Porcine reproductive and respiratory syndrome virus typing quadruple fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection composition and kit thereof
By designing the quadruple fluorescence quantitative RT-PCR detection composition and its kit for viral typing of pig breeding and respiratory syndrome, the problems of long detection cycle and low sensitivity in the prior art are solved, and rapid and accurate identification of virus types is achieved, and diagnosis and prevention and control of farms are supported.
Patent Information
- Application Number
- CN202510811205.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-17
- Publication Date
- 2025-08-22
AI Technical Summary
When detecting pig breeding and respiratory syndrome viruses, the prior art has problems such as long detection cycle, complex operation and low sensitivity, and it is difficult to quickly and accurately identify four virus types: PRRSV-2, NADC30, HP-PRRSV, and NADC34-like PRRSV.
A quadruple fluorescence quantitative RT-PCR detection composition and its kit are designed, including specific primers and probes, which can simultaneously detect four viruses, PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV, combined with fluorescence quantitative results analysis, simplifying the operation process and improving detection speed and sensitivity.
It realizes rapid and accurate identification of PRRSV virus types in pig herds, greatly shortens the detection cycle, simple operation, high sensitivity, and provides effective monitoring tools to support the diagnosis and prevention and control of the farm.
Smart Images

Figure CN120519635A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of animal virus detection in the veterinary field, and in particular to a porcine reproductive and respiratory syndrome virus typing quadruple fluorescent quantitative RT-PCR detection composition and a kit thereof. Background Art
[0002] Porcine reproductive and respiratory syndrome (PRRS) is an infectious disease of pigs caused by the porcine reproductive and respiratory syndrome virus (PRRSV). It is characterized by reproductive failure in sows, including miscarriage, stillbirth, and mummification, and respiratory problems in piglets and finishing pigs, causing significant economic losses to the domestic swine industry. Clinically, continuous monitoring for the presence of PRRSV on-site requires sequencing and typing of diseased specimens, which is time-consuming and requires high virus load and storage conditions.
[0003] Therefore, a quadruple real-time fluorescence quantitative RT-PCR detection method and kit is urgently needed for differential diagnosis of PRRSV-2, NADC30-like, HP-PRRSV, and NADC34-like PRRSV. This method can be used to accurately and quickly identify virus types in clinical practice through analysis of fluorescence quantitative results, greatly shortening the detection cycle. This method has the advantages of simple operation, high sensitivity, and rapid detection, providing a new tool for monitoring the spread of PRRSV in pig herds. Summary of the Invention
[0004] The purpose of the present invention is to provide a quadruple fluorescent quantitative RT-PCR detection composition and kit for porcine reproductive and respiratory syndrome virus typing, in response to the needs of clinical disease diagnosis and detection. The detection composition and kit are capable of simultaneously detecting four viruses: PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV. Thus, in clinical practice, the virus type can be accurately and quickly identified by analyzing the fluorescent quantitative results, greatly shortening the detection cycle. The composition has the advantages of simple operation, high sensitivity, and rapid detection, providing a new tool for monitoring the spread of PRRSV in pig herds, thereby facilitating the diagnosis and prevention of porcine reproductive and respiratory syndrome on farms.
[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows: The present invention provides a quadruple fluorescent quantitative RT-PCR detection composition for porcine reproductive and respiratory syndrome virus typing. The quadruple fluorescent quantitative RT-PCR detection composition simultaneously detects four viruses: PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV. The composition includes primer pairs and probe sequences as follows: a. Primers and probes for detecting PRRSV-2-N gene: Upstream primer PRRSV-2-F: GCACTGATTGACAYTGTGCC, as shown in SEQ ID NO. 1; Downstream primer PRRSV-2-R: CGCATGGTTCTCGCCAAT, as shown in SEQ ID NO. 2; Probe PRRSV-2-P: AGTCACCTATTCAATTAGGGCGACCG; as shown in SEQ ID NO. 3; b. Primers and probes for detecting the NADC30-Like-NSP2 gene: Upstream primer NADC30-like-F: AGCGTRYTGGAYACCTCCTTTG, as shown in SEQ ID NO. 4; Downstream primer NADC30-like-R: CTGATYTTYCTGCGYGGRG, as shown in SEQ ID NO. 5; Probe NADC30-like-P: TTCTCTGGRAGGCTCCTGACAGACYC, as shown in SEQ ID NO. 6; c. Primers and probes for detecting HP-PRRSV-NSP2 gene: Upstream primer HP-PRRSV-F: TGGGTCGGCRCCAKTTCCT, as shown in SEQ ID NO. 7; Downstream primer HP-PRRSV-R: YATATTCCGTYTGTGAGGACRC, as shown in SEQ ID NO.8; Probe HP-PRRSV-P: TCAGCGTTGTTGTYACAGTYCTRCGC, as shown in SEQ ID NO. 9; d. Primers and probes for detecting the NADC34-Like-NSP2 gene: Upstream primer NADC34-like-F: AGTYCACCTAACYGAGTTRCC, as shown in SEQ ID NO. 10; Upstream primer 1-4-4-F: AGTTCACYYAACCAAGCTGCC, as shown in SEQ ID NO. 11; Downstream primer NADC34-like-R: AGGGRYGGGCTTGCAATCT, as shown in SEQ ID NO. 12; Probe NADC34-like-P: CGGCCYCATCGCCRCCTCT, as shown in SEQ ID NO.13.
[0006] Furthermore, in the detection composition, the 5' end label of the probe is selected from FAM, HEX, ROX and CY5; the 5' end label of the probe is selected from BHQ1, BHQ2 and BHQ3.
[0007] Furthermore, in the detection composition, Probe PRRSV-2-P: FAM-AGTCACCTATTCAATTAGGGCGACCG-BHQ1; Probe NADC30-like-P: HEX-TTCTCTGGRAGGCTCCTGACAGACYC-BHQ1; Probe HP-PRRSV-P: ROX-TCAGCGTTGTTGTYACAGTYCTRCGC-BHQ2; Probe NADC34-like-P: CY5-CGGCCYCATCGCCRCCTCT-BHQ3.
[0008] The present invention also provides a porcine reproductive and respiratory syndrome virus typing quadruple fluorescence quantitative RT-PCR detection kit, which comprises the above-mentioned detection composition.
[0009] Furthermore, the kit consists of reagent A, reagent B, reagent C, reagent D and reagent E; wherein, Reagent A is the fluorescent quantitative RT-PCR reaction buffer, which is 5 × One Step U + Mix; Reagent B is a fluorescent quantitative reaction enzyme, which is One Step U + Enzyme Mix; Reagent C is a primer-probe mixture for fluorescent quantitative PCR reaction, comprising the detection composition according to claim 1 and sterile enzyme-free water; Reagent D is the positive control, which is the standard plasmid control PRRSV-POS; Reagent E is a negative control, which is Nuclease-free H2O.
[0010] Furthermore, the concentration of the standard plasmid control substance PRRSV-POS is 3×10 10 copies / μL.
[0011] The present invention also provides a quadruple fluorescence quantitative PCR detection method for porcine reproductive and respiratory syndrome virus typing based on non-diagnostic purposes, comprising the following steps: (1) Extracting RNA template from the sample to be tested; (2) Using the detection composition of claim 1 or the kit of claim 4 to establish a quadruple fluorescence quantitative PCR reaction system; performing fluorescence quantitative PCR detection; (3) Analysis of the results of the samples to be tested.
[0012] Furthermore, the quadruple fluorescence quantitative PCR reaction system is 30 μL, including 6 μL of reagent A, 1.5 μL of reagent B, 17.5 μL of reagent C and 5 μL of template; The template is any one of the RNA of the sample to be tested, the positive control standard and the negative control standard; In the reaction system, the final reaction concentrations of the nine primers were all 0.2 μmol / L, and the final reaction concentrations of the four probes were all 0.3 μmol / L (i.e., the final reaction concentrations of the nine primers for PRRSV-2-N, NADC30-like-NSP2, HP-PRRSV-NSP2, and NADC34-like-NSP2 genes were all 0.2 μmol / L, and the final reaction concentrations of the four probes were all 0.3 μmol / L).
[0013] Furthermore, the reaction conditions of the reaction system are as follows: reverse transcription at 55°C for 15 min, 1 cycle; pre-denaturation at 95°C for 30 s, 1 cycle; denaturation at 95°C for 10 s, annealing at 56°C for 30 s, 40 cycles.
[0014] Furthermore, the result is determined as follows: When a typical S-shaped amplification curve appears in any fluorescence channel of the sample to be tested and the Ct value is <38, the viral nucleic acid corresponding to the fluorescence channel is determined to be positive; Alternatively, when there is no typical S-shaped curve or Ct value in each fluorescence channel of the sample to be tested, it is determined that the viral nucleic acid corresponding to the fluorescence channel is negative; Alternatively, when a typical S-shaped amplification curve appears in any fluorescent channel of the sample to be tested and the Ct value is ≥38, the viral nucleic acid test result corresponding to that fluorescent channel is considered suspicious and retesting is recommended: If the re-amplification result still shows a typical S-shaped amplification curve, the viral nucleic acid test result corresponding to the fluorescent channel is determined to be positive; Alternatively, if there is no obvious amplification curve in the re-amplification result, the viral nucleic acid corresponding to the fluorescent channel is determined to be negative.
[0015] Beneficial effects of the present invention: 1. The primers and probes of the fluorescent quantitative PCR detection composition for detecting PRRSV-2, NADC30-like, HP-PRRSV, and NADC34-like PRRSV of the present invention have good compatibility; the established quadruple fluorescent quantitative PCR detection method can accurately and quickly identify the virus type by analyzing the fluorescent quantitative results, greatly shortening the detection cycle. It has the advantages of simple operation, high sensitivity, and rapid detection, providing a new tool for monitoring the spread of PRRSV in pig herds.
[0016] 2. This invention has developed a quadruple fluorescent quantitative PCR kit for the identification and detection of PRRSV-2, NADC30-like, HP-PRRSV, and NADC34-like PRRSV. This kit is convenient and easy to use. The kit consists of five reagents. In practice, simply mix 6 μL of reagent A, 1.5 μL of reagent B, 17.5 μL of reagent C, and 5 μL of template (sample nucleic acid, positive control, or negative control) for subsequent fluorescent quantitative PCR testing. Results can be interpreted within 1 hour and 30 minutes.
[0017] 3. The quadruple fluorescent quantitative PCR kit for typing porcine reproductive and respiratory syndrome virus (PRRSV) of PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV established by the present invention has extremely high sensitivity. A minimum of 3 copies / reaction can be detected for PRRSV-2, a minimum of 3 copies / reaction can be detected for NADC30-like PRRSV, a minimum of 3 copies / reaction can be detected for HP-PRRSV, and a minimum of 3 copies / reaction can be detected for NADC34-like PRRSV.
[0018] 4. The present invention combines the probe-based fluorescent quantitative detection method widely used in current molecular diagnosis to establish a quadruple fluorescent quantitative detection kit for PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV. The kit has good specificity, sensitivity, and repeatability, and can effectively distinguish the nucleic acids of PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV. It provides excellent technical support for monitoring the spread of PRRSV in pig herds and has good social application prospects and value. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 This is a schematic diagram of the sensitivity test and the corresponding standard curve of the porcine reproductive and respiratory syndrome virus typing quadruple fluorescent quantitative RT-PCR detection kit. Among them, A is a schematic diagram of the PRRSV-2 detection target sensitivity and standard curve, B is a schematic diagram of the sensitivity and standard curve of NADC30-like detection target. C is a schematic diagram of the HP-like detection target sensitivity and standard curve, D is a schematic diagram of the sensitivity and standard curve of NADC34-like detection target. In the figure, PRRSV positive plasmid 1-7: 3×10 6 -3×10 0 copies / μL; 8: negative control; Figure 2 This is a schematic diagram of the specific amplification curve of the quadruple fluorescence quantitative PCR detection method for porcine reproductive and respiratory syndrome virus typing. In the figure, 1: C-PRRSV positive nucleic acid; 2: HP-like positive nucleic acid; 3: NADC30-like nucleic acid; 4-13: PEDV, TGEV, PDCoV, PoRV, PPV, PRV, CSFV, PCV, JEV and Nuclease-free H2O. DETAILED DESCRIPTION
[0020] The present invention is further described in detail below with reference to specific embodiments so that those skilled in the art can understand.
[0021] Example 1 Screening of a Quadruple Fluorescent Quantitative RT-PCR Detection Composition (Primer Probe Combination) for Detecting PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV A total of 941 PRRSV genome sequences were retrieved from the NCBI GenBank database. Multiple sequence alignment was performed using MAFFT. The sequences of different strains were classified according to the different degrees of deletion of the NSP2 gene in NADC30-like PRRSV, NADC34-like PRRSV, and HP-PRRSV compared with the classical PRRSV strains: That is: NADC30-like PRRSV deleted 131aa at aa323-aa433, aa483, and aa504-aa522, NADC34-like PRRSV deleted 100aa at aa328-aa427, and HP-PRRSV deleted 30aa at aa481 and aa533-aa561. A total of 941 PRRSV-2 NSP2 gene sequences were obtained by classification, including 227 NADC30-like PRRSV NSP2 gene sequences, 337 HP-PRRSV NSP2 gene sequences, and 132 NADC34-like PRRSV NSP2 gene sequences. Sequence alignment results identified highly specific and conserved regions, including an 85-bp sequence from the genome of the classical PRRSV strain CH-1a; a 212-bp sequence from the genome of the NADC30-like PRRSV epidemic strain Chsx1401 in China; a 101-bp sequence from the JXA1 gene of the HP-PRRSV epidemic strain in China; a 169-bp sequence from the genome of the NADC34-like PRRSV epidemic strain LNWK96; and a 169-bp sequence from the genome of the RFLP 1-4-4 lineage 1C variant of the NADC34-like PRRSV epidemic strain. Furthermore, factors such as primer mismatches and Tm values were considered. The designed primers and probes were analyzed using Blast software in the NCBI database. The primer pairs and probe sequences were required to cover all known PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV sequences in the database and to have no significant matches with other sequences.
[0022] The sequences of the primers and probes obtained in this example are specifically shown in Table 1: In the table above, the positions correspond to GenBank accession numbers for the classical PRRSV2 CH-1a strain (AY150312), the highly pathogenic PRRSV2 JXA1 strain (EF112445), the NADC30-like PRRSV2 Chsx1401 strain (KP861625), the NADC34-like PRRSV2 LNWK96 strain (MG860516), and the RFLP 1-4-4 lineage 1C variant strain (MW887655). The 5' and 3' ends of the probe sequences in the above table are connected to different fluorescent groups, which are specifically: The fluorescent groups at the 5' and 3' ends of the probe PRRSV2-P are FAM and BHQ1, respectively, that is: FAM-AGTCACCTATTCAATTAGGGCGACCG-BHQ1 The fluorescent groups at the 5′ and 3′ ends of the probe HP-PRRSV2-P are ROX and BHQ2, respectively, that is: ROX-TCAGCGTTGTTGTYACAGTYCTRCGC-BHQ1; The fluorescent groups at the 5' and 3' ends of the probe NADC30-like-PRRSV2-P are HEX and BHQ1, respectively, that is: HEX-TTCTCTGGRAGGCTCCTGACAGACYC-BHQ1; The fluorescent groups at the 5' and 3' ends of the probe NADC34-like-PRRSV2-P are CY5 and BHQ3, respectively, that is: CY5-CGGCCYCATCGCCRCCTCT-BHQ3; In the above nucleotide sequence, R is A / G; Y is C / T; and K is G / T.
[0023] Example 2 Selection of positive and negative controls in the quadruple fluorescence quantitative RT-PCR detection kit for porcine reproductive and respiratory syndrome virus typing Primer and probe sequences for PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV were constructed and incorporated into the pUC57 plasmid vector to generate the plasmid standard PRRSV-POS (SEQ ID NO: 13). The plasmid standard was maintained in our laboratory, and the concentration of the standard plasmid was determined using a Qubit 4 fluorometer. The gene copy number (Y) was calculated using the following formula: Y (copies / μL) = [concentration of plasmid DNA (ng / μL) × 10 -9 / (plasmid DNA length bp × 660)] × 6.02 × 10 23 .
[0024] The gene copy number of the PRRSV-POS standard plasmid was determined to be 3×10 10 copies / μL and diluted with Nuclease-free H2O to a plasmid concentration of 3×10 4 copies / μL as a positive control; Nuclease-free H2O was used as a negative control.
[0025] Example 3 Establishment of a quadruple fluorescence quantitative RT-PCR detection kit for SARS-CoV typing and its quadruple fluorescence quantitative PCR detection method 1. Composition of the Quadruple Fluorescence Quantitative PCR Detection Kit The quadruple fluorescence quantitative PCR detection kit consists of reagents A, B, C, D, and E, among which: Reagent A is the fluorescent quantitative PCR reaction buffer, which is 5×One Step U + MIX; Reagent B is a fluorescent quantitative reaction enzyme, which is One Step U + Enzyme MIX; Reagent C is a primer-probe mixture for fluorescent quantitative PCR reaction, which contains four sets of primers, probes and nuclease-free H2O for PRRSV-2-N, NADC30-Like-NSP2, HP-PRRSV-NSP2, and NADC34-Like-NSP2 genes; Reagent D is the positive control, which is the standard plasmid control PRRSV-POS; Reagent E is a negative control, which is Nuclease-free H2O.
[0026] 2. Establishment of standard curve After exploring the concentrations of primers and probes, the reaction system for quadruple fluorescence quantitative PCR was determined to be 30 μL, including 6 μL of reagent A, 1.5 μL of reagent B, 17.5 μL of reagent C, and 5 μL of reagent D, with the remainder being Nuclease-free H2O. In the reaction system, the final reaction concentrations of the eight primers for PRRSV-2 M, NADC30-like-NSP2, HP-PRRSV-NSP2, and NADC34-like-NSP2 genes were all 0.2 μmol / L, and the final reaction concentrations of the four probes were all 0.3 μmol / L.
[0027] Medtl System was used for fluorescence quantitative PCR detection, and the optimal reaction program was: reverse transcription at 55°C for 15 min, 1 cycle; pre-denaturation at 95°C for 30 s, 1 cycle; denaturation at 95°C for 10 s, annealing at 56°C for 30 s, 40 cycles.
[0028] like Figure 1 As shown, the copy number of the standard plasmid PRRSV-POS is between 3 and 3×10 6 In the range of copies / μL, the established quadruple fluorescence quantitative PCR detection method can obtain a good amplification kinetic curve, among which, The linear equation of the PRRSV-2 standard curve is: y = -3.403x + 32.95, correlation coefficient (R 2 ) = 0.9973, amplification efficiency (E%) = 96.7%; The linear equation of the NADC30-like-PRRSV standard curve is: y = -3.301x + 32.85, correlation coefficient (R 2 ) = 0.9977, amplification efficiency (E%) = 100%; The linear equation of the HP-PRRSV standard curve is: y = -3.280x + 32.09, correlation coefficient (R 2 ) = 0.9974, amplification efficiency (E%) = 101.8%; The linear equation of the NADC34-like-PRRSV standard curve is: y = -3.414x + 33.02, correlation coefficient (R 2 ) = 0.9984, amplification efficiency (E%) = 96.29 %.
[0029] 3. Detection Method a. Sample RNA extraction: Extract sample nucleic acid according to the instructions of the commercial kit. b. System preparation: Set up the test sample, negative control and positive control, and the reaction system is prepared as shown in Table 2: Table 2 c. Reaction program settings: Table 3 d. Fluorescence channel settings ①FAM channel is used for PRRSV-2 strain detection; ②HEX channel is used for NADC30-like-PRRSV strain detection; ③ROX channel is used for HP-like-PRRSV strain detection; ④Cy5 channel is used for detection of NADC34-like-PRRSV strains.
[0030] IV. Judgment criteria 1. Test conditions: The test is considered valid if each channel of the positive control shows a typical S-shaped amplification curve and a Ct value <35, and each channel of the negative control shows no typical S-shaped amplification curve or no Ct value. Otherwise, the test is invalid and needs to be retested. (1) When a typical S-shaped amplification curve appears in any fluorescent channel of the sample to be tested and the Ct value is <38, the viral nucleic acid corresponding to the fluorescent channel is determined to be positive; For example, if a typical S-shaped amplification curve appears in a single FAM channel and the Ct value is less than 38, it is determined to be positive for C-PRRSV strain (classic strain) nucleic acid; When a typical S-shaped amplification curve appeared in the FAM and HEX channels and the Ct value was <38, it was determined to be positive for the nucleic acid of the NADC30-like-PRRSV strain; When a typical S-shaped amplification curve appeared in the FAM and ROX channels and the Ct value was <38, it was determined to be positive for HP-like-PRRSV strain nucleic acid; When a typical S-shaped amplification curve appeared in the FAM and Cy5 channels and the Ct value was <38, it was determined to be positive for the nucleic acid of the NADC34-like-PRRSV strain; (2) When there is no typical S-shaped curve or Ct value in each fluorescence channel of the sample to be tested, it is judged that the viral nucleic acid corresponding to the fluorescence channel is negative; (3) When a typical S-shaped amplification curve appears in any fluorescent channel of the sample to be tested and the Ct value is ≥38, the viral nucleic acid test result corresponding to the fluorescent channel is judged to be suspicious and retesting is recommended; If the re-amplification result still shows a typical S-shaped amplification curve, the viral nucleic acid test result corresponding to the fluorescent channel is determined to be positive; If there is no obvious amplification curve in the re-amplification result, the viral nucleic acid corresponding to the fluorescent channel is determined to be negative.
[0031] Specificity and reproducibility verification of the above detection kits 1. Specificity Experiment DNA / RNA of porcine parvovirus (PPV), pseudorabies virus (PRV), classical swine fever virus (CSFV), porcine circovirus (PCV), Japanese encephalitis virus (JEV), porcine epidemic diarrhea (PEDV), transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus (PDCoV) and porcine rotavirus group A (PoRV A) were used as templates. At the same time, nucleic acids of CA-PRRSV, NADC30-Like-PRRSV and HP-PRRSV were set as positive controls, and Nuclease-free H2O was used as negative control. The established quadruple fluorescence quantitative PCR detection method was used for detection, as shown in FIG. Figure 2 As shown in the figure, the positive control group showed a specific amplification curve, while the samples containing other pathogenic DNA and RNA were all negative, indicating that the detection method established in this study has good specificity.
[0032] 2. Repeatability Experiment The above plasmid standard (PRRSV-POS) was diluted 10-fold to select a concentration of 3×10 5 copies / μL, 3×10 4 copies / μL, 3×10 3The intra-batch and inter-batch repeatability tests were performed using the PRRSV-POS standard plasmid at 200 copies / μL as a template. The intra-batch repeatability results are shown in Table 4, with an intra-group coefficient of variation of 0.03% to 1.48%. The inter-batch repeatability results are shown in Table 5, with an inter-group coefficient of variation of 0.15% to 1.31%, indicating that the established quadruple fluorescence quantitative PCR detection method has good stability and repeatability.
[0033] Table 4 Intra-group repeatability test Table 5 Repeatability test between groups Example 4 Clinical Application of a Quadruple Fluorescence Quantitative PCR Detection Kit for Detecting PRRSV-2, NADC30-Like-PRRSV, HP-PRRSV, and NADC34-Like-PRRSV The above detection kit was used to detect the 20 collected samples suspected of blue ear disease in pigs, and the samples were sequenced and the results were recorded.
[0034] The results showed that the method established by the invention was completely consistent with the results of sample sequencing. It successfully detected 11 NADC30-like samples, 2 NADC34-like samples, and 7 classic PRRSV samples. This method is accurate and reliable.
[0035] Table 6 Statistical results of real-time fluorescence quantitative PCR detection of clinical samples The present invention designs four pairs of fluorescent quantitative PCR primers and probes, provides a kit and a detection method for rapidly distinguishing PRRSV-2, NADC30-Like-PRRSV, HP-PRRSV, and NADC34-Like-PRRSV. The kit has the advantages of high sensitivity, strong specificity, and good repeatability, and provides an effective means for the detection of clinical samples.
[0036] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A quadruple fluorescent quantitative RT-PCR detection composition for porcine reproductive and respiratory syndrome virus typing, characterized by: The quadruple fluorescent quantitative RT-PCR detection composition simultaneously detects four viruses: PRRSV-2, NADC30-like PRRSV, HP-PRRSV, and NADC34-like PRRSV. It includes primer pairs and probe sequences as follows: a. Primers and probes for detecting PRRSV-2-N gene: Upstream primer PRRSV-2-F: GCACTGATTGACAYTGTGCC, Downstream primer PRRSV-2-R: CGCATGGTTCTCGCCAAT, Probe PRRSV-2-P: AGTCACCTATTCAATTAGGGCGACCG; b. Primers and probes for detecting the NADC30-Like-NSP2 gene: Upstream primer NADC30-like-F: AGCGTRYTGGAYACCTCCTTTG, Downstream primer NADC30-like-R: CTGATYTTYCTGCGYGGRG, Probe NADC30-like-P: TTCTCTGGRAGGCTCCTGACAGACYC; c. Primers and probes for detecting HP-PRRSV-NSP2 gene: Upstream primer HP-PRRSV-F: TGGGTCGGCRCCAKTTCCT, Downstream primer HP-PRRSV-R: YATATTCCGTYTGTGAGGACRC, Probe HP-PRRSV-P: TCAGCGTTGTTGTYACAGTYCTRCGC; d. Primers and probes for detecting the NADC34-Like-NSP2 gene: Upstream primer NADC34-like-F: AGTYCACCTAACYGAGTTRCC, Upstream primer 1-4-4-F: AGTTCACYYAACCAAGCTGCC, Downstream primer NADC34-like-R: AGGGRYGGGCTTGCAATCT, Probe NADC34-like-P: CGGCCYCATCGCCRCCTCT.
2. The detection composition according to claim 1, characterized in that: In the detection composition, the 5' end label of the probe is selected from FAM, HEX, ROX and CY5; the 5' end label of the probe is selected from BHQ1, BHQ2 and BHQ3.
3. The detection composition according to claim 1, characterized in that: In the detection composition, Probe PRRSV-2-P: FAM-AGTCACCTATTCAATTAGGGCGACCG-BHQ1; Probe NADC30-like-P: HEX-TTCTCTGGRAGGCTCCTGACAGACYC-BHQ1; Probe HP-PRRSV-P: ROX-TCAGCGTTGTTGTYACAGTYCTRCGC-BHQ2; Probe NADC34-like-P: CY5-CGGCCYCATCGCCRCCTCT-BHQ3.
4. A quadruple fluorescent quantitative RT-PCR detection kit for porcine reproductive and respiratory syndrome virus typing, characterized by: The kit comprises the detection composition according to claim 1.
5. The detection kit according to claim 4, characterized in that The kit consists of reagent A, reagent B, reagent C, reagent D and reagent E; wherein, Reagent A is fluorescent quantitative RT-PCR reaction buffer; Reagent B is a fluorescent quantitative reaction enzyme; Reagent C is a primer-probe mixture for fluorescent quantitative PCR reaction, comprising the detection composition according to claim 1 and sterile enzyme-free water; Reagent D is the positive control, which is the standard plasmid control PRRSV-POS; Reagent E is a negative control, which is Nuclease-free H2O.
6. The quadruple fluorescence quantitative PCR detection kit according to claim 5, characterized in that: The concentration of the standard plasmid reference substance PRRSV-POS is 3×10 10 copies / μL.
7. A quadruple fluorescence quantitative PCR detection method for porcine reproductive and respiratory syndrome virus typing based on non-diagnostic purposes, characterized in that: The following steps are involved: (1) Extracting RNA template from the sample to be tested; (2) Using the detection composition of claim 1 or the kit of claim 4 to establish a quadruple fluorescence quantitative PCR reaction system; performing fluorescence quantitative PCR detection; (3) Analysis of the results of the samples to be tested.
8. The quadruple fluorescence quantitative PCR detection method according to claim 7, characterized in that: The quadruple fluorescence quantitative PCR reaction system is 30 μL, including 6 μL of reagent A, 1.5 μL of reagent B, 17.5 μL of reagent C and 5 μL of template; The template is any one of the RNA of the sample to be tested, the positive control standard and the negative control standard; In the reaction system, the final reaction concentrations of the nine primers were all 0.2 μmol / L, and the final reaction concentrations of the four probes were all 0.3 μmol / L.
9. The quadruple fluorescence quantitative PCR detection method according to claim 7, characterized in that: The reaction conditions of the reaction system are as follows: reverse transcription at 55° C. for 15 min, 1 cycle; pre-denaturation at 95° C. for 30 s, 1 cycle; denaturation at 95° C. for 10 s, annealing at 56° C. for 30 s, 40 cycles.
10. The quadruple fluorescence quantitative PCR detection method according to claim 7, characterized in that: The results are judged as follows: When a typical S-shaped amplification curve appears in any fluorescence channel of the sample to be tested and the Ct value is <38, the viral nucleic acid corresponding to the fluorescence channel is determined to be positive; Alternatively, when there is no typical S-shaped curve or Ct value in each fluorescence channel of the sample to be tested, it is determined that the viral nucleic acid corresponding to the fluorescence channel is negative; Alternatively, when a typical S-shaped amplification curve appears in any fluorescent channel of the sample to be tested and the Ct value is ≥38, the viral nucleic acid test result corresponding to that fluorescent channel is considered suspicious and retesting is recommended: If the re-amplification result still shows a typical S-shaped amplification curve, the viral nucleic acid test result corresponding to the fluorescent channel is determined to be positive; Alternatively, if there is no obvious amplification curve in the re-amplification result, the viral nucleic acid corresponding to the fluorescent channel is determined to be negative.