Universal reference gene, primer probe and kit for shrimp and crab pathogen nucleic acid amplification detection and application of universal reference gene, primer probe and kit

Abstract

The invention discloses a universal reference gene for shrimp and crab pathogen nucleic acid amplification detection. The universal reference gene is a tRNA gene of decapodia crustaceans. The invention also provides a primer probe for detecting the general reference gene, a kit comprising the primer probe, and application of the primer probe in preparation of a shrimp and crab pathogen nucleic acid amplification detection reagent. The detection primer probe provided by the invention overcomes the defect that a common reference gene primer can only adapt to one kind of shrimp and crab animals, is universal to various shrimp and crab animals and various tissues, is not interfered by other nucleic acids of a genome, simplifies the detection process, greatly improves the detection efficiency, and saves the reagent development cost.

Description

Technical Field

[0001] The invention belongs to the field of molecular biological detection, and particularly relates to a universal internal reference gene, a primer probe, a kit and applications thereof for nucleic acid amplification detection of shrimp and crab pathogens. Background Art

[0002] Shrimp and crab are important economic aquatic resources in the world. They not only occupy an important position in fisheries, but also play a key role in aquaculture. Therefore, the health of shrimp and crab is crucial to maintaining the sustainable development of fisheries and aquaculture. Shrimp and crab are threatened by a variety of pathogens, including viruses, bacteria, parasites, etc. These pathogens not only affect the growth and development of shrimp and crab, but also may cause large-scale deaths, causing huge economic losses to the aquaculture industry. In order to prevent and control these pathogenic diseases, PCR technology is widely used in the field of shrimp and crab disease detection. In order to improve the detection quality of PCR, it is necessary to introduce internal reference gene detection.

[0003] Since the PCR detection process involves many experimental processes, including clinical sample collection, sample storage and transportation, nucleic acid extraction, and PCR reaction, any operation error in any step may lead to nucleic acid degradation or excessive inhibitors causing amplification reaction failure, which may lead to false negative experiments. If endogenous reference genes are detected, the nucleic acid of endogenous genes in the sample can be detected while PCR is diagnosing pathogens. This can effectively control the quality of the entire experimental process, including clinical sample collection, sample storage and transportation, nucleic acid extraction, and PCR reaction, and eliminate experimental operation errors, reagent failures, and reaction failures. False negatives can be avoided to a certain extent, and the reliability of diagnostic results can be improved.

[0004] Many pathogens can use a variety of shrimp and crab animals as hosts, such as white spot syndrome WSSV, decapod iridovirus DIV1, Vibrio harveyi HV, Vibrio alginolyticus, Enterocytozoon hepatocellularis EHP, etc. Therefore, when conducting PCR monitoring of crustacean pathogens, it may be necessary to test a variety of shrimp and crab samples, and universal internal reference primers that can be applied to a variety of shrimp and crabs have strong practical value.

[0005] It is easy to design dedicated internal reference primers for PCR testing of specific species of shrimp and crab. For example, the recognized 18s RNA gene is highly conserved in multiple species, and appropriate regions can be selected to design DNA internal reference gene primers for specific species. However, these genes may not be applicable to other shrimp and crab species. Designing specific internal reference primer probes for each shrimp and crab is time-consuming and labor-intensive, increasing various costs.

[0006] At present, the commonly used internal reference quality control method is to add exogenous genes or pseudoviruses containing exogenous genes after the sample is transported to the laboratory, before nucleic acid extraction or before PCR. This method cannot effectively monitor the upstream sample collection, transportation and storage, and nucleic acid extraction process, and it adds additional experimental operation steps and material costs. Summary of the invention

[0007] In view of the above technical problems to be solved, one object of the present invention is to provide a universal internal reference gene suitable for nucleic acid amplification detection of shrimp and crab pathogens, which can be used for multiple shrimp and crab species and multiple tissues, is not interfered by other nucleic acids in the genome, and has a high detection efficiency.

[0008] Another object of the present invention is to provide a primer probe for detecting the universal internal reference gene.

[0009] Another object of the present invention is to provide a kit comprising the primer probe.

[0010] Another object of the present invention is to provide application of the primer probe.

[0011] In order to achieve the above invention objectives, the present invention provides a universal internal reference gene for nucleic acid amplification detection of shrimp and crab pathogens, wherein the universal internal reference gene is a tRNA gene of the Decapoda Crustacea.

[0012] On the other hand, the present invention also provides a primer probe for detecting the universal internal reference gene, characterized in that the primer probe comprises:

[0013] Upstream primer: 5′-CGGCTAGCTCAGTCGGTA-3′;

[0014] Downstream primer: 5′-CCAACGTGGGGCTCGAA-3′;

[0015] Probe: 5'-VIC-ACCCCGAGATTAAGAGTCTCGTGCT-BHQ1-3'.

[0016] On the other hand, the present invention also provides the use of the primer probe in preparing a nucleic acid amplification detection kit for shrimp and crab pathogens.

[0017] Preferably, the shrimps and crabs are any one or more of prawns, Macrobrachium rosenbergii, shrimp, redclaw crayfish, Procambarus clarkii (crayfish), blue crab, Chinese mitten crab, swimming crab, king crab, and flower crab.

[0018] Preferably, the pathogen includes any one or more of viruses, bacteria, and parasites.

[0019] Preferably, the pathogen is any one or more of white spot syndrome virus (WSSV), decapod iridovirus (DIV1), infectious hypodermal and hematopoietic necrosis virus (IHHNV), stealing Nodamura virus (CMNV), infectious myonecrosis virus (IMNV), infectious precocious virus (IPV), Nodavirus (MrNV), Chinese mitten crab reovirus (EsRV), blue crab reovirus (MCRV), blue crab dicistrovirus (MCDV), X virus, Vibrio parahaemolyticus (VP), Vibrio harveyi (HV), Vibrio alginolyticus, highly pathogenic Vibrio (HLV), Citrobacter freundii, Vibrio fluviatilis, Shewanella jiruka, Shewanella putrefaciens, shrimp hepatocellular carcinoma (EHP), and microsporidia.

[0020] Preferably, in the application, the reaction system for nucleic acid amplification detection is 25 μL: 5×Probe qPCR Buffer 5 μL, 10×HA buffer 2.5 μL, High Affinity HotStart Taq Enzyme 0.4 μL, 10 μM upstream primer 0.5 μL, 10 μM downstream primer 0.5 μL, 10 μM probe 0.4 μL, DNA template 5 μL, and nuclease-free water to make up to 25 μL.

[0021] Preferably, in the application, the reaction conditions for nucleic acid amplification detection are: denaturation at 95°C for 5 min; 95°C for 15 s, 61°C for 30 s, and 45 cycles.

[0022] On the other hand, the present invention also provides a method for nucleic acid amplification detection of shrimps and crabs, wherein the method uses the tRNA gene of the Decapoda Crustacea as a universal internal reference gene. Preferably, in the method, the universal internal reference gene is detected using the primer probe according to the present invention.

[0023] On the other hand, the present invention also provides a kit for nucleic acid amplification detection of shrimp and crab pathogens, the kit comprising the primer probe according to the present invention.

[0024] Preferably, the nucleic acid amplification detection is DNA pathogen detection or RNA pathogen amplification detection.

[0025] Preferably, the nucleic acid amplification detection is any one of real-time fluorescence quantitative PCR detection, conventional PCR detection, loop-mediated isothermal amplification detection, nucleic acid sequence-dependent amplification detection, rolling circle amplification detection, single primer isothermal amplification detection, helicase-dependent DNA isothermal amplification, recombinase polymerase amplification, and chain replacement amplification.

[0026] Preferably, the kit is used to amplify nucleic acids extracted from shrimp and crab tissues.

[0027] The internal reference gene selected by the present invention is the tRNA (transfer RNA) of the Decapoda order of Crustacea. Because tRNA has sequence conservation: tRNA molecules have a well-defined sequence conservation, which reflects the need to maintain their structure and function during the translation process. Despite the large number of tRNA genes, specific tRNA sequence motifs are highly conserved in multicellular eukaryotes; tRNA has evolutionary conservation: evolutionary studies of tRNA sequences have shown that tRNA sequences are conserved during evolution, which may be related to their key functions in protein synthesis. The Decapoda order is the largest order in the subphylum Crustacea of ​​the phylum Arthropoda, and is also the order with the richest species, with about 9,000 species, including various shrimps, hermit crabs, crabs, etc.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] (1) The present invention proposes to establish a universal internal reference gene in the PCR detection of shrimp and crab nucleic acid pathogens, and use the decapod tRNA gene as a universal internal reference gene for the PCR detection of shrimp and crab pathogen nucleic acid.

[0030] (2) The detection primer probe for the universal reference gene proposed in the present invention overcomes the defect that the common reference gene primers can only adapt to one type of shrimp or crab, so that the kit using the primers is universal for multiple shrimps, crabs and multiple tissues, is not interfered by other genomic nucleic acids, and can be applied to the detection of multiple shrimp and crab internal references, which greatly improves the sample application range, improves the detection efficiency, and saves the reagent development cost.

[0031] (3) The present invention uses endogenous reference gene detection, which does not require the addition of exogenous genes or pseudoviruses containing exogenous genes before nucleic acid extraction or before PCR, thereby simplifying the experimental operation process and reducing material costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The test results of the amplification efficiency of the first set of primer probes designed in Example 2 are shown.

[0033] Figure 2 The test results of the amplification efficiency of the second set of primer probes designed in Example 2 are shown.

[0034] Figure 3 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from shrimp muscle tissue is shown.

[0035] Figure 4 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from muscle tissue of Macrobrachium rosenbergii is shown.

[0036] Figure 5 The amplification pattern of the first group of primer probes and the second group of primer probes in Example 3 for qPCR detection of nucleic acids extracted from muscle tissue of shrimp is shown.

[0037] Figure 6 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from muscle tissue of Procambarus clarkii (crayfish) are shown.

[0038] Figure 7 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from muscle tissue of red claw crayfish are shown.

[0039] Figure 8 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from mud crab muscle tissue are shown.

[0040] Fig. 9 The amplification patterns of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from the muscle tissue of Chinese mitten crab are shown.

[0041] Fig.10 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from swimming crab muscle tissue is shown.

[0042] Fig.11 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acid extracted from king crab muscle tissue is shown.

[0043] Fig.12 The amplification pattern of the first set of primer probes and the second set of primer probes in Example 3 for qPCR detection of nucleic acids extracted from flower crab muscle tissue is shown.

[0044] Fig.13 The amplification pattern of qPCR detection of nucleic acids extracted from the hepatopancreas, gills and muscle tissues of shrimp in Example 4 is shown.

[0045] Fig.14 The amplification pattern of qPCR detection of shrimp samples infected with white spot syndrome virus in Example 5 is shown.

[0046] Fig.15 The amplification pattern of qPCR detection of shrimp samples infected with Vibrio parahaemolyticus in Example 5 is shown.

[0047] Fig.16The amplification pattern of qPCR detection of shrimp samples infected with infectious hypodermal and hematopoietic necrosis viruses in Example 5 is shown.

[0048] Fig.17 The results of T cloning sequencing (bioengineering) of the products amplified by primer probe 1 in Example 3 on samples such as Macrobrachium rosenbergii, shrimp, red claw crayfish, crayfish, blue crab, and Chinese mitten crab are shown, and the sequencing results are compared with the target gene. DETAILED DESCRIPTION

[0049] In order to more clearly illustrate the technical solution of the present invention and make the above-mentioned purposes, features and advantages of the embodiments of the present invention more obvious and understandable, the following will be described in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to illustrate the present invention, and are not used to limit the scope of the present invention.

[0050] Unless otherwise specified, the materials, reagents, instruments and methods used in the following examples are conventional materials, reagents, instruments and methods in the art and can be obtained through commercial channels.

[0051] Example 1 - Candidate gene screening

[0052] The present invention downloads various tRNA sequences of decapods from NCBI, and first compares the reference gene database of crustaceans such as Procambarus clarkii, prawns, shrimps, red claw crayfish, Macrobrachium rosenbergii, blue crab, Chinese mitten crab, swimming crab, king crab, and flower crab by bioinformatics methods to screen out highly conserved tRNA gene fragments. Highly conserved tRNA sequences with a consistency rate greater than 97% in the database can be used as candidate genes, and finally two target genes are screened out. The nucleotide sequences of the candidate genes are shown in Table 1 below.

[0053] Table 1. Nucleotide sequences of candidate genes

[0054]

[0055] Example 2 - Primer screening and testing

[0056] According to the candidate internal reference genes screened in Example 1, upstream and downstream primers were designed. In addition to meeting the general requirements for primer design, it was also required that the primer probes had no more than 1 base mismatch with the gene sequences of various shrimps and crabs. Two sets of primer probes were designed based on the gene. The sequences of the two sets of primer probes are shown in Table 2 below.

[0057] Table 2. Primers and probes for candidate genes

[0058]

[0059] The specific probe of the candidate internal reference gene carries a VIC fluorescent reporter group and a BHQ1 fluorescent quencher group at its 5' end and 3' end, respectively.

[0060] The primer probes and plasmids to be screened were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the plasmids were used for amplification efficiency testing. The synthesized plasmid was 5 μg, and its total copy number was calculated according to the following formula:

[0061]

[0062] In this example, the total plasmid copy number was determined by the above method, and then the plasmid copy number was calibrated by a 10-fold gradient dilution method. 0 copies / μL to 1×10 5 The copies / μL plasmid copy number was used as a template to determine the amplification efficiency of each primer probe.

[0063] qPCR amplification was performed using the High Affinity HotStart Taq kit (Tiangen, ET108-02). A 25 μL reaction system was prepared according to the instructions: 5 μL 5×Probe qPCR Buffer, 2.5 μL 10×HA buffer, 0.4 μL High Affinity HotStart Taq Enzyme, 0.5 μL upstream primer (10 μM), 0.5 μL downstream primer (10 μM), 0.4 μL probe (10 μM), 5 μL DNA template, and 10.7 μL nuclease-free water.

[0064] The reaction was carried out on an ABI7500 real-time fluorescence quantitative PCR instrument (Applied Biosystems, USA) under the following reaction conditions: denaturation at 95°C for 5 min, 95°C for 15 s, 61°C for 30 s, and 45 cycles.

[0065] The results are as follows Figure 1 and Figure 2 shown. Figure 1 The results of the amplification efficiency test of the first set of primer probes are shown. Figure 2 The results of the test of the amplification efficiency of the second set of primer probes are shown. The results show that the amplification efficiency of the two sets of primer probes is between 90% and 110%, R 2 The values ​​were all above 0.99, meeting the preliminary screening requirements for PCR primers and probes.

[0066] Example 3-Testing of primer probes in muscle tissues of different shrimps and crabs

[0067] Further tests were performed based on the two sets of primers and probes in Example 2 to verify their amplification effects in different shrimps and crabs.

[0068] The muscle tissues of crustaceans such as shrimp, Procambarus clarkii (crayfish), mud shrimp, Macrobrachium rosenbergii, red claw crayfish, blue crab, Chinese mitten crab, swimming crab, king crab and flower crab were cut into pieces and homogenized, and nucleic acid was extracted using a nucleic acid extraction kit (TIANGENDNA / RNA AllPrep Kit, catalog number DP422).

[0069] The High Affinity HotStart Taq (Tiangen, ET108-02) kit was used for qPCR amplification. A 25 μL reaction system was prepared according to the instructions: 5 μL 5×Probe qPCR Buffer, 2.5 μL 10×HA buffer, 0.4 μL High Affinity HotStart Taq Enzyme, 0.5 μL upstream primer (10 μM), 0.5 μL downstream primer (10 μM), 0.4 μL probe (10 μM), 10.7 μL nuclease-free water, and 5 μL DNA template.

[0070] The reaction was carried out on a fluorescent quantitative PCR instrument (Macrostone, SLAN-48P) under the following conditions: denaturation at 95°C for 5 min; 95°C for 15 s, 61°C for 30 s, and 45 cycles.

[0071] The final amplification analysis results are as follows Figures 3 to 12 shown. Figures 3 to 12 The amplification patterns of two groups of primer probes designed according to the candidate genes for qPCR detection of nucleic acids extracted from muscle tissues of shrimp, shrimp, Macrobrachium rosenbergii, crayfish, red claw crayfish, blue crab, Chinese mitten crab, swimming crab, king crab, and flower crab are shown respectively. As shown in the figure, the first group of primer probes can have good amplification results for the above-mentioned shrimps and crabs, and the amplification results of the second group of primer probes are not as good as those of the first group of primer probes; therefore, the first group of primer probes were selected for subsequent testing.

[0072] In order to detect whether the target fragment amplified by the first group of primer probes in the above shrimp and crab samples is a specific fragment of the tRNA-Lys gene, the present invention performs T clone sequencing (bioengineering) on ​​the PCR products of the corresponding samples of shrimp, Macrobrachium rosenbergii, red claw crayfish, crayfish, blue crab, and Chinese mitten crab amplified by the first group of primer probes, and 2 T clone sequencings are performed for each sample. The sequencing results are compared with the sequence of the tRNA-Lys gene, showing that they are all matched, except that the Chinese mitten crab amplifies a non-specific fragment in addition to the target gene. Since this test is only used as an internal reference and quality control requirement, even if there is non-specific amplification, it is acceptable. The comparison results are as follows: Fig.17 shown.

[0073] Example 4 - Testing in different tissues of shrimp

[0074] The experimental conditions of Example 3 were adopted, and DNA was extracted from the hepatopancreas, gills, and muscle tissues of shrimp using the first set of primer probes and then subjected to qPCR detection, with 2 replicates for each sample.

[0075] Test results such as Fig.13 As shown. Fig.13 It can be seen that the first group of primer probes can amplify DNA extracted from the hepatopancreas, gills and muscle tissues of shrimp. The Ct value range of different tissue amplifications is 23-27, which can meet the needs of internal reference gene detection in different tissues.

[0076] Example 5 - Testing of shrimp samples infected with white spot syndrome virus, Vibrio parahaemolyticus and infectious hypodermal and hematopoietic necrosis virus

[0077] This example takes white spot syndrome virus (WSSV), Vibrio parahaemolyticus (pirA) and infectious hypodermal and hematopoietic necrosis virus (IHHNV) as examples to test the detection effect of white spot syndrome virus and shrimp internal reference genes, Vibrio parahaemolyticus and shrimp internal reference genes, infectious hypodermal and hematopoietic necrosis virus and shrimp internal reference genes. The primer probes for white spot syndrome virus, Vibrio parahaemolyticus and infectious hypodermal and hematopoietic necrosis virus are from the "WOAH Aquatic Animal Disease Diagnostic Test Manual" (8th Edition) (Compiled by the World Organization for Animal Health, China Agriculture Press, 2022), and the sequences are as follows:

[0078] The sequences of the primers and probes for white spot syndrome virus are as follows:

[0079] Upstream primer WSSV-F: CCGACGCCAAGGGAACT;

[0080] Downstream primer WSSV-R: TTCAGATTCGTACCGTTTCCA;

[0081] Probe WSSV-P: FAM-CGCTTCAGCCATGCCAGCCG-TAMRA.

[0082] The primer and probe sequences for Vibrio parahaemolyticus are as follows:

[0083] Upstream primer pirA-F: TTGGACTGTCGAACCAAACG

[0084] Downstream primer pirA-R: GCACCCCATTGGTATTGAATG

[0085] Probe pirA-P: FAM-AGACAGCAAACATACACCTATCATCCCGGA-TAMRA

[0086] The primer and probe sequences for infectious hypodermal and hematopoietic necrosis virus are as follows:

[0087] IHHNV-F:TACTCCGGACACCCAACCA

[0088] IHHNV-R:GGCTCTGGCAGCAAAGGTAA

[0089] IHHNV-P: FAM-ACCAGACATAGAGCTACAATCCCTCGCCTATTTG-TAMRA

[0090] The shrimp samples infected with white spot syndrome virus, Vibrio parahaemolyticus and infectious hypodermal and hematopoietic necrosis virus were all obtained from the School of Life Sciences of Sun Yat-sen University. After receiving the samples, the hepatopancreas, gills and muscle samples of the shrimp were mixed and cut into pieces, and 0.1g of the mixed tissue was taken. After the nucleic acid was extracted using the TIANGEN DNA / RNA AllPrep Kit (Cat. No. DP422), qPCR detection was performed using the following experimental conditions.

[0091] Prepare the following two PCR-mixes:

[0092] The first PCR-mix contains: white spot syndrome virus and the above preferred first group of primer probes as primer probes for internal reference genes; Vibrio parahaemolyticus and the above preferred first group of primer probes as primer probes for internal reference genes; infectious hypodermal and hematopoietic necrosis virus and the above preferred first group of primer probes as primer probes for internal reference genes. The system is prepared as shown in the following table:

[0093] Components Reactant volume 5×Probe qPCR Buffer 5μL 10×HA buffer 2.5μL High Affinity HotStart Taq Enzyme 0.4μL WSSV-F (10 μM) 0.6μL WSSV-R (10 μM) 0.6μL WSSV-P (10 μM) 0.5μL tRNA-F1 (10 μM) 0.3μL tRNA-R1 (10 μM) 0.3μL tRNA-P1 (10 μM) 0.2μL DEPC water 9.6μL Total volume 20μL

[0094] Components Reactant volume 5×Probe qPCR Buffer 5μL 10×HA buffer 2.5μL High Affinity HotStart Taq Enzyme 0.4μL pirA-F (10 μM) 0.6μL pirA-R (10 μM) 0.6μL pirA-P (10 μM) 0.5μL tRNA-F1 (10 μM) 0.3μL tRNA-R1 (10 μM) 0.3μL tRNA-P1 (10 μM) 0.2μL DEPC water 9.6μL Total volume 20μL

[0095] Components Reactant volume 5×Probe qPCR Buffer 5μL 10×HA buffer 2.5μL High Affinity HotStart Taq Enzyme 0.4μL IHHNV-F (10 μM) 0.6μL IHHNV-R (10μM) 0.6μL IHHNV-P (10 μM) 0.5μL tRNA-F1 (10 μM) 0.3μL tRNA-R1 (10 μM) 0.3μL tRNA-P1 (10 μM) 0.2μL DEPC water 9.6μL Total volume 20μL

[0096] The second PCR-mix contains primer probes for white spot syndrome virus, primer probes for Vibrio parahaemolyticus, and primer probes for infectious hypodermal and hematopoietic necrosis viruses, but does not contain primer probes for internal reference genes. The system is prepared as shown in the following table:

[0097] Components Reactant volume 5×Probe qPCR Buffer 5μL 10×HA buffer 2.5μL High Affinity HotStart Taq Enzyme 0.4μL WSSV-F (10 μM) 0.6μL WSSV-R (10 μM) 0.6μL WSSV-P (10 μM) 0.5μL DEPC water 10.4μL Total volume 20μL

[0098] Components Reactant volume 5×Probe qPCR Buffer 5μL 10×HA buffer 2.5μL High Affinity HotStart Taq Enzyme 0.4μL pirA-F (10 μM) 0.6μL pirA-R (10 μM) 0.6μL pirA-P (10 μM) 0.5μL DEPC water 10.4μL Total volume 20μL

[0099] Components Reactant volume 5×Probe qPCR Buffer 5μL 10×HA buffer 2.5μL High Affinity HotStart Taq Enzyme 0.4μL IHHNV-F (10 μM) 0.6μL IHHNV-R (10μM) 0.6μL IHHNV-P (10 μM) 0.5μL DEPC water 10.4μL Total volume 20μL

[0100] After the amplification system was prepared, each system was repeated twice, and 5 μL of the corresponding pathogen sample extracted according to the above method was added to each system. After mixing, qPCR detection was performed using the experimental conditions of Example 3.

[0101] The results are as follows Figures 14 to 16 As shown, Fig.14 It was shown that the first PCR mix containing primers and probes of white spot syndrome virus (WSSV) and an internal reference gene in Example 5 could simultaneously detect WSSV and the internal reference gene, and compared with the second PCR mix without the internal reference gene primer, the Ct value of WSSV amplification remained almost unchanged, and the fluorescence intensity decreased by about 5%, indicating that the simultaneous amplification of the internal reference gene did not significantly affect the amplification of WSSV. Fig.15 It shows that the first PCR mix containing primers and probes of Vibrio parahaemolyticus (pirA) and the internal reference gene in Example 5 can detect pirA and the internal reference gene at the same time, and compared with the second PCR mix without the internal reference gene primer, the Ct value of pirA amplification is almost unchanged, and the fluorescence intensity does not decrease, indicating that the simultaneous amplification of the internal reference gene does not have a significant effect on the amplification of (pirA). Fig.16 It was shown that the first PCR mix containing primer probes of infectious hypodermal and hematopoietic necrosis virus (IHHNV) and an internal reference gene in Example 5 could simultaneously detect IHHNV and the internal reference gene, and compared with the second PCR mix without the internal reference gene primer, the Ct value of IHHNV amplification remained almost unchanged, and the fluorescence intensity decreased by about 5%, indicating that the simultaneous amplification of the internal reference gene did not significantly affect the amplification of IHHNV.

[0102] The above-described embodiments of the present invention do not constitute a limitation on the protection scope of the present invention. Any modification, equivalent substitution, improvement and reverse complementation of sequences made within the spirit and principle of the present invention are included in the protection scope of the present invention.

Claims

1. A universal internal reference gene for nucleic acid amplification detection of shrimp and crab pathogens, characterized in that: The universal internal reference gene is a tRNA gene of Decapoda Crustacea.

2. A primer probe for detecting the universal reference gene according to claim 1, characterized in that: The primer probe comprises: Upstream primer: 5′-CGGCTAGCTCAGTCGGTA-3′; Downstream primer: 5′-CCAACGTGGGGCTCGAA-3′; Probe: 5′-VIC-ACCCCGAGATTAAGAGTCTCGTGCT-BHQ1-3′.

3. Use of the primer probe described in claim 2 in preparing a nucleic acid amplification detection kit for shrimp and crab pathogens.

4. The use according to claim 3, characterized in that: The shrimps and crabs are any one or more of prawns, Macrobrachium rosenbergii, ground shrimp, red claw crayfish, Procambarus clarkii, blue crab, Chinese mitten crab, swimming crab, king crab, and flower crab.

5. The use according to claim 3, characterized in that: The pathogens include any one or more of viruses, bacteria, and parasites.

6. The use according to claim 3, characterized in that: The pathogen is any one or more of white spot syndrome virus, decapod iridovirus, infectious subcutaneous and hematopoietic necrosis virus, Nodama virus, infectious myonecrosis virus, infectious precocious virus, Noda virus, Chinese mitten crab reovirus, blue crab reovirus, blue crab dicistrovirus, X virus, Vibrio parahaemolyticus, Vibrio harveyi, Vibrio alginolyticus, highly pathogenic Vibrio, Citrobacter freundii, Vibrio fluviatilis, Shewanella jirovecii, Shewanella putrefaciens, shrimp hepatocystis, and microsporidia.

7. A kit for nucleic acid amplification detection of shrimp and crab pathogens, characterized in that: The kit comprises the primer probe according to claim 2.

8. The kit according to claim 7, characterized in that The nucleic acid amplification detection is DNA pathogen detection or RNA pathogen amplification detection.

9. The kit according to claim 8, characterized in that The nucleic acid amplification detection is any one of real-time fluorescence quantitative PCR detection, conventional PCR detection, loop-mediated isothermal amplification detection, nucleic acid sequence-dependent amplification detection, rolling circle amplification detection, single primer isothermal amplification detection, helicase-dependent DNA isothermal amplification, recombinase polymerase amplification, and chain replacement amplification.

10. The kit according to any one of claims 7 to 9, characterized in that The kit is used for amplifying nucleic acids extracted from shrimp and crab tissues.

Images