel is the amplification result of the internal reference gene. The first PCR mix containing primer probes for viral hemorrhagic septicemia virus (VHSV) and the internal reference gene can detect VHSV and the internal reference gene simultaneously, and compared with the second PCR mix without the internal reference gene primer, the Ct value of VHSV amplification is almost unchanged, and the fluorescence intensity decreases by about 5%.

[0116] The above results showed that the simultaneous amplification of internal reference genes did not significantly affect the amplification of KHV, IHNV and VHNV.

[0117] The above-described embodiments of the present invention do not constitute a limitation on the protection scope of the present invention. Any modification, equivalent substitution, improvement and reverse complementation of sequences made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A universal internal reference gene for nucleic acid amplification detection of fish pathogens, characterized in that: The universal internal reference gene is the Eurycoma tRNA gene.

2. A primer probe for detecting the universal reference gene according to claim 1, characterized in that: The primer probe comprises: Upstream primer: 5′-CCTCGTTAGTATAGTGGACAGT-3′; Downstream primer: 5′-CGTCGGGGAATCGAACC-3′; Probe: 5'-VIC-CGCCTGTCACGCGGAAGACCG-BHQ1-3'.

3. Use of the primer probe described in claim 2 in preparing a fish pathogen nucleic acid amplification detection kit.

4. The use according to claim 3, characterized in that: The fish include any one or more of sea bass, California bass, grouper, mandarin fish, crucian carp, grass carp, snakehead carp, koi, tilapia, yellow catfish, golden pomfret, salmon, eel, and channel catfish.

5. The use according to claim 3, characterized in that: The pathogens include any one or more of viruses, bacteria, and parasites.

6. The use according to claim 3, characterized in that: The pathogen is any one or more of rhabdovirus, infectious spleen and kidney necrosis virus, neuronecrosis virus, herpes virus, iridovirus, Luohu virus, reovirus, infectious hematopoietic necrosis virus, viral hemorrhagic septicemia virus, infectious pancreatic necrosis virus, epidemic hematopoietic necrosis virus, carp spring virus, carp edema virus, salmon alphavirus, calicivirus, descaling virus, Vibrio, columnar bacterium, Nocardia, Yersinia ruckeri, Pseudomonas proteus, Cryptocaryon irritans, Ichthyophthirius, Wheelworm, and Botoworm.

7. A kit for nucleic acid amplification detection of fish pathogens, characterized in that: The kit comprises the primer probe according to claim 2.

8. The kit according to claim 7, characterized in that The nucleic acid amplification detection is DNA pathogen detection or RNA pathogen amplification detection.

9. The kit according to claim 7, characterized in that The nucleic acid amplification detection is any one of real-time fluorescence quantitative PCR detection, conventional PCR detection, loop-mediated isothermal amplification detection, nucleic acid sequence-dependent amplification detection, rolling circle amplification detection, single primer isothermal amplification detection, helicase-dependent DNA isothermal amplification, recombinase polymerase amplification, and chain replacement amplification.

10. The kit according to any one of claims 7 to 9, characterized in that The kit is used for amplifying nucleic acids extracted from fish tissues.

Images