Bacillus amyloliquefaciens H-6 and application thereof in preparation of medicine for treating or preventing porcine reproductive and respiratory syndrome virus infection

Abstract

The invention belongs to the technical field of antiviral microecological preparations for livestock and poultry, and particularly relates to bacillus amyloliquefaciens H-6 and application thereof in preparation of drugs for treating or preventing porcine reproductive and respiratory syndrome virus infection. The preservation number of the bacillus amyloliquefaciens is CCTCC (China Center for Type Culture Collection) NO: M 20242740. The bacterial strain can reduce the infection activity of PRRSV cells, inhibit invasion and infection of PRRSV to the cells, and reduce proliferation of viruses on the cells. The anti-infection research on the cell level and the animal body level shows that the strain has a remarkable PRRSV resisting effect in vivo and in vitro, proliferation of viruses in a pig body can be reduced, damage of PRRSV infection to lung tissues and organs is reduced, the adverse effect of PRRSV infection to the body is effectively controlled, clinical disease symptoms of the pig during PRRSV infection can be weakened, and the porcine reproductive and respiratory syndrome treatment effect is improved. The composition can be used for preventing and controlling the porcine reproductive and respiratory syndrome.

Description

Technical Field

[0001] The invention belongs to the technical field of antiviral microecological preparations for livestock and poultry, and specifically relates to Bacillus amyloliquefaciens H-6 and application thereof in preparing medicines for treating or preventing porcine reproductive and respiratory syndrome virus infection. Background Art

[0002] Porcine Reproductive and Respiratory Syndrome (PRRS) is a highly contagious disease caused by Porcine Reproductive and Respiratory Syndrome virus (PRRSV), which is characterized by reproductive disorders in sows and respiratory disorders in pigs of all ages. PRRSV infection can cause respiratory diseases in pigs of all ages. At the same time, PRRSV infection can also cause immune system disorders and immunosuppression, thereby triggering secondary infections or mixed infections with other pathogens such as porcine circovirus type 2, Streptococcus suis, and Mycoplasma hyopneumoniae, resulting in concentrated outbreaks of multiple inflammations in the body in the late stage of PRRSV infection, ultimately leading to an increase in the mortality rate of infected pigs, causing huge economic losses to the pig farming industry. However, due to the high variability of PRRSV, the continuous emergence of new strains, immune escape and poor cross-protection between heterologous strains, the protective efficacy of existing vaccines is limited, PRRSV infection has not been well controlled, and the emergence of mutant strains often leads to the spread of PRRSV disease. Related research on antiviral drugs has found that the development of antiviral drugs is often characterized by high R&D costs, long R&D cycles, and high production costs. As a green and safe microorganism, probiotics have many types and wide sources, which provide new ideas for the development of anti-PRRSV drugs. They are currently one of the effective choices for the development of anti-PRRSV drug preparations.

[0003] PRRS is one of the important infectious diseases that affects the development of the world's pig farming industry. Although PRRS has been studied at home and abroad for more than 30 years, there is no effective antiviral product in clinical practice. Summary of the invention

[0004] The purpose of the present invention is to solve the problem that porcine reproductive and respiratory syndrome virus (PRRSV) infection is difficult to prevent and treat, and to provide a strain of Bacillus amyloliquefaciens H-6 resistant to porcine reproductive and respiratory syndrome virus infection. The preservation number of the strain of Bacillus amyloliquefaciens is: CCTCC NO: M 20242740.

[0005] Another object of the present invention is to provide the use of Bacillus amyloliquefaciens H-6 in the preparation of a medicament for treating or preventing porcine reproductive and respiratory syndrome virus infection.

[0006] In order to achieve the above object, the present invention adopts the following technical measures:

[0007] The applicant screened out a Bacillus amyloliquefaciens strain from 92 self-retained Bacillus strains that has a significant inhibitory effect on porcine reproductive and respiratory syndrome virus infection. The strain was deposited in the China Center for Type Culture Collection on December 6, 2024, and the classification name is: Bacillus amyloliquefaciens H-6, the deposit number is CCTCCNO: M 20242740, and the address is: Wuhan University, Wuhan, China.

[0008] The protection scope of the present invention includes:

[0009] The fermentation broth of Bacillus amyloliquefaciens H-6 contains live bacteria of Bacillus amyloliquefaciens H-6.

[0010] A compound, wherein the active ingredient of the compound comprises live bacteria of Bacillus amyloliquefaciens H-6 with a preservation number of CCTCC NO: M 20242740.

[0011] Application of Bacillus amyloliquefaciens H-6, fermentation broth of Bacillus amyloliquefaciens H-6 and / or a compound thereof in preparing a medicine for treating or preventing porcine reproductive and respiratory syndrome virus infection.

[0012] Application of Bacillus amyloliquefaciens H-6, fermentation broth of Bacillus amyloliquefaciens H-6 and / or a compound thereof in the preparation of a drug for reducing the sensitivity of cells to porcine reproductive and respiratory syndrome virus.

[0013] In the above application, preferably, the cells are porcine cells.

[0014] Application of Bacillus amyloliquefaciens H-6, fermentation liquid of Bacillus amyloliquefaciens H-6 and / or a compound thereof in the preparation of a feed additive for pigs.

[0015] Compared with the prior art, the present invention has the following advantages:

[0016] In the present invention, the probiotic Bacillus amyloliquefaciens H-6 was used to study the anti-infection of PRRSV at the cellular level and the animal body level, and it was found that it has significant anti-PRRSV activity both in vivo and in vitro. As a potential antiviral microecological preparation, Bacillus amyloliquefaciens has the following advantages compared with vaccines and traditional antiviral chemical drugs:

[0017] 1. Bacillus amyloliquefaciens has low production cost, strong stress resistance, and is easy to store, transport and use.

[0018] 2. No toxic side effects, no residue, anti-viral, growth-promoting, green and safe.

[0019] 3. It has the advantages of easy use, safety, no immune stress and high economic benefits.

[0020] 4. The Bacillus amyloliquefaciens H-6 fermentation broth of the present invention can reduce the infection activity of PRRSV cells at the cellular level, inhibit the invasion and infection of PRRSV to cells, reduce the proliferation of the virus on cells, and can be used to prevent and control PRRSV infection.

[0021] 5. The Bacillus amyloliquefaciens H-6 preparation of the present invention, when administered orally to experimental pigs, can effectively protect against morbidity and mortality caused by PRRSV infection. 80% of the pigs in the control group died, while the survival rate of the pigs in the group fed with the Bacillus amyloliquefaciens preparation reached 100%. It can significantly inhibit PRRSV detoxification, reduce environmental pollution, significantly reduce the damage of PRRSV infection to lung tissues and organs, and effectively control the adverse effects of PRRSV infection on the body, and can be used for the prevention and control of PRRSV. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 To study the effect of Bacillus amyloliquefaciens preparation on the proliferation of porcine reproductive and respiratory syndrome virus (PRRSV) at the cellular level.

[0023] Figure 2 To study the effect of feeding Bacillus amyloliquefaciens preparation on the survival rate of PRRSV infection.

[0024] Figure 3 To study the effect of feeding Bacillus amyloliquefaciens preparation on the clinical symptoms of pigs infected with PRRSV.

[0025] Figure 4 To study the effect of feeding Bacillus amyloliquefaciens preparation on the virus content in the serum of pigs infected with PRRSV.

[0026] A was the positive control group infected with PRRSV, and B was the test group fed with Bacillus amyloliquefaciens preparation.

[0027] Figure 5 To study the effect of feeding Bacillus amyloliquefaciens preparation on the body temperature of pigs infected with PRRSV.

[0028] A was the positive control group infected with PRRSV, and B was the test group fed with Bacillus amyloliquefaciens preparation.

[0029] Figure 6 To investigate the effect of feeding Bacillus amyloliquefaciens preparation on the body weight of pigs infected with PRRSV.

[0030] A was the positive control group infected with PRRSV, and B was the test group fed with Bacillus amyloliquefaciens preparation.

[0031] Figure 7 To study the effect of feeding Bacillus amyloliquefaciens preparation on the virus content in anal swabs of pigs infected with PRRSV.

[0032] A was the positive control group infected with PRRSV, and B was the test group fed with Bacillus amyloliquefaciens preparation.

[0033] Figure 8 To study the effect of Bacillus amyloliquefaciens preparation on the virus content in throat swabs of pigs infected with PRRSV.

[0034] A was the positive control group infected with PRRSV, and B was the test group fed with Bacillus amyloliquefaciens preparation.

[0035] Fig. 9 To study the effect of Bacillus amyloliquefaciens preparation on the virus content in nasal swabs of pigs infected with PRRSV.

[0036] A was the positive control group infected with PRRSV, and B was the test group fed with Bacillus amyloliquefaciens preparation.

[0037] Fig.10 To study the effects of Bacillus amyloliquefaciens preparations on tissue and organ lesions in pigs infected with PRRSV. DETAILED DESCRIPTION

[0038] In order to better understand the content of the present invention, the content of the present invention is further described below in conjunction with specific embodiments, but the protection content of the present invention is not limited to the following embodiments. The test methods and conditions in the embodiments of the present invention are conventional methods unless otherwise specified. The technical solutions described in the present invention are conventional solutions in the field unless otherwise specified; the reagents or materials are derived from commercial channels unless otherwise specified.

[0039] Embodiment 1:

[0040] Screening of probiotic strains against PRRSV infection

[0041] 1. Cultivation of Marc-145 cells

[0042] Take the frozen Marc145 cells out of the liquid nitrogen tank, quickly thaw them in a 37°C water bath, and then centrifuge the cell suspension in a centrifuge tube. After centrifugation, discard the supernatant, resuspend in 10% serum 1640 complete medium and transfer to a T25 cell culture flask, and culture the cell flask in a constant temperature cell culture incubator at 37°C containing 5% CO2. After the cells grow into a uniform monolayer, discard the supernatant, wash with PBS three times, add trypsin to digest the cells for 3-5 minutes, terminate the digestion with 1640 complete medium, discard the supernatant after centrifugation, add fresh complete medium to resuspend the cells, and then inoculate the cells into a new cell culture flask or culture plate for later use.

[0043] 2. Preparation of probiotic fermentation broth

[0044] 92 glycerol strains of Bacillus preserved in the applicant's laboratory were streaked and cultured, and then a single colony was picked and inoculated into 50 ml NB liquid culture medium. After culturing at 37°C in a shaking incubator for 24 hours, the culture was centrifuged at 3500r / min for 10 minutes, and the supernatant was taken and stored at -80°C for later use.

[0045] 3. Anti-PRRSV treatment of probiotic fermentation broth in Marc 145 cells and alveolar macrophages (PAM)

[0046] Marc145 cells were evenly inoculated in a 24-well cell plate and placed in a constant temperature cell culture incubator for culture. When the cells grew into a uniform monolayer, the supernatant was discarded, washed 3 times with sterile PBS, and then inoculated with 1640 medium containing different probiotic fermentation broths, where the concentration of the probiotic fermentation broth was 10 μL / mL. A blank control group without fermentation broth was also set up. After 6 hours, the supernatant was discarded, washed 3 times with PBS, and then inoculated with a mixture of 1640 medium containing different probiotic fermentation broths and PRRSV virus (0.1MOI). After 2 hours of incubation in a cell culture incubator, the supernatant was discarded, washed 3 times with PBS, and then inoculated with a new medium containing different probiotic metabolites, and the 24-well cell plate was placed in a constant temperature cell culture incubator for 24 hours. The method of treating primary alveolar macrophages (PAM cells) with probiotic fermentation broth was the same as that of Marc145.

[0047] 4. Determination of viral load in cells and viral fluid

[0048] After 24 hours of culture, the 24-well cell plate was placed in a -80°C refrigerator and repeatedly frozen and thawed three times to fully release the virus particles in the cells, and then centrifuged to obtain the supernatant for viral load detection. The detection method was carried out in accordance with the real-time fluorescence quantitative PCR method recommended by the National Standard of the People's Republic of China for Blue Ear Detection (GB / T18090-2023), with primer sequence F: 5'-GCACTGATTGACAYTGTGCC-3'; R: 5'-CGCATGGTTCTCGCCAAT-3'; probe primer: 5'-(FAM)AGTCACCTATTCAATTAGGGCGACCG(TAMRA)-3'.

[0049] The results are shown in Table 1 and Figure 1 As shown in the figure, among the 92 strains of probiotics screened, it was found that the fermented broth of probiotics No. 57, No. 62, No. 66, No. 71, No. 74, and No. 88 had significant anti-PRRSV activity compared with the control group, P < 0.001, and the CT value was higher than that of the control group. Marc145 cells and primary PAM cells were treated with the fermented broth of No. 74 bacteria and infected with the weak strain NAD30 of PRRSV, the highly pathogenic strain WH3 and the recombinant strain PRRSV-GFP, respectively. The viral content in the cells was detected 24 hours after infection. The results showed that the average CT values ​​of NAD30, WH3, and PRRSV-GFP in Marc145 cells treated with the fermented broth of No. 74 bacteria increased by 12.88, 13.09, and 2.39 respectively compared with the control group; the average CT values ​​of NAD30, WH3, and PRRSV-GFP in primary PAM cells treated with the fermented broth of No. 74 bacteria increased by 7.43, 10.52, and 6.07 respectively compared with the control group. The above results show that probiotic No. 74 can significantly inhibit the proliferation of PRRSV attenuated strain NAD30, highly pathogenic strain WH3 and recombinant strain PRRSV-GFP in Marc145 cells and primary PAM cells. Strain No. 74 has broad-spectrum antiviral activity against PRRSV, so strain No. 74 was further identified.

[0050] 5. Biological characteristics and identification of H-6 strain with anti-PRRSV activity

[0051] The test revealed that probiotic No. 74 is a Gram-positive bacterium that forms spores but does not move. The colony on the NA medium is 3-4 mm in diameter and has a smooth round structure. The study found that the optimal growth temperature for the bacterium is 37°C and the optimal growth pH is 6-7. The 16S test found that the bacterium has a similarity of 99.9% with Bacillus amyloliquefaciens.

[0052] The applicant of the present invention named it Bacillus amyloliquefaciens H-6. The strain was sent to the China Center for Type Culture Collection (CCTCC) on December 6, 2024, and the classification name was Bacillus amyloliquefaciens H-6. The preservation number was CCTCC NO: M 20242740, and the address was Wuhan University, Wuhan, China.

[0053] Table 1. Screening of probiotics against PRRSV

[0054]

[0055] Embodiment 2:

[0056] Effects of probiotic preparations on PRRSV infection in pigs

[0057] 1. Preparation of probiotic preparations against PRRSV

[0058] First, the frozen Bacillus amyloliquefaciens H-6 was revived, and a proper amount of freeze-dried bacterial powder was dipped into a 1mL pipette tip and inoculated into NB liquid culture medium and cultured at 37℃ for 12 hours. After 12 hours, an appropriate amount of bacterial liquid was streaked on NA solid plate culture medium with an inoculation loop and cultured at 37℃ for 12 hours. Then, a single colony was picked and inoculated into NB liquid culture medium and cultured at 37℃ and 160rpm for 12 hours.

[0059] Subsequently, the H-6 bacterial solution was added to a 30 L small industrial fermenter at a volume ratio of 1:1000 and fermented at a constant temperature of 37°C. The fermentation medium was NB liquid medium with a pH of 6.5-7.0. During the fermentation process, the tank pressure was always maintained at 0.05-0.06MPa. The initial speed of the fermenter was 150rpm. When the dissolved oxygen content in the fermenter was lower than 20%, the speed was gradually increased to 700rpm. After 16 hours of fermentation, the formation of bacterial spores was observed under a microscope and the spore conversion rate was estimated by the five-point counting method. When the conversion rate reached more than 90%, the fermentation was stopped, the tank was released, and the bacterial solution was counted. The concentration of the released bacteria was generally 100-150×10 9 CFU / mL, and then the fermentation liquid was spray-dried to prepare H-6 probiotic fermentation dry powder as the raw material of anti-PRRSV probiotic preparation, which was stored in a 4°C refrigerator for future use.

[0060] 2. Experimental animal facilities and preparation of experimental animals

[0061] One week before the animal experiment, the experimental animal room was thoroughly cleaned and fumigated for disinfection. Two days before the experiment, the experimental piglets were transported to the animal room, and 10 healthy PRRSV-negative piglets aged 40 days were randomly divided into groups and fed in the animal room for 2 days. The feeding status of the piglets was observed to ensure that each piglet could eat and drink water normally.

[0062] 3. Animal Experiment Design

[0063] Ten PRRSV-negative pigs (40-day-old weaned piglets) were randomly divided into two groups, a control group and an experimental group, with 5 pigs in each group. The 5 pigs in the control group were numbered 131, 132, 133, 134, and 135, and the 5 pigs in the experimental group were numbered 41, 42, 43, 44, and 45. All animals were raised in an animal room that complies with GMP animal experiment standards. The control group was fed with piglet feed that did not contain H-6 preparations; the experimental group was fed with piglet feed that contained H-6 preparations and ensured that each pig was fed 5×10 89 CFU live bacteria preparation; after 10 days of feeding, the animals were infected with the highly pathogenic PRRSV strain WH3 by nasal drip, with an infection dose of 10 4 TCID 50 , the experimental groups are shown in Table 2.

[0064] Table 2. Grouping of animal trials of probiotic preparations against PRRSV infection

[0065]

[0066] 4. Effect of Bacillus amyloliquefaciens preparation on clinical pathogenesis of PRRSV-infected pigs

[0067] After PRRSV infection, the body temperature (rectal temperature) and weight of the piglets were measured. At the same time, the clinical characteristics of the piglets after infection were observed and recorded, including appetite, mental state, body surface condition, respiratory symptoms and neurological symptoms, and scored according to the clinical indicators shown in Table 3. Among them, the death case score = total clinical score + 5 points = 20 points. The clinical evaluation criteria are shown in Table 3. The results are shown in Tables 4 and Figure 3 As shown, the clinical symptoms of the experimental group after infection were significantly lower than those of the infected pigs in the control group.

[0068] Table 3. Overall clinical symptom assessment criteria for PRRSV-infected piglets

[0069]

[0070] Table 4. Clinical symptom scores of PRRSV-infected piglets

[0071]

[0072] 5. Effect of Bacillus amyloliquefaciens preparation on mortality of PRRSV-infected pigs

[0073] After PRRSV infection, the health status of the pigs was observed every day, and the clinical condition of the pigs after infection was recorded and clinical evaluation was performed. The results are shown in Table 4: In the control group, 2 pigs died on the 14th day, 1 pig died on the 18th day, and 1 pig died on the 24th day, with a survival rate of 20%; there was no death in the experimental group, and the survival rate was 100%.

[0074] 6. Effect of Bacillus amyloliquefaciens preparation on body temperature of PRRSV-infected pigs

[0075] Starting from the 0th day of PRRSV infection, the body temperature of pigs was tested every other day until the 30th day. The infected pigs in the control group began to die on the 14th day. The dead pigs were immediately dissected and observed for the lesions in their internal organs. All pigs in the experimental group were dissected and observed for the lesions in their internal organs after the end of the experiment.

[0076] The results are shown in Table 5 and Figure 5 As shown, the body temperature of pig No. 131 in the control group reached 41°C on the 4th day of infection, and the body temperature remained above 40°C until death on the 24th day; the body temperatures of pigs No. 132, 133, 134, and 135 all reached above 40°C on the 4th day of infection, and the body temperatures of pigs No. 133 and 134 all reached above 41°C on the 6th day of infection. Pig No. 133 died on the 18th day after infection, and pig No. 134 died on the 14th day of infection; pigs No. 41 and 42 in the experimental group began to have body temperatures above 40°C on the 8th day of infection, among which pigs No. 41 and 42 had a fever of 41°C on the 10th and 12th days of infection, and then fluctuated between 40°C and 39°C, and finally stabilized below 40°C, and no deaths occurred during this period.

[0077] Table 5. Effect of Bacillus amyloliquefaciens preparations on body temperature of PRRSV-infected pigs

[0078]

[0079] 7. Effect of Bacillus amyloliquefaciens preparation on body weight of PRRSV-infected pigs

[0080] Starting from day 0 of PRRSV infection, the weight of the pigs was measured every other day until day 30. The results are shown in Table 6 and Figure 6 As shown, the weight of pigs in the control group increased slowly after infection, and weight stagnation occurred in pigs 131, 132, 133 and 134. Pigs 133 and 135 died on the 24th and 16th days after infection, respectively. Pigs 131 and 134 lost weight and died on the 18th and 14th days after infection, respectively. Pig 132 gained weight slowly but did not die. In the experimental group, except for pig 41 which lost weight on the 16th day after infection, the weight of the other pigs was in a state of slow growth.

[0081] Table 6. Effect of Bacillus amyloliquefaciens preparation on body weight of PRRSV-infected pigs

[0082]

[0083] 8. Determination of serum viral load of PRRSV-infected pigs using Bacillus amyloliquefaciens preparation

[0084] Starting from the 0th day of PRRSV infection, blood was collected from the anterior vena cava of infected pigs every 7 days, and the serum was placed at 37°C for 2 hours and then transferred to 4°C for 1-2 hours. The precipitated serum was collected in a biosafety cabinet and centrifuged at 4000r / min in a 4°C centrifuge for 5-10 minutes. The supernatant was collected, packaged, and stored in a -80°C refrigerator for subsequent serum viral load detection.

[0085] The results are shown in Table 7 and Figure 4 As shown, the serum CT values ​​of the pigs in the control group were all below 20 on the 7th day after infection. Pig 131 died on the 24th day after infection, pig 133 died on the 20th day after infection, and pigs 134 and 135 died on the 14th day after infection. The viral load in the serum of the pigs in the experimental group was high since the 7th day after infection, and then gradually decreased. On the 28th day after infection, the serum CT values ​​of the pigs in the experimental group all reached above 30, and the average serum CT value on the 42nd day after infection was greater than 35. No deaths occurred during the infection.

[0086] Table 7. Effect of Bacillus amyloliquefaciens preparations on viral load in sera of PRRSV-infected pigs

[0087]

[0088] 9. Effect of Bacillus amyloliquefaciens preparation on the viral load of anal swabs from PRRSV-infected pigs

[0089] Starting from the 0th day of PRRSV infection, anal swabs were collected from infected pigs every two days for a total of 30 days, and the PRRSV content in the anal swabs was detected using the real-time fluorescence quantitative PCR method recommended in the National Standard of the People's Republic of China for Blue Ear Detection (GB / T18090-2023).

[0090] The results are shown in Table 8 and Figure 7 As shown, the viral load of anal swabs of pigs in the control group was significantly higher than that in the experimental group. The CT values ​​of the experimental group generally fluctuated around the upper limit of 30, while the CT values ​​of anal swabs of pigs in the control group were generally below 30, and deaths occurred successively in pigs 131, 133, 134, and 135.

[0091] Table 8. Effect of Bacillus amyloliquefaciens preparations on viral load in anal swabs of PRRSV-infected pigs

[0092]

[0093] 10. Effect of Bacillus amyloliquefaciens preparation on viral load of throat swabs from PRRSV-infected pigs

[0094] Starting from the 0th day of PRRSV infection, throat swabs of infected pigs were collected every two days for a total of 30 days, and the PRRSV content in the throat swabs was detected using the real-time fluorescence quantitative PCR method recommended in the National Standard of the People's Republic of China for Blue Ear Detection (GB / T18090-2023).

[0095] The results are shown in Table 9 and Figure 8 As shown, the viral load of throat swabs of pigs in the control group was significantly higher than that of pigs in the experimental group. The CT values ​​of throat swabs of pigs in the control group were all below 30 since the 4th day from the beginning of infection. The CT values ​​of the experimental group began to decrease on the 6th day after infection and then gradually increased without any death. The throat swab of pig No. 42 was negative on the 28th day after infection, and the throat swab of pig No. 43 was negative on the 30th day after infection.

[0096] Table 9. Effect of Bacillus amyloliquefaciens preparations on viral load in throat swabs of PRRSV-infected pigs

[0097]

[0098] 11. Effect of Bacillus amyloliquefaciens preparation on viral load of nasal swabs from PRRSV-infected pigs

[0099] Starting from the 0th day of PRRSV infection, nasal swabs were collected from infected pigs every two days for a total of 30 days, and the PRRSV content in the nasal swabs was detected using the real-time fluorescence quantitative PCR method recommended in the National Standard of the People's Republic of China for Blue Ear Detection (GB / T18090-2023).

[0100] The results are shown in Table 10 and Fig. 9 As shown, the viral load in the nasal swabs of the experimental group pigs after infection was significantly lower than that of the control group pigs, and the nasal swabs of pigs No. 41 and No. 42 in the experimental group were negative since the 28th day after infection.

[0101] Table 10. Effect of Bacillus amyloliquefaciens preparations on viral load in nasal swabs of PRRSV-infected pigs

[0102]

[0103] 12. Effect of Bacillus amyloliquefaciens preparation on lung tissue lesions in pigs infected with PRRSV

[0104] The blank control group was autopsied immediately after death from PRRSV infection; the experimental group was autopsied on the 42nd day after infection, and normal pigs of the same age that were not infected with PRRSV were also autopsied. Fig.10As shown, the lungs of pigs in the PRRSV control group had obvious substantial lesions, while the lungs of piglets in the experimental group fed with H-6 probiotic preparations and the normal negative control group without virus infection showed no obvious abnormalities; there were no obvious lesions in other organs. In summary, feeding Bacillus amyloliquefaciens preparations can significantly reduce the degree of lung tissue and organ damage caused by PRRSV.

Claims

1. An isolated strain of Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens )H-6, the preservation number of the Bacillus amyloliquefaciens is CCTCC NO: M 20242740.

2. The fermentation broth of Bacillus amyloliquefaciens H-6 according to claim 1, wherein the fermentation broth contains live bacteria of Bacillus amyloliquefaciens H-6.

3. A compound, wherein the active ingredient of the compound comprises live bacteria of Bacillus amyloliquefaciens H-6 with a deposit number of CCTCC NO: M 20242740.

4. Use of the Bacillus amyloliquefaciens H-6 according to claim 1, the fermentation broth of the Bacillus amyloliquefaciens H-6 according to claim 2 and / or the composite according to claim 3 in the preparation of a medicament for treating or preventing porcine reproductive and respiratory syndrome virus infection.

5. Use of the Bacillus amyloliquefaciens H-6 according to claim 1, the fermentation broth of the Bacillus amyloliquefaciens H-6 according to claim 2 and / or the composite according to claim 3 in the preparation of a drug for reducing the sensitivity of cells to porcine reproductive and respiratory syndrome virus.

6. The use according to claim 5, wherein the cells are porcine cells.

7. Use of the Bacillus amyloliquefaciens H-6 according to claim 1, the fermentation liquid of the Bacillus amyloliquefaciens H-6 according to claim 2 and / or the compound according to claim 3 in the preparation of a feed additive for pigs.

8. A pig feed, comprising the Bacillus amyloliquefaciens H-6 according to claim 1, the fermentation liquid of the Bacillus amyloliquefaciens H-6 according to claim 2 and / or the compound according to claim 3.

Images