Application of tsRNA-20 or simulant of tsRNA-20 in preparation of medicine for treating chronic plus acute liver failure and / or promoting liver cell proliferation

Abstract

The invention relates to the technical field of hepatic failure treatment, and particularly discloses application of tsRNA-20 or a simulant thereof in preparation of drugs for treating chronic plus acute hepatic failure and / or promoting liver cell proliferation. Through tsRNA sequencing and qRT-PCR verification, down-regulated expression of the tsRNA-20 in a plasma sample and liver tissue in chronic and acute hepatic failure is determined, and cell experiments find that the tsRNA-20 regulates an ACPH / GRHL1 axis to promote liver cell proliferation. Specifically, it is found that tsRNA-20 is combined with an amidyl peptide hydrolase (ACPH), so that a Ras-ERK pathway is activated, nuclear translocation of a granulocyte-like transcription factor 1 (GRHL1) is promoted, and finally liver cell proliferation is enhanced. Therefore, when the tsRNA-20, the precursor tRNA-GIy-CCC thereof and the regulated objects ACPH and GRHL1 thereof are applied to treatment of the chronic and acute liver failure, the tsRNA-20, the precursor tRNA-GIy-CCC thereof and the regulated objects ACPH and GRHL1 thereof can be used as targets to be regulated to promote liver cell proliferation, so that liver regeneration is promoted, the treatment effect of the chronic and acute liver failure is improved, the lifetime of patients with liver diseases is prolonged, and the tsRNA-20, the precursor tRNA-GIy-CCC and the regulated objects ACPH and GRHL1 possibly become new targets for precise treatment. The clinical application value is relatively high.

Description

Technical Field

[0001] The present invention relates to the field of liver failure treatment, and more specifically, to the use of tsRNA-20 or its mimetics in the preparation of drugs for acute-on-chronic liver failure and / or promoting liver cell proliferation. Background Art

[0002] Acute-on-chronic liver failure (ACLF) is a common end-stage liver disease in clinical practice, characterized by a sharp deterioration of liver function in a short period of time and a very high short-term mortality rate. Currently, there is a lack of effective treatments, and it is one of the major diseases that threaten the health of Chinese residents. Hepatocyte regeneration and repair remains one of the main pathways for liver recovery during chronic liver injury, and promoting liver regeneration is an effective treatment strategy. Therefore, there is an urgent need to develop non-transplantation medical treatments, including cell-based liver regeneration therapy, to intervene in the development of liver failure as soon as possible. However, the molecular basis of ACLF is not yet fully understood by the academic community, and further research is needed on its molecular mechanisms to identify new diagnostic and therapeutic targets.

[0003] tRNA-derived RNAs (tsRNAs) are a novel class of small noncoding RNAs (sncRNAs) that are generated by specific cleavage of mature or precursor transfer RNAs and regulate gene expression at the transcriptional and translational levels. Accumulating evidence supports the hypothesis that tsRNAs play diverse roles in many regulatory pathways with evolutionarily conserved functions in various molecular processes such as gene regulation, RNA processing, protein biosynthesis, and oncogenic transformation. Some tsRNAs have also been implicated in the proliferation, migration, and invasion of certain types of cancer cells. Despite this, few studies have investigated the effects of tsRNAs on liver injury or hepatocyte proliferation, and the functional role and potential mechanisms of tsRNAs in acute-on-chronic liver failure remain largely unexplored.

[0004] Therefore, in order to overcome the gaps in existing treatment technologies, it is necessary to find new mechanisms and new targets for acute-on-chronic liver failure or hepatocyte proliferation in order to improve treatment plans and improve treatment efficacy. Summary of the invention

[0005] The present invention aims to overcome at least one of the deficiencies of the above-mentioned prior art, and provides the use of tsRNA-20 or its mimetics in the preparation of drugs for acute-on-chronic liver failure and / or promoting hepatocyte proliferation, which promotes the nuclear translocation of GRHL1 by binding to ACPH and regulating its expression in hepatocytes, thereby enhancing hepatocyte proliferation and improving the therapeutic effect of acute-on-chronic liver failure; and based on the relationship between tsRNA-20, ACPH, Ras / ERK and GRHL1 revealed by the present invention, it can provide a new target for liver regeneration treatment of acute-on-chronic liver failure, provide a new strategy for promoting hepatocyte proliferation, and make up for the gaps in the prior art.

[0006] One object of the present invention is to provide the use of tsRNA-20 or its mimics in the preparation of drugs for acute-on-chronic liver failure and / or promoting liver cell proliferation, wherein the nucleotide sequence of the tsRNA-20 or its mimics includes GCATT GGTGGTTCAG TGGTAGAATT CTCGC CT. In one embodiment of the present invention, it was found through experiments that the artificially synthesized tsRNA-20 mimics significantly reduced the cytotoxic effect of exosomes from patients with acute-on-chronic liver failure (ACLF) on human normal liver cells L02 cells cultured in vitro. Therefore, tsRNA-20 or its mimics can be used in corresponding drugs for acute-on-chronic liver failure and / or promoting liver cell proliferation.

[0007] Further, tsRNA-20 or its mimics bind to ACPH and promote GRHL1 nuclear translocation, thereby promoting hepatocyte proliferation. In one or more embodiments of the present invention, the relevant mechanism was verified by experiments, and it was found that tsRNA-20 binds to ACPH and regulates its expression in hepatocytes, thereby activating the Ras-ERK pathway and promoting GRHL1 nuclear translocation, ultimately enhancing normal hepatocyte proliferation.

[0008] Another object of the present invention is to provide the use of tsRNA-20 promoter, ACPH promoter and / or GRHL1 promoter in the preparation of drugs for treating chronic acute liver failure and / or promoting hepatocyte proliferation. Based on the above findings, tsRNA-20 promoter has the potential for application in the preparation of ACLF drugs. In the embodiments of the present invention, the expression levels of ACPH and GRHL1 in liver tissue and plasma exosomes of ACLF patients and ACLF mouse models are significantly lower than those in the corresponding control groups, so ACPH promoter and / or GRHL1 promoter also have the potential for application in the preparation of ACLF drugs.

[0009] Another object of the present invention is to provide the use of human tRNA-GIy-CCC, ACPH and / or GRHL1 as targets in the preparation of drugs for treating acute-on-chronic liver failure and / or promoting hepatocyte proliferation. Human tRNA-GIy-CCC is a precursor of tsRNA-20, and tsRNA-20 in the human body is formed by cleavage of mature tRNA-Gly-CCC.

[0010] Another object of the present invention is to provide a drug for treating acute-on-chronic liver failure, comprising tsRNA-20, a tsRNA-20 mimetic, a tsRNA-20 promoter, an ACPH promoter and / or a GRHL1 promoter; the nucleotide sequence of the tsRNA-20 or its mimetic comprises GCATT GGTGG TTCAG TGGTAGAATT CTCGC CT.

[0011] Another object of the present invention is to provide a drug for promoting hepatocyte proliferation, characterized in that it includes tsRNA-20, a tsRNA-20 mimetic, a tsRNA-20 promoter, an ACPH promoter and / or a GRHL1 promoter; the nucleotide sequence of the tsRNA-20 or its mimetic includes GCATT GGTGG TTCAG TGGTAGAATT CTCGC CT.

[0012] Another object of the present invention is to provide a kit for detecting tsRNA-20, characterized in that it comprises one or more of a nucleic acid extraction reagent, an RT primer, a qPCR primer, and a gene-specific probe;

[0013] The sequence of the RT primer includes: GTCGT ATCCAGTGCAGGGTC CGAGG TATTC GCACTGGATACGACAGGCGA;

[0014] The sequences of the qPCR primers include: F':TTGGT GGTTC AGTGG TAGAATTC; R':AGTGC AGGGTCCGAG GTATT;

[0015] The sequences of the gene-specific probes include: Sense: GCAUU GGUGG UUCGU GGUAG AAUUCUCGCC U; Antisense: AGGCG AGAAU UCUAC CACUG AACCACCAAU GC.

[0016] Since the embodiments of the present invention demonstrate the important role of tsRNA-20 in promoting hepatocyte proliferation, the kit for detecting tsRNA-20 has certain application potential and can be widely used in the research of related signal pathways and medical experiments and clinical trials of various liver diseases.

[0017] Another object of the present invention is to provide a shRNA for knocking down tsRNA-20, wherein the nucleotide sequence includes CCACCAATGC.

[0018] Another object of the present invention is to provide a shRNA for knocking down ACPH, wherein the nucleotide sequence includes GAACACTTTG ATGCA AGCCA T.

[0019] In the comparative example of the present invention, shRNA knocking down tsRNA-20 and shRNA knocking down ACPH are used for experimental verification of related mechanisms. Since the embodiments of the present invention prove the important role of tsRNA-20 in promoting hepatocyte proliferation, shRNA knocking down tsRNA-20 and shRNA knocking down ACPH have certain application potentials and can be widely used in the research of related signal pathways and medical experiments and clinical trials of various liver diseases.

[0020] Compared with the prior art, the beneficial effects of the present invention are: revealing that tsRNA-20 promotes hepatocyte proliferation through the ACPH / GRHL1 regulatory axis, thereby providing a new strategy and target for the treatment of acute-on-chronic liver failure. Specifically, it was found that tsRNA-20 binds to ACPH and regulates its expression in hepatocytes, thereby activating the Ras-ERK pathway and promoting the nuclear translocation of GRHL1, and ultimately enhancing the proliferation of normal hepatocytes. Therefore, when applied to the treatment of acute-on-chronic liver failure, tsRNA-20, its precursor tRNA-GIy-CCC, and its regulatory object ACPH / GRHL1 can be regulated as targets to promote hepatocyte proliferation, thereby promoting liver regeneration, improving the therapeutic effect of acute-on-chronic liver failure, and prolonging the survival of patients with liver disease, becoming a new target for precision treatment, and having a high clinical application value. The relationship between tsRNA-20, ACPH, and GRHL1 revealed can also provide a research basis for further improving the therapeutic effect of acute-on-chronic liver failure and promote the development of the field of liver disease treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 We showed that tsRNA-20 was downregulated in plasma exosome samples and liver tissues of ACLF patients, and was downregulated in an in vitro model of ACLF and an in vivo mouse model.

[0022] Figure 2 It was shown that overexpression of tsRNA-20 promoted hepatocyte proliferation and restored the viability of damaged hepatocytes, while knockdown of tsRNA-20 inhibited hepatocyte proliferation.

[0023] Figure 3 showed that tsRNA-20 binds to ACPH and regulates its expression in hepatocytes.

[0024] Figure 4 It was shown that ACPH promoted hepatocyte proliferation by activating the Ras pathway, and knocking down ACPH inhibited hepatocyte proliferation.

[0025] Figure 5 It was shown that knockdown of tsRNA-20 could inhibit the proliferation of hepatocytes by reducing the level of GRHL1.

[0026] Figure 6showed that ACPH interacts with GRHL1 and promotes its nuclear translocation in hepatocytes.

[0027] Figure 7 It shows that tsRNA-20 regulates hepatocyte proliferation through the ACPH / GRHL1 regulatory axis under normal and ACLF conditions. DETAILED DESCRIPTION

[0028] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0029] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0030] The present invention is further described in conjunction with specific examples. The following examples are only for explaining the present invention, but do not constitute a limitation of the present invention. If the specific experimental conditions are not specified in the examples, they are usually carried out according to conventional conditions or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels.

[0031] 1. Patients and clinical samples

[0032] The present invention selected fresh liver tissue specimens from ACLF patients (n=11) and healthy subjects (n=3) from the Third Affiliated Hospital of Sun Yat-sen University from December 2019 to December 2022, as well as plasma samples from 49 ACLF patients and 52 healthy subjects. All specimens were frozen and stored at -80°C immediately after collection.

[0033] For plasma samples, plasma exosomes were isolated using a total exosome isolation kit (Cat#4484450, Invitrogen, USA) according to the manufacturer’s protocol. 5 L02 cells were grown to 70%-80% confluence and then cultured with plasma exosomes from ACLF patients for 24 h to construct an in vitro model.

[0034] 2. Cell lines

[0035] Normal human hepatocyte cell lines L02 and THLE-2 were from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Hepatocyte cell lines were grown in DMEM (Gibco) medium supplemented with 10% FBS (CellCook, CM1002L). Human renal epithelial cells (293T) were cultured in DMEM (Gibco) supplemented with 10% FBS (CellCook, CM1002L). The cell lines were incubated in a humidified incubator at 37°C and 5% CO2. The cells were seeded in 6-well plates at a cell density of 20%-40%. After 24 hours, tsRNA-20 mimics or control mimics (Ribobio, Guangzhou, China) (100nM) were transfected into the cells using Lipofectamine3000 (ThermoFisher, USA). The tsRNA mimic sequence is the same as the tsRNA, and the specific sequence is shown in Table 1. siRNAs targeting GRHL1 (HSS120977, HSS120978, and HSS179071) were purchased from Thermo Fisher (Cat#1299001), and HSS120977 was used to knock down GRHL1. Cell lines were transiently transfected with the indicated siRNAs or negative control siRNA (Thermo Fisher, Cat#12935300).

[0036] 3. Plasmid and Lentivirus Packaging

[0037] The pGreen-sh-tsRNA20 lentiviral plasmid was constructed by pGreenPuro-shRNA cloning and expression lentiviral vector (Cat#s SI505A-1; System Biosciences, USA) according to the manufacturer's protocol. In brief, we designed and constructed the sh-tsRNA20 sequence (5′-CCACCAATG-3′) for tsRNA-20. The control shRNA (sh-NC) was used for the negative control group (5′-TTCTCCGAGGTCACGT-3′). The lentiviral packaging system for the auxiliary plasmids (pMD2.G and psPAX2 plasmids) and target plasmids (pGreen-sh-tsRNA20, pCDH-3×Flag-GRHL1, pCDH-3×HA-ACPH and pLKO.1-sh-ACPH) plasmids was ordered from Igebio. For lentiviral packaging, 6 × 10 cells were transfected using Lipofectamine 3000 (Invitrogen) with a mixture of 2 μg of target plasmid, 1.5 μg of envelope encoding pMD2.G plasmid, and 2 μg of packaging vector psPAX2 plasmid. 6 293T cells. Culture supernatants containing packaged virus were harvested 48 h after transfection. For viral infection, confluent hepatocytes (L02 and THLE-2 cells) were plated with 200 μl of virus (2 × 10 5Transduction units / ml) and 6μg / ml polybrene as a transduction enhancer were incubated for 48 hours. After infection, hepatocytes were grown in medium containing 0.5μg / ml puromycin, which was changed every three days to eliminate untransfected cells. After 10 days, hepatocytes were grown in medium without puromycin.

[0038] 4. Construction of ACLF Mouse Model

[0039] Use wild-type (WT) 6-8 week old male C57BL / 6 mice (GemPharmatech, Guangdong, China). Mice are housed in a specific pathogen-free environment, and a 12-hour light / dark cycle is maintained with free access to standard mouse food and water. In order to induce liver fibrosis, 5 mL / kg CCl4 (Sigma-Alderch) dissolved in olive oil (v / v, 10%, Sigma-Aldrich) is administered to mice by intraperitoneal injection (ip) twice a week for 8 weeks. On this basis, after 72 hours, high doses of 5 mL / kg CCl4 ((v / v, 50%) are injected to mice. The mice injected with the same dose of olive oil are used as controls.

[0040] 5. RNA extraction, reverse transcription and quantitative real-time PCR

[0041] RNA was extracted from cell lines, plasma exosomes, and preserved ACLF tissues using AG RNAex Pro RNA Trizol regent (Aikura, Cat#AG21102) according to specific instructions. Relatively pure RNA was obtained after treatment with chloroform, isopropanol, and ethanol. During this process, the RNA solution was centrifuged several times. The RNA concentration was then determined using Nanodrop, and the OD value of the 260 / 280 absorbance ratio was between 1.8 and 2.0. tsRNA expression analysis was performed using the stem-loop qRT-PCR method, and the stem-loop primers used for reverse transcription and the primers used for qRT-PCR are listed in Table 2. The first-strand cDNA was prepared using the PrimeScript TM RT kit (Takara, Cat#RR037A) according to specific instructions. TB was used. Ex TaqTMII (Takara, Cat#RR820A) was used for 3 qPCR procedures. RNA expression was normalized to GAPDH or U6, and relative quantification (RQ) of gene expression was explored using the ΔΔCt method. Quantitative RT-PCR was performed using SYBR Green dye using (Applied Biosystems). PCR reactions were performed in triplicate.

[0042] 6. RNA-seq analysis

[0043] tsRNA-20 knockdown L02 cells and negative control cells were cultured in 6 cm culture dishes. When the density of cells in the culture dish was close to full confluence, they were lysed, centrifuged, and RNA was isolated using TRIzol (Acrolein, Cat# AG21102, Changsha, China). RNA samples were analyzed at Beijing Annoroad Genomics Institute. Ultra TM RNALibrary Prep Kit for Sequencing libraries were generated according to the manufacturer’s instructions (Cat# E7530L, NEB, USA), and index codes were added to associate sequences with each sample. Differentially expressed genes were identified using SPORT, followed by functional enrichment analysis.

[0044] 7. RNA Pull-down Analysis and Mass Spectrometry Detection

[0045] Biotin-labeled sense and antisense tsRNA-20 probes were synthesized by Synbio Technologies. First, 50 μL of streptavidin-labeled Dynabeads (Cat#88802; Thermo Fisher Scientific) were washed three times with binding buffer, resuspended in 200 μL of buffer, and then incubated on a shaker for 4 h at 4 °C with sense and antisense RNA or blank Dynabeads as negative control. Subsequently, 2 mg of protein lysate from THLE-2 cells was added, and the mixture was rotated overnight at 4 °C. After washing three times with phosphate-buffered saline (PBS) on a magnetic separation stand, the RNA-protein complex was resuspended in PBS and denatured in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer at 99 °C for 10 min. Proteins were separated by SDS-PAGE using 10% gels and visualized with a silver staining kit (Cat#24600; Thermo Fisher, USA). Different protein bands were excised and analyzed using mass spectrometry. Fitgene Biotech processed the raw spectral data using MM File Conversion and analyzed protein identity using Mascot software (version 2.6.0) against the Human UniProt database (https: / / www.uniprot.org / ).

[0046] 8. Western Blot

[0047] Protein extracts were prepared using RIPA lysis buffer (P0013K, Beyotime, Shanghai, China) containing protease inhibitors (Roche, P8340, Shanghai, China) and phosphatase inhibitors (Roche, P0044, Mannheim, Germany) on ice for 30 min and then centrifuged at 13,000 × g and 4 °C for 10 min. BCA protein assay kit (ThermoScientific, USA) was used to quantify protein. The cell lysate was then subjected to 10% tricine-SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and then electronically blotted on a 0.2 μM nitrocellulose (NC) membrane (Millipore). After incubation with the target and secondary antibody, the membrane was subjected to chemiluminescence by a gel imaging system (SyngeneG: BOXF3, USA). GRHL1 antibody was purchased from Sigma-Aldrich (HPA005798). ACPH antibody was purchased from Bethyl (A304-808A). ERK1 / 2pERK1 / 2 antibody was purchased from Cell Signaling Technology (CST4695, CST4370). The Ras activation assay biochemical kit (BK008-S) containing Pan-Ras antibody was purchased from Cytoskeleton. Rabbit anti-β-actin antibody (CST, 4970) and rabbit anti-GAPDH antibody (CST, 5174) were used as endogenous controls.

[0048] 9. Cell counting kit 8 (CCK-8) assay

[0049] Cell growth viability was measured by CCK-8 kit (Biyuntian Biotechnology, C0038, Shanghai, China). After 48 hours of transfection, cells were seeded in 96-well plates at a density of approximately 2×103 cells per well. After discarding the original culture medium, 10 μl of CCK-8 solution and 100 μl of complete culture medium were added to the wells at fixed intervals. OD values ​​(450 nm) were detected. All measurements were repeated 3 times.

[0050] 10. EdU detection

[0051] The Cell-Light EdU Apollo in vitro kit for EdU assay (Beyotime, Guangzhou, China) was used to compare the growth capacity. First, L02 and THLE-2 cell lines were transfected with target RNA or plasmid. Subsequently, 4 × 10 3Each transfected cell was seeded into each well of a 24-well plate. The EdU solution was diluted with complete medium to a final concentration of 50 μM. This EdU medium was then added to each well and the cells were incubated for 2 hours. After fixation, permeabilization, and staining, images were captured using a fluorescence microscope.

[0052] 11. Clone formation

[0053] For cell proliferation assays involving target gene overexpression or knockdown, cells were plated at 1 × 10 4 The density of cells was inoculated in 5 mL of culture medium supplemented with 10% fetal bovine serum (FBS). The culture medium was changed every 3 days. After 10-14 days of culture, the cells were fixed in 4% formaldehyde and stained with 0.1% crystal violet. ImageJ software v1.8 (National Institutes of Health, Bethesda, MD, USA) was used to count the number of colonies.

[0054] Experiment 1 Expression level of tsRNA-20 in plasma exosomes and liver tissues of ACLF

[0055] tsRNA sequencing was performed on plasma exosomes from three healthy subjects (labeled as N) and five ACLF patients (labeled as L). Figure 1 A), sequencing results showed that the 16 differentially expressed tsRNAs were all downregulated in ACLF patients (|FC|≥2; P<0.05), among which tsRNA-5' derived from the 5' end of mature tRNA was the most abundant tsRNA ( Figure 1 B). Among these candidate tsRNAs, tsRNA-20 (tRNA-Gly-CCC-1-1) met the predetermined threshold for significant expression levels determined in the study. Figure 1 C shows a schematic diagram of the predicted cleavage of tsRNA-20 from mature tRNA-Gly-CCC. In addition, we detected the expression level of tsRNA-20 in plasma exosomes and liver tissues of patients and confirmed that the expression level of tsRNA-20 in ACLF plasma exosomes (n=49) was significantly reduced compared with normal plasma exosome samples (n=52) (P<0.0001)( Figure 1 D). We also performed a retrospective nested case-control study. Initially, three patients were diagnosed with hepatitis B virus flare (HBV flare) and developed acute-on-chronic liver failure (ACLF) within 4 weeks. Their plasma samples were collected every three days and analyzed. Our analysis showed that tsRNA-20 levels in plasma exosome samples during the ACLF period were significantly reduced compared with samples collected during the initial stage of HBV flare (P < 0.01, Figure 1E). Samples from the same patient at different time points are indicated by patient numbers. In addition, the expression level of tsRNA-20 in ACLF liver tissue (n=11) was significantly lower than that in normal tissue (n=3) (P<0.05). Figure 1 F). Throughout the above experiments, many evidences show that tsRNA-20 is downregulated in acute-on-chronic liver failure (ACLF), which is consistent with our sequencing results, indicating that it may play a key role in the pathogenesis of ACLF. Therefore, tsRNA-20 was selected as the research object.

[0056] In addition, we established ACLF in vitro and in vivo models. First, L02 hepatocytes were incubated with plasma exosomes from ACLF patients overnight to establish an ACLF in vitro model. The results showed that the level of tsRNA-20 in the ACLF model was significantly reduced compared with the negative control (P<0.01)( Figure 1 G). Next, mice injected with CCl4 were used as an in vivo model of ACLF ( Figure 1 LM). This study found that the expression level of tsRNA-20 in exosomes of primary ACLF mouse hepatocytes was significantly lower than that in wild-type (WT) mouse hepatocytes (P<0.0001)( Figure 1 H).

[0057] Experiment 2tsRNA-20 mimics significantly reduced the inhibitory effect of exosomes from patients with acute-on-chronic liver failure (ACLF) on the proliferation of L02 cells

[0058] To evaluate the biological function of tsRNA-20 in ACLF, we performed gain-of-function and loss-of-function experiments in hepatocytes. In the loss-of-function experiments, tsRNA-20 sh-RNA and negative control (sh-NC) lentivirus were synthesized and transfected into L02 and THLE-2 cells. The transfection efficiency was tested by qRT-PCR. The results are shown in Figure 2 As shown in A, it proves that its knockdown is reliable. CCK-8 assay showed that the knockdown of tsRNA-20 significantly inhibited the proliferation of normal cells ( Figure 2 B). Flow cytometry analysis of the cell cycle showed that knockdown of tsRNA-20 caused the cell cycle to arrest at the G0 / G1 phase ( Figure 2 C). Gain-of-function experiments using transfection of tsRNA-20 mimics for EdU and colony formation assays showed that knockout of tsRNA-20 inhibited cell proliferation, whereas overexpression of tsRNA-20 enhanced cell proliferation, and similar results were observed in L02 cells and THLE-2 cells ( Figure 2DE). EdU assay was then used to detect the cell proliferation ability of tsRNA-20 in an ACLF in vitro cell model. Plasma exosomes from ACLF patients were incubated with human L02 hepatocytes transfected with and without tsRNA-20 mimics. The results showed that exosomes from ACLF patients were significantly harmful to L02 cells, while the cell growth inhibition was greatly reduced after the introduction of tsRNA-20 mimics, indicating that tsRNA-20 has a promoting effect on the recovery of damaged liver cell vitality ( Figure 2 F).

[0059] Experiment 3 tsRNA-20 interacts with ACPH and regulates its expression in hepatocytes

[0060] After we synthesized the sequence probe of biotin-labeled tsRNA-20, we used the sense chain probe sequence including rGrCrArUrUrGrGrUrGrGrUrUrCrGrUrGrGrUrArGrArArUrUrCrUrCrGrCrUr, and the antisense chain probe sequence including rArGrGrCrGrArArUrUrCrUrArCrCrArCrUrGrArArCrCrArCrArArUrGrC to perform RNA pull-down analysis, and then performed mass spectrometry protein analysis to determine the proteins that interact with tsRNA-20 in L02 and THLE-2 cells ( Figure 3 A). This study showed that tsRNA-20 co-binds with multiple RNA binding proteins, and ACPH exhibits the highest binding affinity. RNA immunoprecipitation (RIP) experiments also showed that tsRNA-20 was significantly enriched in RNA after ACPH antibody immunoprecipitation ( Figure 3 B). Subsequently, we evaluated the expression level of ACPH in hepatic cell lines. After transfecting L02 and THLE-2 cell lines with sh-tsRNA-20 lentiviral plasmids and tsRNA-20 mimics, we observed that overexpression of tsRNA-20 led to upregulation of ACPH protein expression, while knockout of tsRNA-20 reduced ACPH protein expression ( Figure 3 CD).

[0061] In addition, we evaluated the expression of ACPH in human plasma exosomes and liver tissue samples from ACLF patients and healthy controls. As expected, ACPH protein levels were significantly lower in all ACLF samples than in control samples ( Figure 3 E, F). The in vivo ACLF mouse model also showed that the expression of ACPH was significantly reduced in ACLF samples compared with wild-type samples ( Figure 3 G).

[0062] Experiment 4 Overexpression of ACPH activates Ras pathway to promote hepatocyte proliferation

[0063] To evaluate the biological function of ACPH in ACLF, we performed gain-of-function and loss-of-function experiments in hepatocytes. ACPH sh-RNA, ACPH overexpression, and negative control (sh-NC) lentivirus were synthesized and transfected into L02 and THLE-2 cells. The transfection efficiency is shown in Figure 4 AB. EdU and colony formation experiments showed that in THLE-2 and L02 cells, overexpression of ACPH promoted the proliferation of hepatocytes, while knockout of ACPH inhibited the proliferation of cells ( Figure 4 CF). To further elucidate the role of tsRNA-20 in regulating cell proliferation through interaction with ACPH, we performed a rescue experiment. The results showed that overexpression of ACPH significantly reduced the inhibitory effect of sh-tsRNA-20 on THLE-2 cell proliferation ( Figure 4 Based on the above results, we believe that the effect of tsRNA-20 on hepatocyte proliferation is at least partly dependent on ACPH.

[0064] To elucidate the potential pathways by which tsRNA-20 plays a role in ACPH-mediated hepatocyte proliferation, we performed RNA-seq analysis. KEGG pathway analysis showed that the target molecules for downregulating tsRNA-20 were mainly enriched in the MAPK signaling pathway. Ras pull-down experiments showed that ACPH overexpression significantly enhanced Ras enzyme activity compared with the negative control, characterized by an increase in the GTP-bound form and an increase in the total Ras protein level ( Figure 4 IJ). The above results indicate that ACPH can rescue the inhibitory effect of tsRNA-20 decrease on hepatocyte proliferation by activating Ras signaling pathway.

[0065] Experiment 5 Knockdown of tsRNA-20 can inhibit hepatocyte proliferation by reducing GRHL1 levels in ACLF

[0066] To explore target genes regulated by tsRNA-20, we also performed RNA-seq analysis on L02 cells treated with exosomes from ACLF patients. By overlapping the differentially expressed RNAs in the two groups of L02 cells (control and ACLF exosomes; sh-NC and sh-tsRNA-20), we identified 12 overlapping RNAs as candidate RNAs ( Figure 5A), GRHL1, FAM106A, SERPINB3, RAD9B, NOG, INHBE, LXN, CREB3L3, IGLON5, AP001029.1, SPRED1, NR1D2, and RPS6KL. Among them, GRHL1 was the most downregulated after tsRNA-20 knockout, which was verified by qRT-PCR ( Figure 5 B). Flow cytometry was used to detect the cell cycle, and EdU and colony formation experiments were used to study the biological function of GRHL1. First, we transduced lentivirus to overexpress GRHL1 or transfected siRNA against GRHL1 to knock it out in THLE-2 and L02 cell lines. We found that in both cell lines, overexpression of GRHL1 enhanced cell proliferation and increased the number of cells in the S phase of the cell cycle, while downregulation of GRHL1 inhibited cell proliferation ( Figure 5 CE). In addition, the expression levels of GRHL1 in liver tissue and plasma exosomes of ACLF patients and ACLF mouse model were significantly lower than those in the corresponding control group ( Figure 5 F, G, H). In addition, rescue experiments showed that co-transfection of THLE-2 cells with GRHL1 overexpression vector and sh-tsRNA-20 led to a significant increase in cell proliferation, indicating that the biological function of tsRNA-20 is partially dependent on GRHL1 ( Figure 5 I).

[0067] In summary, tsRNA-20 gene knockdown-induced GRHL1 gene downregulation may play an important role in the pathogenesis of ACLF.

[0068] Experiment 6ACPH interacts with GRHL1 and promotes its nuclear translocation in hepatocytes

[0069] To fully elucidate its potential mechanism, we performed subcellular fractionation experiments. The results showed that tsRNA-20 and ACPH were mainly localized in the cytoplasm, while GRHL1 was mainly localized in the nucleus ( Figure 6 A). The results showed that overexpression of ACPH not only increased the expression level of ACPH, but also upregulated the expression of GRHL1. In contrast, knockdown of the ACPH gene resulted in the inhibition of both ACPH and GRHL1 expression. Notably, co-transfection of overexpressed ACPH with sh-tsRNA-20 into THLE-2 cells effectively rescued the reduction of GRHL1 caused by downregulation of tsRNA-20 ( Figure 6 B). To determine whether ACPH interacts directly with GRHL1, we first used protein binding prediction software to predict that the two can directly bind ( Figure 6C, D). Subsequent immunofluorescence analysis showed that ACPH overexpression promoted the translocation of GRHL1 from the cytoplasm to the nucleus in hepatocytes ( Figure 6 E) These results suggest that ACPH, which activates the Ras / ERK pathway, is an upstream regulator of GRHL1.

[0070] In general, this example found that tsRNA-20 promoted hepatocyte proliferation by regulating the ACPH / GRHL1 axis. Figure 7 As shown. Mechanistically, the inventors discovered and verified through experiments that tsRNA-20 binds to ACPH and regulates its expression in hepatocytes; GRHL1 is a key target gene in the transcriptome changes induced by tsRNA-20; in addition, it was demonstrated that overexpression of ACPH significantly increased the activity of Ras-GTPase, indicating that overexpression of ACPH alleviated the inhibitory effect of sh-tsRNA-20 on hepatocyte proliferation by activating the Ras / ERK signaling pathway; it was also confirmed that the levels of ACPH and GRHL1 were downregulated in liver tissue and plasma exosomes of ACLF patients, while the upregulation of ACPH and GRHL1 levels could promote hepatocyte proliferation. These findings indicate that the downregulation of ACPH and GRHL1 levels caused by the downregulation of tsRNA-20 plays an important role in the pathogenesis of ACLF, providing new insights into the pathogenesis of ACLF.

[0071] In terms of drug intervention, the introduction of tsRNA-20 mimics in in vitro experiments significantly reduced the toxicity of exosomes from ACLF patients to L02 cells and promoted their proliferation. Therefore, tsRNA-20 or its mimics and tsRNA-20 promoters can be used in the preparation of ACLF drugs. In addition, since the expression levels of ACPH and GRHL1 in liver tissue and plasma exosomes of ACLF patients and ACLF mouse models are significantly lower than those in the corresponding control groups, and the present invention proves that overexpression of ACPH and GRHL1 can promote the proliferation of normal hepatocytes, ACPH promoters and / or GRHL1 promoters also have the potential for the preparation of ACLF drugs.

[0072] Obviously, the above embodiments of the present invention are only examples for clearly illustrating the technical solutions of the present invention, and are not intended to limit the specific implementation methods of the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the claims of the present invention shall be included in the protection scope of the claims of the present invention.

Claims

1. Use of tsRNA-20 or its mimics in the preparation of a drug for treating acute-on-chronic liver failure and / or promoting hepatocyte proliferation, characterized in that: The nucleotide sequence of the tsRNA-20 or its mimetic includes GCATT GGTGG TTCAG TGGTAGAATT CTCGC CT.

2. The use according to claim 1, characterized in that: tsRNA-20 or its mimics bind to ACPH and promote GRHL1 nuclear translocation, thereby promoting hepatocyte proliferation.

3. Use of tsRNA-20 promoter, ACPH promoter and / or GRHL1 promoter in the preparation of drugs for treating acute-on-chronic liver failure and / or promoting hepatocyte proliferation.

4. Use of human tRNA-GIy-CCC, ACPH and / or GRHL1 as targets in the preparation of drugs for treating acute-on-chronic liver failure and / or promoting hepatocyte proliferation.

5. A drug for treating acute-on-chronic liver failure, characterized in that: It includes tsRNA-20, tsRNA-20 mimics, tsRNA-20 promoter, ACPH promoter and / or GRHL1 promoter; the nucleotide sequence of the tsRNA-20 or its mimics includes GCATT GGTGG TTCAG TGGTAGAATT CTCGC CT.

6. A drug for promoting hepatocyte proliferation, characterized in that: It includes tsRNA-20, tsRNA-20 mimics, tsRNA-20 promoter, ACPH promoter and / or GRHL1 promoter; the nucleotide sequence of the tsRNA-20 or its mimics includes GCATT GGTGG TTCAG TGGTAGAATT CTCGC CT.

7. A kit for detecting tsRNA-20, characterized in that: including one or more of nucleic acid extraction reagents, RT primers, qPCR primers, and gene-specific probes; The sequence of the RT primer includes: GTCGT ATCCAGTGCA GGGTC CGAGG TATTC GCACT GGATACGACAGGCGA; The sequences of the qPCR primers include: F':TTGGT GGTTC AGTGG TAGAA TTC; R':AGTGC AGGGTCCGAG GTATT; The sequences of the gene-specific probes include: Sense: GCAUU GGUGG UUCGU GGUAG AAUUC UCGCC U; Antisense: AGGCG AGAAU UCUAC CACUG AACCA CCAAU GC.

8. A shRNA for knocking down tsRNA-20, characterized in that The nucleotide sequence includes CCACC AATGC.

9. A shRNA for knocking down ACPH, characterized in that The nucleotide sequence includes GAACACTTTG ATGCA AGCCAT.

Images