Construction method of tissue-engineered skin organoids and uvb-induced skin organoid aging model

By constructing tissue-engineered skin organoids through anatomical inoculation and gas-liquid interface culture, the problem of disordered anatomical layers in existing skin organoid models has been solved, realizing a UVB-induced skin organoid aging model for use in simulating skin diseases and drug screening research.

CN119899791BActive Publication Date: 2025-11-11GUANGDONG HOSPITAL OF TRADITIONAL CHINESE MEDICINE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510087204.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-20
Publication Date
2025-11-11
Estimated Expiration
2045-01-20

AI Technical Summary

Technical Problem

Existing skin organoid models suffer from anatomical layer disorder during in vitro culture, lack skin appendage structures, and lack UVB-induced aging models.

Method used

Using an anatomical inoculation method, primary skin organoids with transparent sac-like head structures induced and differentiated from iPSCs were inoculated onto decellularized porcine skin sections with the epidermis facing upwards and the dermis facing downwards. Tissue-engineered skin organoids were constructed using an air-liquid interface culture system, and senescence of the skin organoids was induced by UVB irradiation.

Benefits of technology

We constructed tissue-engineered skin organoids with structures close to the physiological anatomy of human skin, which can simulate the physiological structure and function of skin tissue. These organoids can be used for disease model construction, drug screening, toxicity testing, skin damage and repair regeneration, and provide a UVB-induced skin organoid aging model.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119899791B_ABST
    Figure CN119899791B_ABST
Patent Text Reader

Abstract

This invention discloses a method for constructing tissue-engineered skin organoids. After dissecting primary skin organoids induced and differentiated from iPSCs, transparent sac-like structures are seeded onto a decellularized porcine skin scaffold with the epidermis facing upwards and the dermis facing downwards. The tissue-engineered skin organoids are then cultured using an air-liquid interface culture system to construct a structure closely resembling the physiological and anatomical structure of human skin. The tissue-engineered skin organoids provided by this invention can be applied to disease model construction, drug screening and toxicity testing, skin injury and repair regeneration, and skin development. UVB irradiation of the tissue-engineered skin organoids can induce aging in human skin organoids, thus constructing a UVB-induced skin organoid aging model.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a method for constructing tissue-engineered skin organoids and a UVB-induced skin organoid aging model. Background Technology

[0002] Organoids are products that are obtained by culturing embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), or stem and progenitor cells derived from tissues in vitro using three-dimensional culture technology.

[0003] Skin organoids are a novel type of organoid model that can be derived from induced pluripotent stem cells (iPSCs) or totipotent stem cells. They typically possess a transparent, sac-like head and an opaque tail, and can partially mimic the structure and function of real skin tissue, as well as in vivo communication. They can, to some extent, replace animal models and are now widely used in research fields such as skin development, disease models, and drug screening. Compared to traditional 2D cell models, organoid models exhibit more stable genetic and phenotypic characteristics and a wider variety of cell types during in vitro culture.

[0004] Existing in vitro skin research models primarily rely on in vitro cultured 2D skin cells and 3D self-assembled skin cell models. These models exhibit significant differences in interlayer interactions compared to real physiological states and lack structures such as skin appendages, resulting in a considerable discrepancy with real skin. Using human iPSCs, cystic skin organoids similar to the skin of an 18-week-old human fetus can be constructed. These organoids consist of a layered epidermis, a fatty dermis, pigmented hair follicles with sebaceous glands, sensory neurons, Schwann cells, and touch-related Merkel cells. These skin organoids can form hair-bearing skin organoids on the backs of nude mice. However, the main limitation of existing skin organoids is the anatomical disorganization caused by their spherical growth. The outermost layer of normal skin is the stratum corneum formed by keratinocytes, which acts as the skin's physical barrier and sheds when cells age and die. In contrast, skin organoids form spherical vesicles, with hair shafts growing inwards towards a fluid-filled core, accompanied by hair follicles protruding outwards from the vesicle surface. During skin organoid culture, the cystic structure restricts shedding and accumulates keratinized tissue in the core. Therefore, in the later stages of culture (>150 days), floating dead keratinocytes can be observed growing onto the surface of the organoid. This inward growth characteristic makes the tissue structure of skin organoids anatomically and histologically very different from that of physiological skin.

[0005] There is currently no UVB-induced skin organoid aging model. Summary of the Invention

[0006] The first objective of this invention is to provide a tissue-engineered skin organoid and a method for constructing the same, in order to solve at least one of the aforementioned technical problems.

[0007] A second objective of this invention is to provide a UVB-induced skin organoid aging model to address at least one of the aforementioned technical problems.

[0008] According to one aspect of the present invention, a method for constructing tissue-engineered skin organoids is provided, comprising the following steps:

[0009] (1) iPSCs were induced to differentiate and cultured for 85-100 days to construct primary skin organoids;

[0010] (2) Section the decellularized pig skin, and the section thickness is 90-110 μm to obtain decellularized pig skin sections;

[0011] (3) After dissecting the primary skin organoids, the transparent sac-like structures were inoculated onto decellularized porcine skin sections with the inner side facing up and the outer side facing down to obtain the complex.

[0012] (4) The complex is cultured at the gas-liquid interface for 10 to 21 days to obtain tissue-engineered skin organoids.

[0013] This invention employs a "dissection inoculation" method, dissecting a primary skin organoid with a transparent sac-like head structure that has the dermis facing outward and the epidermis facing inward, obtained by iPSCs-induced differentiation. The tail, composed of a dense, opaque cell mass, is removed, and the transparent sac-like structure is opened and inoculated onto a decellularized porcine skin scaffold with the epidermis facing upward and the dermis facing downward. The scaffold is then cultured using an air-liquid interface culture system to construct a tissue-engineered skin organoid.

[0014] The tissue-engineered skin organoids provided by this invention include skin appendages such as the epidermis, basal layer, dermis (fibroblasts), hair follicles, pigment cells, sebaceous glands, sensory neurons, and Merkel cells, exhibiting a top-to-bottom anatomical structure. Its structure is close to the physiological anatomical structure of human skin, and the epidermis is even closer to the physiological state of the human body.

[0015] The tissue-engineered skin organoids provided by this invention can be applied to disease model construction. These organoids highly simulate the physiological structure and function of skin tissue, such as the epidermis, dermis, and appendages (e.g., hair follicles, sweat glands), providing a more realistic model for studying the pathological mechanisms of skin diseases. On one hand, through further induced differentiation, organoids with specific skin disease characteristics, such as those for skin cancer and psoriasis, can be constructed based on the tissue-engineered skin organoids. These models contribute to a deeper understanding of the disease's development and progression. On the other hand, research on tissue-engineered skin organoids allows for the exploration of interactions between different cell types and molecular signaling pathways in disease development, providing new targets and approaches for disease diagnosis and treatment.

[0016] The tissue-engineered skin organoids provided by this invention can be applied to drug screening and toxicity testing. These organoids can be used for high-throughput drug screening; by detecting the effects of drugs on the tissue-engineered skin organoids, candidate drugs with potential therapeutic value can be rapidly screened. Toxicity testing using tissue-engineered skin organoids can assess the potential toxicity of drugs to the skin, including irritation and allergic reactions, providing important data for drug safety evaluation. Furthermore, by combining a patient's genetic information and disease characteristics, personalized tissue-engineered skin organoid models can be constructed to assess the patient's response to specific drugs and guide the development of personalized treatment plans.

[0017] The tissue-engineered skin organoids provided by this invention can be applied to skin injury and regeneration. Using these organoids as repair materials, through cell culture, expansion, and differentiation, bioactive and functional skin substitutes can be prepared for the repair of skin defects. Furthermore, the various cell types and growth factors contained in the tissue-engineered skin organoids can promote skin tissue regeneration and repair, accelerating the wound healing process. Therefore, the tissue-engineered skin organoids provided by this invention can be applied to the treatment of skin diseases such as burns and chronic skin ulcers.

[0018] In some implementations, the method for constructing primary skin organoids by inducing differentiation using iPSCs can be found in the method described in the reference "Lee J, van der Valk WH, Serdy SA, Deakin C, Kim J, Le AP, Koehler KR. Generation and characterization of hair-bearing skin organoids from human pluripotent stem cells. Nat Protoc. 2022 May; 17(5):1266-1305."

[0019] In some implementations, the method for constructing primary skin organoids by inducing differentiation using iPSCs may include the following steps:

[0020] S1. iPSCs were suspended in E8 medium containing 20 μM Y27632, and then seeded onto a cell culture device. After centrifugation at 110g for 6 min, the cells were incubated at 37℃ in a 5% CO2 incubator for 24 h. Then, E8 medium was added and cultured for another 24 h to obtain cell aggregates.

[0021] S2, Day 0 of induced differentiation: Cell aggregates were collected and induced to differentiate using E6 medium containing 2% Matrigel, 10 μM MSB431542, 4 ng / mL bFGF and 2.5 ng / mL BMP4.

[0022] S3, Day 3 of induced differentiation, add E6 medium containing 200 ng / mL LDN-193189 (BMP inhibitor) and 250 ng / mL bFGF;

[0023] S4. On day 6 of induced differentiation, add E6 medium, and on days 8 and 10, perform a half-volume medium replacement with E6 medium.

[0024] S5. On day 12 of induced differentiation, cell aggregates were collected, and skin organoid maturation medium containing 1% Matrigel was added. The cells were placed on a shaker and cultured at 5% CO2, 37°C, and 65 rpm. On day 15, half of the medium was replaced with skin organoid maturation medium containing 1% Matrigel.

[0025] S6. From day 18 to day 45 of induced differentiation, half of the medium was replaced every 3 days with skin organoid maturation medium.

[0026] S7. Starting from day 45 of induced differentiation, replace half of the medium with skin organoid maturation medium every 2 days, and replace the entire medium with skin organoid maturation medium once a week. Culture until day 85-100 to obtain primary skin organoids.

[0027] Thus, the resulting primary skin organoids have differentiated keratinocyte differentiation proteins Loricrin and Filaggrin, and the organoids are thick enough to be cut into fragments or dissected, and are easy to handle.

[0028] In some embodiments, in step (4), gelma can be dropped between the primary skin organoid and the decellularized porcine skin slice, and the gelma can be cured by blue light irradiation, thereby inoculating the primary skin organoid onto the decellularized porcine skin.

[0029] In some embodiments, the method of culturing the complex at the gas-liquid interface in step (4) may include the following steps:

[0030] The complex was added to the Transwell chamber, followed by the addition of skin organoid maturation medium. The skin organoid maturation medium should not submerge the skin organoids in the primary complex to form an air-liquid culture interface. During the culture process, a complete medium change was performed every 3 days.

[0031] In some embodiments, the skin organoid maturation culture medium comprises: basal medium, 1×GlutaMax, 0.5×B-27minus vitamin A, 0.5×N-2 supplement, 0.1mM 2-mercaptoethanol, and 100μg / mL normocin, wherein the basal medium is composed of advanced DMEM / F-12 and neurobasal medium in a 1:1 volume ratio.

[0032] In some implementations, the decellularized pigskin can be a commercially available decellularized pigskin matrix.

[0033] In some embodiments, the method for preparing decellularized pig skin may include the following steps:

[0034] A1) Take pig skin, clean and sterilize it, freeze it at -80℃ for 4 hours, thaw it at room temperature, and repeat the freezing and thawing process 10 times.

[0035] A2) After the last thaw, the pig skin was placed in 2% SDS and shaken at 350 rpm at room temperature for 36 h; then the pig skin was removed and placed in 1% Triton X-100 containing 2% penicillin and streptomycin antibiotics and shaken at 350 rpm at room temperature for 12 h.

[0036] A3) Remove the pig skin and place it in a 4% sodium deoxycholate aqueous solution. Shake at 200 rpm and room temperature for 2 hours. Remove the pig skin and remove the protein by distilling water and 3.4M NaCl solution, and remove the nucleic acid by a solution containing 10 μg / mL DNase and 5 μg / mL RNase. Dry and sterilize to obtain the final product.

[0037] Therefore, the resulting decellularized pigskin is thoroughly decellularized, has a loose and porous structure, and retains DNA within acceptable limits. Compared to commercially available decellularized pigskin matrix, the decellularized pigskin collagen provided by this invention is more completely preserved.

[0038] In some embodiments, protein removal using 3.4M NaCl solution may specifically include the following steps: placing the cleaned pigskin in 3.4M NaCl solution, shaking at 350 rpm and room temperature for 1 hour, removing the pigskin, and washing it with PBS buffer at room temperature.

[0039] In some embodiments, denucleic acid removal using a solution containing 10 μg / mL DNase and 5 μg / mL RNase may specifically include the following steps: placing the deproteinized pig skin in a PBS buffer containing 10 μg / mL DNase and 5 μg / mL RNase, shaking at 350 rpm and 37°C for 1 h, removing the pig skin, and washing it with PBS buffer.

[0040] According to another aspect of the present invention, a method for preparing a UVB-induced skin organoid aging model is provided, comprising the following steps:

[0041] The tissue-engineered skin organoids of the present invention were added to PBS buffer, irradiated with UVB for 5-10 min, and then cultured in skin organoid maturation medium for 24 h to obtain the final product.

[0042] The activity of β-galactosidase in tissue-engineered skin organoids was increased after UVB irradiation, and the expression of aging-related secretory phenotypes TNF-α, IL-6, IL-8, and MMP-2 was increased, while the production of SOD decreased. This indicates that UVB can induce aging in human skin organoids, and a UVB-induced skin organoid aging model was successfully constructed.

[0043] In some implementations, the wavelength of UVB irradiation can be 302 nm, and the intensity can be 900 μW / cm². 2 .

[0044] The UVB-induced skin organoid aging model provided by this invention can be applied to the screening of anti-photoaging materials and the study of the mechanism of action of anti-photoaging materials. Attached Figure Description

[0045] Figure 1 This is a phase contrast microscope image of the hiPSCs cultivation process. The microscope was magnified 40 times and the scale bar was 500 μm.

[0046] Figure 2 Images showing the immunostaining results of NANOG and OCT4 in hiPSCs, taken under a microscope at magnifications of 100x (top) and 200x (bottom), with scale bars of 50μm (top) and 20μm (bottom).

[0047] Figure 3 The images show the immunostaining results of SOX2 in hiPSCs. The images were taken under a microscope at magnification of 40x (top) and 100x (bottom), with scale bars of 500μm (top) and 100μm (bottom).

[0048] Figure 4 This is a schematic diagram illustrating the process of induced differentiation of skin organoids.

[0049] Figure 5The images show the changes during the induced differentiation process of skin organoids under a microscope. The microscope images were taken at a magnification of 40x and a scale bar of 500μm.

[0050] Figure 6 This shows the size changes during the induced differentiation of skin organoids, among which... *** P<0.001, ** P<0.01, * P<0.05;

[0051] Figure 7 HE staining and light micrographs of skin organoids induced to differentiate to day 88 were taken under a microscope at magnifications of 40x (left), 100x (top right), and 200x (bottom right), with scale bars of 500μm (left), 50μm (top right), and 20μm (bottom).

[0052] Figure 8 Immunofluorescence identification image of skin organoids induced to differentiate for approximately 84 days was obtained by microscopy at 100x magnification and with a scale bar of 50 μm.

[0053] Figure 9 Light microscopy (left) and scanning electron microscopy (SEM) images of skin organoids induced to differentiate to day 79. The light microscopy magnification was 100x and the scale bar was 50μm (left); the SEM magnifications were 500x (middle) and 1000x (right), and the scale bars were 20μm (middle) and 10μm (right), respectively.

[0054] Figure 10 Light microscopy (left) and HE staining images of skin organoids induced to differentiate to day 120. Microscopic images were taken at magnifications of 40x (left), 100x (top right), and 200x (bottom right), with scale bars of 500μm (left), 50μm (top right), and 20μm (bottom).

[0055] Figure 11 Immunofluorescence identification images of mature skin organoids: KRT5 scale bar at 100 μm; NEFH scale bar at 50 μm and 20 μm; NEFH / KRT5 double staining scale bar at 50 μm and 20 μm; SCD-1 scale bar at 200 μm and 20 μm; MITF scale bar at 50 μm and 20 μm.

[0056] Figure 12 Oil Red O staining images of mature skin organoids, with scale bars at 200 μm (left) and 100 μm (right);

[0057] Figure 13 Images of DAPI staining results for normal and decellularized pig skin, taken under a microscope at 100x magnification and with a scale bar of 200μm.

[0058] Figure 14 Images of HE staining results for normal and decellularized pig skin, taken under a microscope at 40x magnification and with a scale bar of 500μm;

[0059] Figure 15 Scanning electron microscope (SEM) images of normal and decellularized pig skin are shown. The SEM magnifications are 500x (transverse section) and 200x (longitudinal section), and the scale bars are 20μm (transverse section) and 50μm (longitudinal section).

[0060] Figure 16 Images show the Masson staining results of normal and decellularized pig skin, taken under a microscope at 200x magnification with a scale bar of 100μm. * P<0.05, vs normal pigskin;

[0061] Figure 17 DNA quantification results for normal and decellularized pig skin. *** P < 0.001;

[0062] Figure 18 This is an anatomical diagram of skin organoids;

[0063] Figure 19 HE staining results and immunofluorescence identification results of the tissue-engineered skin organoids obtained in Example 3 were obtained by microscopic imaging at magnification of 100x and 200x, with scale bars of 200μm and 100μm.

[0064] Figure 20 HE staining and immunofluorescence identification results of the tissue-engineered skin organoids prepared in Comparative Example 1 were obtained by microscopic imaging at magnifications of 100x and 200x, with scale bars of 200μm and 100μm.

[0065] Figure 21 HE staining and immunofluorescence identification results of the tissue-engineered skin organoids prepared in Comparative Example 2 were obtained by microscopic imaging at magnifications of 40x, 100x, and 200x, with scale bars of 500μm, 200μm, and 50μm.

[0066] Figure 22 Images showing β-galactosidase staining results of tissue-engineered skin organoids under different treatments, taken under a microscope at 100x magnification and with a scale bar of 200μm;

[0067] Figure 23 The expression of TNF-α, IL-6, and IL-8 in tissue-engineered skin organoids under different treatments was shown by microscopy at 400x magnification and scale bar at 20μm.

[0068] Figures 24-26The mRNA levels of TNF-α, IL-6, and IL-8 in tissue-engineered skin organoids under different treatments are shown in descending order. * P<0.05, *** P<0.001;

[0069] Figure 27 The expression of MMP-2 in tissue-engineered skin organoids under different treatments. * P<0.05;

[0070] Figure 28 The expression of cycle-related proteins p16 / p21 / p-p53 in tissue-engineered skin organoids under different treatments. * P<0.05, ** P<0.01, *** P<0.001;

[0071] Figure 29 The amount of SOD generated in tissue-engineered skin organoids under different treatments. Detailed Implementation

[0072] The present invention will be further described in detail below with reference to the embodiments. The embodiments are for illustrative purposes only and do not limit the invention in any way. Unless otherwise specified, the raw materials and reagents used in the embodiments are conventional products that can be obtained commercially; experimental methods that do not specify specific conditions in the embodiments are generally performed under conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0073] Example 1: Constructing human skin organoids using hiPSCs

[0074] The human iPSCs (hiPSCs) cell line used in this invention is from the School of Medicine, Sun Yat-sen University.

[0075] I. Preparation of Main Reagents

[0076] 1. Preparation of Y-27632 (Manufacturer: Tocris Bioscience, Catalog No.: 1254 / 1) stock solution: Briefly separate the tube containing Y-27632. Dissolve 1 mg of Y-27632 in 148 μL of sterile ultrapure water, at which point the concentration is 20 μmol / mL. Aliquot and store at -80℃ until use. When using, add 1–2 μL of stock solution to 1 mL of culture system.

[0077] 2. Preparation of SB431542 (R&D, 1614 / 10) stock solution: Immediately disconnect the tube containing SB431542. Dissolve 10 mg of SB431542 in 2.378 mL of DMSO, protecting from light. After thorough dissolution and mixing, aliquot and store at -80°C for later use. Add 1 μL of stock solution to each 1 mL of culture system before use.

[0078] 3. Preparation of bFGF (Peprotech, 100-18B) stock solution: Immediately disconnect the tube containing bFGF. Dissolve 500 μg of bFGF in 1 mL of 5 mM Tris, pH 7.6. After thorough dissolution and mixing, aliquot and store at -80°C for later use. Dilute to the required concentration before use: for a concentration of 4 ng / mL, add 0.24 μL of stock solution per 30 mL of system; for a concentration of 250 ng / mL, add 2.5 μL of stock solution per 5 mL of system.

[0079] 4. Preparation of BMP4 (Peprotech, AF-120-05ET) stock solution: Immediately disconnect the tube containing BMP4. Dissolve 100 μg of BMP4 in 1 mL of 5 mM HCl. After thorough dissolution and mixing, aliquot and store at -80°C for later use. When using, add 0.05 μL of stock solution to each 1 mL culture system.

[0080] 5. Preparation of LDN-193189 (R&D, 6053 / 10) stock solution: Immediately separate the tube containing LDN-193189. Dissolve 10 mg of LDN-193189 in 5 mL of DMSO, protecting from light. Aliquot and store at -80°C. When using, add 0.25 μL of stock solution to each 1 mL of culture system.

[0081] 6. Preparation of Organoid maturation medium (OMM): OMM was prepared by mixing Advanced DMEM / F12 (Gibco, 12634010) and Neurobasal medium (Gibco, 356230) in a 1:1 ratio, and adding 1×GlutaMax (Gibco, 35050061), 0.5×B-27minus vitamin A (Gibco, 12587010), 0.5×N-2 supplement (Gibco, 17502048), 0.1 mM 2-mercaptoethanol (Gibco, 21985023), and 100 μg / mL Normocin (Invitrogen, ant-nr-1).

[0082] 7. Thawing and dispensing of Matrigel (Corning, 354277 / 356230): Place the Matrigel in a foam box filled with crushed ice and thaw overnight at 4°C. Dispense the next day and store at -30°C.

[0083] 8. Preparation of Gelma: Prepare Gelma (methacrylamide gelatin, Huaxia Siyin, 10527C) and blue light initiator (Huaxia Siyin, 20601A) in OMM medium to a concentration of 7.5% and 1.5%, respectively. Prepare approximately 2-3 mL each time. After preparation, filter the solution and dispense it into small EP tubes. Dispense 70 μL of Gelma and 40 μL of blue light initiator into each tube (use one tube of Gelma and one tube of blue light initiator together). Inoculate the mixture and skin organoids (whole or digested) into pre-drilled wells in decellularized porcine skin. Irradiate with a blue light flashlight for about 10-15 seconds. The mixture is ready when it has a jelly-like consistency when gently touched with tweezers.

[0084] II. Experimental Methods

[0085] (I) The recovery and cultivation of hiPSCs

[0086] Before cell resuscitation, the culture plates were coated with Matrigel Matrix (20×) and incubated in a cell culture incubator for at least 0.5 h. HiPSCs were removed from the liquid nitrogen tank and placed in a 37°C water bath until completely thawed. The thawed cells were then slowly added to a 15 mL sterile centrifuge tube containing 4 mL of mTeSRTM1 medium (STEMCELL, catalog number 85850). The tubes were centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. 1 mL of mTeSRTM1 medium and 10 μM Y-27632 dihydrochloride were added, and the cells were seeded into Matrigel Matrix (20×) coated wells and cultured in a cell culture incubator. The medium was changed daily, and the cell status was observed under an inverted optical microscope. HiPSCs were passaged when the colonies became too large or reached confluence.

[0087] (II) HiPSCs passage and cryopreservation

[0088] Discard the old culture medium from the well plate and add 0.5 mL. (Cell dissociation agent, Gibco, A1110501), digest for 2 min in a cell culture incubator, add 1 mL of mTeSRTM1 medium to stop digestion, transfer to a 15 mL sterile centrifuge tube, centrifuge at 1000 rpm for 5 min, and seed in Matrigel Matrix (20×) coated cell culture plates at a 1:6 ratio. Incubate at 37°C in a CO2 incubator. After cell digestion and centrifugation, follow the Knock Out procedure. TMSR-Multi-Species: Prepare cell cryopreservation solution with a DMSO ratio of 9:1 (this cell cryopreservation solution has a higher cell survival rate compared to the cell cryopreservation solution prepared with a culture medium: serum: DMSO ratio of 5:4:1). Resuspend the cells in the prepared cryopreservation solution, transfer the suspension to cell cryovials, and store them in liquid nitrogen after gradient cooling.

[0089] (III) Immunofluorescence identification of hiPSCs

[0090] When passaged hiPSCs, cells were seeded into cell culture dishes pre-coated with matrix gel. Once the hiPSCs nearly formed a monolayer, the coverslips were removed, and the cells were washed once with PBS and fixed with 4% paraformaldehyde solution (Soleb, P1110) for 30 min. The cells were then washed three times with PBS, 5 min each time. Cells were blocked and permeabilized using blocking buffer containing 10% donkey serum and 3% Triton X-100 (Maclean, T824275-500 mL) at 37°C for 30 min. Appropriate concentrations of NANOG (Proteintech, 14295-1-AP), OCT4 (Proteintech, 60242-1-Ig), and SOX2 (BD, 561469) primary antibodies, prepared with PBST containing 3% Triton X-100, were added to the cell culture dishes, and the cells were incubated overnight at 4°C. The following day, the cells were washed three times with PBST, 5 min each time. The cells were then incubated with a suitable concentration of fluorescent secondary antibody at 37°C for 2 hours. They were washed three times with PBS, 5 minutes each time. Finally, the cell nuclei were counterstained with Hoechst 33342 (ABCAM, ab228551). The cells were washed three times with PBS, 5 minutes each time. One drop of anti-fluorescence quenching mounting medium (Solepro, S2100) was added to each slide, and the slides were mounted and examined under a fluorescence microscope.

[0091] (iv) Construction of skin organoids

[0092] (1) Digestion and dissociation of hiPSCs in 6-well plates. Cells were then suspended in E8 medium containing 10 μM Y27632. Viable cell counts were determined by trypan blue staining. An appropriate number of viable cells were transferred to E8 medium (Essential 8 medium, Corning, A1517001) containing 20 μM Y27632 and seeded at a density of 6000 cells per well (100 μL) into 96-well U-shaped plates (αplus, WP24-5CCUSH) with low adsorption. Cell aggregation was aided by centrifugation at 110 g for 6 min. These cell aggregates were incubated at 37 °C in a 5% CO2 incubator for 24 h.

[0093] (2) Add an equal volume of fresh E8 medium (100 μL) to each well to dilute Y27632 and promote cell proliferation and aggregation growth.

[0094] (3) The next day, differentiation was induced. All cell aggregates were collected and transferred to a new 96-well U-shaped plate and cultured in 100 μL of E6 medium containing 2% Matrigel, 10 μM SB431542, 4 ng / mL bFGF and 2.5 ng / mL BMP4 to initiate non-neural ectoderm formation.

[0095] (4) On the third day of differentiation, 25 μL of E6 medium containing 200 ng / mL LDN-193189 (BMP inhibitor) and 250 ng / mL bFGF was added to each well, so that the final volume was 125 μL per well, inducing the formation of CNC (cranial neural crest) cells.

[0096] (5) On the 6th day of differentiation, add 75 μL of fresh E6 medium to make the final volume reach 200 μL.

[0097] (6) Replace half of the E6 medium with fresh medium on day 8 and day 10.

[0098] (7) On day 12, to induce epidermal self-assembly, all aggregates were transferred into the individual wells of a 24-well low-attachment plate in 500 μL of OM containing 1% Matrigel. To maintain the aggregates in the floating culture to keep the medium circulation constant, the 24-well plate was placed on a vortex shaker and run at 65 rpm in a 37°C incubator containing 5% CO2.

[0099] (8) On day 15 of differentiation, replace half of the culture medium in the 24 wells with OMM containing 1% Matrigel.

[0100] (9) Starting from day 18, perform a half-volume medium change every 3 days (from day 18 to day 45) or every other day (from day 45 to day 150 or longer) with fresh OMM without Matrigel, including a full medium change once a week starting from day 45.

[0101] (10) As the aggregates mature and grow larger, it may be necessary to increase the total volume of the culture medium per well to 1 mL starting from day 80.

[0102] (11) Observe the growth of organoids and take pictures every day using an inverted microscope.

[0103] (V) Organoid sections

[0104] Skin organoids were fixed overnight at 4°C with 4% paraformaldehyde, and then washed three times with PBS for 5 minutes each time.

[0105] Organoids were embedded using OCT (Sakura, 4583). Sections were prepared using a cryostat to a thickness of approximately 20 μm. Each tissue sample was mounted on 15-20 slides, with 3-4 tissue samples mounted on each slide. The sections were dried in a 37°C oven for 30 min and then transferred to a -80°C freezer for long-term storage.

[0106] (vi) Immunofluorescence analysis of organoid surface markers

[0107] Wash sections three times with PBS. Block with blocking buffer containing 10% donkey serum and 3% Triton X-100 in a humidified chamber at 37°C for 1 hour. Incubate with primary antibody overnight at 4°C. Wash three times with PBS for 5 minutes each time. Incubate with secondary antibody at room temperature for 2 hours and counterstain with Hoechst 33342. Mount sections with anti-fluorescence quenching mounting medium for photography. Negative control samples are incubated with secondary antibody only. Observe fluorescence under a fluorescence microscope. Observe the formation of epidermal, basal, and dermal markers (CD49f, KRT5, KRT15, ​​Vitmentin, PDGFR-α) on days 55-75 of organoid culture. After 75 days, observe the formation of hair follicle-related structures such as follicular skin coagulants and dermal papillae. After 120 days, observe the formation of skin appendage structures such as sensory neuron markers.

[0108] (vii) Oil Red O staining method for analyzing organoid sebaceous glands and adipocyte clusters

[0109] After thawing frozen sections, wash three times with PBS for 5 minutes each time. Shake dry the sections, label tissue blocks with an immunohistochemistry pen, rinse with 60% isopropanol for 20 seconds, then rinse with water. Stain with Oil Red O dye at room temperature for 10 minutes. Place the sections on a humidified chamber to prevent drying. Discard the Oil Red O dye and differentiate the sections with 60% isopropanol. Rinse with pure water. Mount with neutral resin and observe under a light microscope.

[0110] (viii) HE staining

[0111] (1) Frozen sections were baked in a 37°C oven for 30 min, then washed three times with PBS for 5 min each time. The sections were fixed with 95% ethanol for 1 min. Hematoxylin staining was performed for 30 s-2 min, followed by rinsing with running water for 1 min. The staining of cell nuclei was observed under a microscope. The sections were differentiated with 1% hydrochloric acid alcohol for 1 s, followed by rinsing with running water for 3 min. The sections were then soaked in 80% ethanol for 30 s, followed by rinsing with running water for 1 min. Eosin staining was performed for 1 min, followed by rinsing with running water for 1 min.

[0112] (3) Dehydration and mounting: Immerse the slides sequentially in 75% ethanol for 20s, 80% ethanol for 20s, 95% ethanol for 20s, anhydrous ethanol for 1 min, xylene I for 10 min, and xylene II for 10 min. Remove the slides from the xylene, shake off excess water, and finally mount with cell preservation solution. Store at room temperature.

[0113] III. Experimental Results

[0114] (I) Cultivation and Identification of HiPSCs

[0115] Resuscitate hiPSCs at approximately 50% density, changing the hiPSC culture medium daily with fresh medium. Passage the cells once they form large clones or begin to fuse. Figure 1 This is a phase-contrast microscope image of the hiPSC culture process. The hiPSC cells are uniform in size, grow in clusters, and form clonal clusters. The clonal clusters have clear boundaries, and the cells are tightly packed together without obvious gaps.

[0116] NANOG and OCT4 are transcription factors expressed in pluripotent stem cells and are crucial for maintaining the pluripotency of embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). NANOG promotes the self-renewal of iPSCs through synergistic action with other transcription factors such as OCT4. SOX2-positive expression is essential for the induction of hiPSCs into neural epithelium. During the differentiation of iPSCs into neural cells, the expression pattern and regulatory network of SOX2 are crucial for guiding cell fate determination. SOX2 is essential for the self-renewal and differentiation of neural stem cells and neural progenitor cells. It regulates the expression of genes related to neural development by binding to promoter and enhancer regions of various target genes. SOX2 expression in neural stem cells is closely related to cell pluripotency and self-renewal capacity, while in neural progenitor cells, SOX2 expression is associated with cell differentiation and maturation. Immunofluorescence results showed ( Figure 2-3 ), hiPSCs showed high expression of NANOOG, OCT4 and SOX2.

[0117] (II) Skin organoid induction

[0118] Figure 4 This is a diagram illustrating the process of skin organoid formation.

[0119] First, embryoids with a diameter of about 500 μm were formed in an ultra-low adsorption 96-well plate. After washing the embryoids three times with E6 medium, subsequent induction was performed. Figure 5-6The results showed that on day 3 of induction, a thin, transparent epithelial layer formed on the surface of the skin organoids; from day 6 to 9, sacs formed, containing dark nuclei and radial traces of mesenchymal cell migration from the nucleus to the peripheral epithelium. From day 12 to 21, the surface of the sacs was lightly covered by mesenchymal cells, and a cluster of mesenchymal cells formed at one pole of the sac. Subsequently, the maturation medium OMM, which was used to maintain organoid growth and differentiation, was changed every 3 days or every other day to promote further differentiation and maturation. At approximately day 120, an organoid structure was observed, consisting of a transparent sac as the head and a dense, opaque cell cluster as the tail.

[0120] (III) Identification of Skin Organoids

[0121] 1. HE staining observation of skin organoids in mid-differentiation stage

[0122] The skin organoids induced to day 88 were fixed, sectioned, and stained with hematoxylin and eosin (HE). The results are as follows: Figure 7 As shown. Figure 7 The differentiated skin organoids clearly show keratinocytes, basal layer structures, and dermis, with hair follicle structures already beginning to form.

[0123] 2. Identification of the basic structures of the epidermis, basal layer, and dermis during differentiation.

[0124] After 75 days of induction, the skin organoids can be identified in terms of the epidermis, basal layer, and dermis.

[0125] Figure 8 Immunofluorescence identification of skin organoids induced for approximately 84 days shows that the embryoids have differentiated into skin organoids containing an epidermal layer (KRT15), a dermal layer (PDGFR-α, SOX2), and visible hair primordia (PCAD) structures in the dermal layer.

[0126] 3. Scanning electron microscopy observation of skin organoid morphology during differentiation

[0127] After fixation, dehydration, drying, and conductive coating, the skin organoids on day 79 were scanned. Figure 9 The results show that SEM images can clearly display the surface texture and microstructure of skin organoids, with the morphology and density of hair follicles clearly visible.

[0128] 4. HE staining observation of differentiated and mature skin organoids

[0129] Skin organoids induced to 120 days were fixed, sectioned, and stained with hematoxylin and eosin (HE). Figure 10 The light micrograph reveals a more mature hair follicle structure. HE staining shows keratinocytes, keratinized layers, and even shed and dead keratinocytes.

[0130] 5. Identification of the basic structures of the epidermis, basal layer, and dermis of differentiated mature skin organoids.

[0131] Mature skin organoids induced for more than 120 days were fixed, dehydrated, sectioned, and immunofluorescence stained. The expression of various maturity markers in the skin organoids was then observed under a laser confocal microscope. Figure 11 It is evident that mature skin organoids possess structures such as hair follicles (KRT5), sebaceous gland structures (SCD-1), sensory neurons (NEFH), Merkel cells (KRT20), and melanocytes (MITF).

[0132] 6. Sebaceous gland structure of differentiated mature skin organoids stained with Oil Red O.

[0133] Mature skin organoids induced for more than 120 days were fixed, dehydrated, sectioned, and stained with Oil Red chromatogram. The Oil Red staining was then observed under a light microscope. Figure 12 It is evident that mature skin organoid hair follicles can be stained orange-red by oil red dye, suggesting that the hair follicles contain sebaceous glands or fatty structures.

[0134] Example 2: Preparation of decellularized pig skin

[0135] The normal pig skin used in this embodiment was purchased from Shiqi Slaughterhouse in Panyu, Guangzhou; the decellularized pig skin matrix was purchased from Jiangsu Youchuang Biomedical Technology Co., Ltd. (DC-ADM-C type).

[0136] I. Preparation of Main Reagents

[0137] Preparation of 1.2% SDS: Take 10 mL of 20% SDS aqueous solution (Maclean, S885172-250 mL), add sterile water for injection to make up to 100 mL, and then filter it through a 0.22 μm needle filter to sterilize it before use.

[0138] Preparation of 2.4% sodium deoxycholate aqueous solution: Accurately weigh 4g of sodium deoxycholate powder (Maclean, H854437-25g), add sterile water for injection to a final volume of 100mL, and then filter through a 0.22μm needle filter for sterilization before use.

[0139] 3.3.4M NaCl preparation: Accurately weigh 19.8706g of NaCl crystal powder (Maclean, S805275-500g), add sterile water for injection to a final volume of 100mL, and filter through a 0.22μm needle filter for sterilization before use.

[0140] 4. Preparation of DNase (20 μg / mL): Immediately separate the tube containing DNase (Thermo Fisher Scientific, DN25-100 mg). Accurately weigh 1 mg of DNase powder, dilute to 50 mL of sterile water for injection, and filter through a 0.22 μm syringe filter for sterilization.

[0141] 5. Preparation of RNase (10 μg / mL): Briefly remove the tube containing RNase (Thermo Fisher Scientific, EN0531). Pipette 50 μL of 10 mg / mL RNase aqueous solution and add it to 49.95 mL of sterile water for injection to obtain a 10 μg / mL RNase solution. Before use, mix the 20 μg / mL DNase aqueous solution and the 10 μg / mL RNase solution in a 1:1 ratio.

[0142] II. Experimental Methods

[0143] (I) Preparation of decellularized pigskin

[0144] 1. Take the full-thickness pigskin, rinse it three times with distilled water, then soak it in alcohol for 30 seconds and rinse it twice with physiological saline. Remove the hair with scissors and tweezers, scrape off the fat with a blade, and then wash it three times with sterile water for injection. Then soak it overnight at 4°C in ddH2O containing 2% penicillin-streptomycin (Gibco, 15140122) + 10 μg / mL gentamicin (Thermo Fisher Scientific, G1272) + 2.5 μg / mL soluble amphotericin B (Solepro, IA0320).

[0145] 2. On the second day, rinse repeatedly with sterile water for injection, cut into 5*2cm tissues, freeze at -80℃ for 4 hours, and thaw 10 times at room temperature.

[0146] 3.2% SDS, shaken at 350 rpm at room temperature for 36 h, and 1% Triton X-100 (containing 2% penicillin and streptomycin), shaken at 350 rpm at room temperature for 12 h, were used for decellularization treatment alternately.

[0147] 4. Infuse with 4% sodium deoxycholate aqueous solution at 200 rpm and shake at room temperature for 2 hours. After rinsing with distilled water, cut 0.5*0.5cm full-thickness pigskin for frozen sections and stain with DAPI.

[0148] 5. After observing the cell-free structure, the skin was washed sequentially with 3.4M NaCl with shaking to remove proteins, and then with a solution containing DNase (10 μg / mL) and RNase (5 μg / mL) to remove nucleic acids. Finally, the decellularized pigskin was freeze-dried, sterilized by ultraviolet irradiation, and stored at -80℃ for later use.

[0149] (II) DAPI nuclear staining:

[0150] Untreated pigskin (normal pigskin), decellularized pigskin prepared in this example (hereinafter referred to as "non-crosslinked decellularized pigskin"), and commercially available decellularized pigskin were routinely fixed and dehydrated, then embedded and sectioned using OCT. The slides were washed three times with PBS for 5 minutes each time. Then, the tissue edges were circled with an immunohistochemical pen, DAPI staining solution was added to the tissue, and the slides were incubated at room temperature for 10 minutes. After washing with PBS, the slides were mounted for observation under a microscope.

[0151] (III) Masson staining

[0152] Masson staining was performed using a Masson staining kit (Solepro, G1340).

[0153] Place the frozen sections to be stained in a 37°C oven for 30 minutes. Wash three times with PBS, 5 minutes each time. Stain with prepared Weigert iron hematoxylin staining solution for 5-10 minutes, then differentiate with acidic ethanol differentiation solution and rinse with tap water. Re-blue with Masson's blue solution and wash with water. Wash with distilled water for 1 minute. Stain with Ponceau S and fuchsin for 5-10 minutes. Prepare a weak acid working solution with distilled water and weak acid solution in a 2:1 ratio and wash for 1 minute. Wash with phosphomolybdic acid solution for 1-2 minutes. Wash with weak acid working solution for 1 minute. Stain directly in aniline blue staining solution for 1-2 minutes. Wash with weak acid working solution for 1 minute. Dehydrate with 95% ethanol and anhydrous ethanol three times, 10 seconds each time. Clear with xylene three times, 2 minutes each time. Finally, mount with mounting medium.

[0154] (iv) Scanning electron microscopy observation of pigskin morphology

[0155] Pigskin was freeze-dried in a freeze dryer for 72 hours. It was then sprayed with gold and observed under a scanning electron microscope.

[0156] (v) DNA Residual Detection

[0157] Pig skin was freeze-dried for 72 hours. A suitable amount of tissue was taken from three groups of samples and weighed, with three aliquots from each group, approximately 20 mg per aliquot. DNA was extracted using a DNA extraction kit (Novizan, DC102). The tissue was minced, and 230 μL of buffer GA and 20 μL of proteinase K were added. The mixture was incubated at 55°C until the tissue was completely dissolved. 250 μL of buffer GB was added, vortexed, and incubated at 70°C for 10 minutes. Then, 180 μL of anhydrous ethanol was added, and the mixture was mixed by pipetting and then transferred to an adsorption column for centrifugation. The adsorption column was treated to remove proteins, ions, and residual ethanol. Finally, 50 μL of preheated Elution Buffer was added to elute the column. The extracted DNA was quantified using a Nanodrop 2000. The DNA content (ng / mg) in the sample was calculated based on the detection results.

[0158] III. Experimental Results

[0159] (1) Macroscopic morphology and DAPI staining of decellularized pig skin

[0160] Non-crosslinked decellularized pigskin and purchased decellularized pigskin are lighter in color, with less visible pores and texture compared to normal tissue. Non-crosslinked decellularized pigskin is more elastic than commercially available decellularized pigskin. DAPI staining of frozen sections showed (…). Figure 13 Compared to normal pig skin tissue where blue fluorescent cell nuclei can be found in the full thickness of the skin, non-crosslinked decellularized pig skin still shows a small number of cell nuclei, while commercially available decellularized pig skin does not show obvious blue fluorescent cell nuclei.

[0161] (2) Effects of decellularization on the histological morphology of porcine skin stained with hematoxylin and eosin (HE).

[0162] HE staining showed ( Figure 14 Normal porcine skin tissue shows blue-stained cell nuclei and abundant collagen and elastin fibers. In non-crosslinked decellularized porcine skin, no blue-stained cell nuclei were observed in either transverse or longitudinal sections. The density of dermal collagen arrangement remained unchanged, its distribution was normal, and no defects were observed. Compared to the normal porcine skin group and the non-crosslinked decellularized porcine skin group, the collagen in commercially available decellularized porcine skin was significantly lighter in color, possibly related to the degree of crosslinking or possible aging and degeneration.

[0163] (3) Morphological changes of decellularized pig skin under scanning electron microscopy

[0164] Scanning electron microscopy results show ( Figure 15 Both normal and decellularized pig skin tissues contain abundant collagen fibers, including coarse collagen fibers and fine, branched reticular collagen fibers. Compared with other groups of pig skin, the non-crosslinked decellularized pig skin has a looser and more porous fiber structure.

[0165] (4) Masson staining of decellularized pig skin to observe changes in collagen density

[0166] After Masson staining, collagen appears blue and cell nuclei appear red under bright field observation. For example... Figure 16 As shown, non-crosslinked decellularized pigskin and commercially available decellularized pigskin are looser in texture, and there is no significant change in collagen distribution between non-crosslinked decellularized pigskin and normal pigskin. The area occupied by collagen was calculated using FUJI software, and the data were analyzed using SPSS 26.0. The lack of significant change in collagen distribution between non-crosslinked decellularized pigskin and normal pigskin indicates that there is no significant change in collagen distribution before and after decellularization. The collagen distribution area in commercially available decellularized pigskin was smaller than that in normal pigskin (P = 0.041), and the difference was statistically significant.

[0167] (5) Determination of DNA content by dry weight of decellularized pigskin

[0168] The dry weight of DNA in decellularized scaffolds is an important indicator for evaluating the effectiveness of decellularization. Scaffold materials with low DNA content can reduce immunogenicity and improve biocompatibility. DNA residues remained in porcine skin after decellularization. DNA quantification results showed (…). Figure 17 The DNA content of normal porcine skin tissue was (99.43673±16.41099) ng / mg. The DNA content of commercially available decellularized porcine skin scaffolds and non-crosslinked decellularized porcine skin was 12.58642±9.06713 and 4.54443±4.49308 ng / mg, respectively, both <50 ng / mg. Compared with normal porcine skin tissue, P<0.001, indicating a statistically significant difference.

[0169] Example 3: Construction of tissue-engineered skin organoids

[0170] Includes the following steps:

[0171] (1) The decellularized pig skin obtained in Example 2 was sliced, and the slice thickness was about 100 μm.

[0172] (2) The skin organoid cultured to day 100 in Example 1 was dissected. The anatomical diagram is shown below. Figure 18 As shown, during the dissection, the tail, composed of dense, opaque cell clusters, was removed from the skin organoid. Figure 18 The part circled in red in the middle) was dissected to open its transparent sac-like structure. Figure 18(The orange dashed line in the middle is the anatomical schematic line). Then, the transparent sac-like structure of the skin organoid was inoculated onto decellularized porcine skin with the inner side facing up and the outer side facing down. Gelma gel was dropped between the skin organoid and the decellularized porcine skin section. After irradiation with blue light for 15 seconds, the gelma gel was gently touched until it became jelly-like. The porcine skin and organoid were then transferred to a Transwell 6-well plate for upper layer culture. 800 μL of OMM was added to ensure that the surface of the skin organoid was not submerged in the culture medium (air-liquid culture interface). The medium was changed every 3 days.

[0173] (3) After culturing for 10-21 days, the organoid-decellularized porcine skin culture was removed, routinely fixed and dehydrated, and then frozen sectioned and identified.

[0174] Figure 19 The results of HE staining and immunofluorescence identification of the tissue-engineered skin organoids obtained in this embodiment are shown.

[0175] HE staining results showed that the tissue-engineered skin organoids prepared in this embodiment had distinct epidermal and dermal layers, with the epidermis located above the dermis. After gas-liquid interface culture, the epidermal layer of the skin organoids thickened, and red-stained stratum corneum was visible. Hair follicle openings in the dermis faced upwards.

[0176] Immunofluorescence results showed that structures such as hair follicles (KRT5), sebaceous glands (SCD-1), sensory neurons (NEFH), and melanocytes (MITF) were visible in the skin organoids. This indicates that the tissue-engineered skin organoids cultured using the method of this invention more closely resemble physiological structures.

[0177] Comparative Example 1

[0178] (1) The decellularized pig skin obtained in Example 2 was sliced, and the slice thickness was about 1 mm.

[0179] (2) Take the skin organoid cultured for 85-100 days in Example 1 and cut it into 1mm pieces. 3 The organoids were then inoculated onto decellularized porcine skin, and Gelma gel was dropped onto the top layer. After 15 seconds of blue light irradiation, the Gelma gel turned into a jelly-like state upon gentle touch. The porcine skin and organoids were then transferred to 24-well plates for culture. After culture until D120 or higher, the organoid-decellularized porcine skin culture was removed, routinely fixed and dehydrated, and then frozen sectioned and identified.

[0180] HE staining and immunofluorescence results showed that ( Figure 20The decellularized porcine skin showed infiltrated cell nuclei and exhibited good tissue compatibility with the digested and inoculated skin organoids. The epidermis contained keratinocytes, keratinocyte clusters (white arrows in HE image), the basal layer (KRT5 and KRT15), and basal melanocyte structures (MITF). The dermal structure (PDGFR-α) was clearly visible, and sebaceous gland structures were also observed (red arrows in HE image, SCD-1 fluorescence). However, the structure of this skin organoid was dispersed and did not reflect the physiological and anatomical structure of human skin.

[0181] Comparative Example 2

[0182] (1) The decellularized pig skin obtained in Example 2 was sliced, and the slice thickness was about 100 μm.

[0183] (2) Take the skin organoid cultured for 85-100 days in Example 1 and place it head-down on decellularized porcine skin. Apply Gelma gel to the contact area between the organoid and the porcine skin. After irradiating with blue light for 15 seconds, the Gelma gel will become jelly-like upon gentle touch. Then cover it with a decellularized porcine skin of the same size and thickness. Transfer the porcine skin and organoid to a 24-well plate for culture. Change the medium every 3 days. After culturing to D120 or higher, remove the organoid-decellularized porcine skin culture, perform routine fixation and dehydration, and then perform frozen sectioning and identification.

[0184] HE and immunofluorescence results showed that ( Figure 21 The decellularized porcine skin scaffold showed infiltrative cell nuclei with a downward infiltration trend. It exhibited good tissue compatibility with inoculated skin organoids. The skin organoids had a relatively thin epidermis, and the epidermal layer (KRT15), epidermal stem cells (CD49f), dermal structure (Vimentin), and hair follicle structure were visible.

[0185] Example 4: Construction of a UVB-induced skin organoid aging model

[0186] Includes the following steps:

[0187] Take the differentiated and mature tissue-engineered skin organoids obtained after 20 days of culture following dissection and inoculation in Example 3, add 1 mL of PBS to each well, and then irradiate the tissue-engineered skin organoids at a UVB radiometer at a wavelength of 302 nm for 5 min with an irradiation intensity of 900 μW / cm². 2 Then, add skin organoid maturation culture medium and continue culturing for 24 hours to obtain the product.

[0188] Identification of UVB-induced skin organoid aging models

[0189] I. Experimental Methods

[0190] The experimental subjects were the UVB-induced skin organoid aging model (UVB group) constructed in Example 4 and the tissue-engineered skin organoids (Contrl group) that did not undergo UVB irradiation treatment as a normal control group.

[0191] (I) Organoid sections

[0192] Skin organoids were fixed overnight at 4°C by immersion in 4% paraformaldehyde. The next day, they were washed three times with PBS for 5 minutes each time. After dehydration with 30% sucrose for 3 days, the organoids were embedded in OCT and sectioned in a cryostat (section thickness set to 20 μm). Each tissue was mounted on 15-20 slides, and 3-4 tissue sections were mounted on each slide. The sections were dried in a 37°C oven for 30 minutes and then transferred to a -80°C freezer for long-term storage.

[0193] (ii) β-galactosidase staining

[0194] Staining was performed using a β-galactosidase staining kit (Solepro, G1580). The steps included were as follows:

[0195] (1) Wash organoid sections with PBS 3 times, 5 min each time.

[0196] (2) Circle the tissue edge with an immunohistochemical pen. Add an appropriate volume of β-galactosidase staining fixative to the section, enough to fully cover the tissue, and fix at room temperature for at least 15 minutes (in a humidified chamber).

[0197] (3) Soak and wash the tissue with PBS 3 times, 5 min each time.

[0198] (4) Remove the PBS and add an appropriate amount of staining working solution. The preparation method for 1 mL of staining working solution is as follows:

[0199] Mix 10 μL of β-galactosidase staining solution A, 10 μL of β-galactosidase staining solution B, 930 μL of β-galactosidase staining solution C, and 50 μL of X-Gal solution thoroughly to obtain the final product.

[0200] (5) Incubate overnight in a humidified box at 37°C, and seal with plastic wrap to prevent evaporation. Wash with PBS three times the next day, 5 minutes each time.

[0201] (6) Observe under a regular optical microscope. If observation is not possible in time, add mounting solution and seal the slide, then store at 4°C for a period of time.

[0202] (III) Immunofluorescence staining

[0203] Organoid sections were washed three times with PBS. They were then blocked in a humidified chamber at 37°C for 1 hour with 10% donkey serum. After incubation with primary antibody at 4°C overnight, the sections were washed three times with PBS for 5 minutes each time. Following incubation with secondary antibody at room temperature for 1 hour and counterstaining with Hoechst 33342, the sections were mounted with anti-fluorescence quenching mounting medium for photography. Negative control samples were incubated with secondary antibody only. Fluorescence was observed under a fluorescence microscope.

[0204] (iv) Extraction of skin organoid proteins

[0205] The organoids were washed three times with pre-chilled PBS. RIPA cell lysis buffer was added, and the organoids were minced with scissors. After lysing on ice for 30 min, cell proteins were transferred to 1.5 mL EP tubes using a pipette. The tubes were vortexed and incubated on ice for another 30 min, vortexing once every 10 min. The EP tubes were centrifuged at 16000 rf for 30 min at 4 °C, and the supernatant was collected and stored at -80 °C.

[0206] (V) Protein quantification, electrophoresis, membrane transfer, and development

[0207] The expression levels of MMP-2 and cycle-related proteins p16 / p21 / p-p53 in organoids were detected.

[0208] 1. Protein quantification

[0209] Protein quantification was performed using the BCA Protein Quantification Kit (Beyotime, P0012). The steps included are as follows:

[0210] (1) Add 0.5 mg / mL of standard to a 96-well plate at the following ratios: 0, 1, 2, 4, 8, 12, 16, 20 μL. Add PBS to each well to bring the total to 20 μL. Set up two or more replicates.

[0211] (2) Take 1-2 μL of protein supernatant and dilute it 10-20 times with PBS to make the volume of each well 20 μL. Set up 2 replicates for each sample.

[0212] (3) Add 200 μL of BCA working solution to each well and mix well. Incubate at 37℃ for 20-30 min.

[0213] (4) Read the OD value at 562nm using an ELISA reader. Plot a standard curve and calculate the protein concentration.

[0214] 2. SDS-PAGE gel electrophoresis

[0215] (1) Prepare an appropriate concentration of SDS-PAGE gel according to the molecular weight of the target protein and store it at 4°C for later use. The SDS-PAGE gel preparation kit is manufactured by Beyotime, and the product number is P0012A.

[0216] (2) Remove the sample from -80℃ and thaw at 4℃. Vortex mix before loading the sample.

[0217] (3) Load 10 μL of sample (protein concentration 1 μg / μL) for each group. Add an equal volume of pre-stained marker (Thermo Fisher Scientific, 26616) to both sides of the sample lane.

[0218] (4) Run electrophoresis at a constant voltage of 80V for about 20-30 minutes to allow the protein to enter the separating gel. Then adjust the voltage to 100V and continue electrophoresis. Stop electrophoresis when the marker reaches the bottom of the separating gel.

[0219] 3. Transfer membrane

[0220] (1) Cut the membranes to the following size order: PVDF membrane > filter paper > gel. Activate the PVDF membrane with methanol for 10 seconds until it becomes transparent, then soak it together with the filter paper in the transfer solution. The soaking time should be about 5 minutes.

[0221] (2) On the semi-dry transfer apparatus, place the filter paper, PVDF membrane, gel, and filter paper from bottom to top. Use a glass rod to remove air bubbles from the middle of the filter paper to both sides, and finally connect the power supply. The transfer voltage and time are approximately 25V and 20min.

[0222] 4. Immunoblotting of the target protein

[0223] (1) Place the membrane face up in TBST containing 5% skim milk powder / BSA and seal at room temperature for 1-2 hours.

[0224] (2) Wash the sealed membrane three times with TBST, 5 min each time. Cut the membrane according to the size of the pre-stained marker and the target protein and mark it accordingly.

[0225] (3) Transfer the membrane into the primary antibody incubation box for incubation (primary antibody concentration 1:1000) at 4°C overnight.

[0226] (4) The next day, remove the strip. Wash with TBST 3 times, 10 minutes each time.

[0227] (5) Add an appropriate concentration (1:5000) of horseradish peroxidase (HRP) labeled secondary antibody, incubate at room temperature for 1-2 hours, and gently shake on a decolorizing shaker.

[0228] (6) Wash with TBST 3 times (10 min / time).

[0229] (7) The ECL luminescence color development method was used, with the ratio of luminescent solution A to solution B being 1:1. The PVDF membrane was drained off the filter paper and then placed in a developing instrument for development.

[0230] (8) Quantitative analysis was performed using Image-J.

[0231] (vi) Detection of superoxide dismutase (SOD) in organoids

[0232] The protein supernatant was thawed at 4℃, and the protein concentration was determined by the BCA method. The SOD detection kit (Nanjing Jiancheng, A001-3-2) was then tested according to the instructions.

[0233] When the SOD inhibition rate reaches 50%, the corresponding enzyme amount is 1 unit of SOD activity (U). SOD inhibition rate: (A... 对照 -A 对照空白 )-(A 测定 -A 测定空白 )÷(A 对照 -A 对照空白 )

[0234] SOD activity (U / mgprot) = SOD inhibition rate ÷ 50% × reaction system dilution factor ÷ protein concentration of the sample to be tested (mgprot / mL)

[0235] (vii) RT-PCR detection of changes in IL6 / IL8 / TNFα in organoids of each group

[0236] Includes the following steps:

[0237] (1) The organoids were washed three times with pre-cooled PBS. The organoids were cut into small pieces with scissors, and RNA was extracted according to the Novizan FastPure Cell / Tissue Total RNA Isolation Kit (RC101) RNA extraction kit and stored at -80°C.

[0238] (2) Take 10 μL of each RNA sample and use NanoDrop 2000 to perform nucleic acid quantification, with RNase-free ddH2O as a Blank control.

[0239] (3) Using the Novozymes kit III. RT SuperMix for qPCR (+gDNA wiper) was used for RNA reverse transcription. Based on the nucleic acid quantification results of each sample, approximately 500 ng of RNA was added to each tube. RNA was then mixed with RNase-free ddH2O to a final volume of 16 μL. 4 μL of gDNA wiper mix was added and the mixture was pipetted in at 42°C for 2 min. 16 μL of the previous reaction solution was then added to 4 μL of Hiscript qRT supermix to form a 20 μL system. Reverse transcription was then performed at 37°C for 15 min followed by 85°C for 5 seconds. The reverse transcription product was stored at -80°C.

[0240] (4) Dilute cDNA 5-fold. Take 8 μL of cDNA from each tube and add 32 μL of ddH2O, for a total volume of 40 μL. Prepare the reaction mixture: 10 μL of SYBR qPCR master mix, 0.6 μL of forward primer, and 0.6 μL of reverse primer. Prepare 40 tubes for each primer set and aliquot them into each well. Add 8.8 μL of the corresponding diluted cDNA to each well. Reaction conditions: 95℃ for 30 seconds; 95℃ for 10 seconds, 60℃ for 30 seconds; 40 cycles; 95℃ for 15 seconds, 60℃ for 60 seconds, 95℃ for 15 seconds. Detect using the PCR machine.

[0241] (5) Primers for internal reference and target genes were designed using PrimerBank. The following table shows the primer sequences for the genes.

[0242] Table 1 Primer sequences of the target gene

[0243] Gene Name Forward Primer (5' to 3') Reverse Primer (5' to 3') GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG IL-6 ACTCACCTCTTCAGAACGAATTG CCATCTTTGGAAGGTTCAGGTTG TNF-α CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG IL-8 TTTTGCCAAGGAGTGCTAAAGA AACCCTCTGCACCCAGTTTTC

[0244] (viii) Statistical Analysis

[0245] Data were analyzed using SPSS 26.0 statistical software. Experimental results are expressed as mean ± standard error (±SEM). When data conformed to a normal distribution and had homogeneous variances, one-way ANOVA was used for comparisons between groups, and the LSD test was used for pairwise comparisons between groups. When data did not conform to a normal distribution or had unequal variances, nonparametric tests were used. The Kruskal-Wallis test was used for pairwise comparisons between groups. A p-value < 0.05 was considered statistically significant. Graphpad Prism 8.0 was used for plotting and representing the data.

[0246] II. Experimental Results

[0247] 1. Effects of UVB irradiation on β-galactosidase activity in tissue-engineered skin organoids

[0248] β-galactosidase is a biomarker of senescent cells, and changes in β-galactosidase activity reflect the dynamic process of cellular senescence.

[0249] Tissue-engineered skin organoids treated with UVB irradiation were fixed, sectioned, stained with β-galactosidase, and observed under an optical microscope. Figure 22 The results showed that the control group had almost no blue staining. In the UVB group, the keratinocyte layer and basal layer were blurred and unclear compared to the control group, and the blue staining was more pronounced.

[0250] 2. Effects of UVB irradiation on the expression of TNF-α, IL-6, and IL-8 in tissue-engineered skin organoids

[0251] Tissue-engineered skin organoids treated with UVB irradiation were fixed, sectioned, and stained with immunofluorescence. The expression of TNF-α, IL-6, and IL-8 was observed under a confocal microscope. Immunofluorescence results showed ( Figure 23 TNF-α, IL-6, and IL-8 were expressed very little or almost not at all in the control group, but their expression increased in the UVB group.

[0252] In addition, RNA was extracted, quantified, reverse transcribed, and RT-PCR was performed on the organoids, and the ΔCt values ​​of each group were compared. The results showed ( Figures 24-26 The levels of TNF-α, IL-6, and IL-8 mRNA in the UVB-treated group were higher than those in the control group.

[0253] 3. Effects of UVB irradiation on the expression of MMP-2 and cell cycle-related proteins p16 / p21 / p-p53 in tissue-engineered skin organoids

[0254] The organoids were subjected to protein extraction, quantification, electrophoresis, transfer, development and quantification, and the relative gray values ​​of the organoid proteins in each group were compared.

[0255] The results show ( Figures 27-28 The expression levels of MMP-2 and cycle-related proteins p16 / p21 / p-p53 in the UVB-treated group were significantly higher than those in the control group.

[0256] 4. Effects of UVB irradiation on SOD production in tissue-engineered skin organoids

[0257] The results are as follows Figure 29 As shown, compared with the control group, the UVB group had reduced SOD production.

[0258] III. Experimental Conclusions

[0259] Tissue-engineered skin organoids treated with UVB irradiation showed increased aging-related secretory phenotypes such as TNF-α, IL-6, IL-8, and MMP-2, inhibited SOD production, and upregulated expression of cycle-related proteins p16 / p21 / p-p53, making them suitable as a photoaging model for skin organoids.

[0260] The above are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. A method for constructing tissue-engineered skin organoids, characterized in that, Includes the following steps: (1) iPSCs were induced to differentiate and cultured for 85-100 days to construct primary skin organoids; (2) Section the decellularized pig skin, and the section thickness is 90~110 μm to obtain decellularized pig skin sections; (3) Dissect the primary skin organoids, remove the tail composed of dense opaque cell clusters, and cut open the transparent sac-like structure. Then, inoculate it onto decellularized porcine skin sections with the epidermis facing up and the dermis facing down to obtain the complex. (4) The complex is cultured at the gas-liquid interface for 10 to 21 days to obtain tissue-engineered skin organoids.

2. The construction method according to claim 1, characterized in that, Step (1) includes the following steps: S1. iPSCs were suspended in E8 medium containing 20 μM Y27632, then seeded on a cell culture device, centrifuged at 110 g for 6 min, and then incubated in a 37°C, 5% CO2 incubator for 24 h; then E8 medium was added and cultured for another 24 h to obtain cell aggregates. S2, Day 0 of differentiation induction: Cell aggregates were collected and induced to differentiate using E6 medium containing 2% Matrigel, 10 μM SB431542, 4 ng / mL bFGF and 2.5 ng / mL BMP4. S3, Day 3 of induced differentiation, add E6 medium containing 200 ng / mL LDN-193189 and 250 ng / mL bFGF; S4. On day 6 of induced differentiation, add E6 medium, and on days 8 and 10, perform a half-volume medium replacement with E6 medium. S5. On day 12 of induced differentiation, cell aggregates were collected, and skin organoid maturation medium containing 1% Matrigel was added. The cells were placed on a shaker and cultured at 5% CO2, 37°C, and 65 rpm. On day 15, half of the medium was replaced with skin organoid maturation medium containing 1% Matrigel. S6. From day 18 to day 45 of induced differentiation, half of the medium was replaced every 3 days with skin organoid maturation medium. S7. Starting from day 45 of induced differentiation, replace half of the medium with skin organoid maturation medium every 2 days, and replace the entire medium with skin organoid maturation medium once a week. Culture until day 85-100 to obtain primary skin organoids.

3. The construction method according to claim 1 or 2, characterized in that, The method for culturing the complex at the gas-liquid interface in step (4) includes the following steps: The complex was added to the Transwell chamber, and then skin organoid maturation medium was added to form an air-liquid culture interface. During the culture process, a complete medium replacement was performed every 3 days.

4. The construction method according to claim 3, characterized in that, The skin organoid maturation culture medium comprises: basal culture medium, 1×GlutaMax, 0.5×B-27 minus vitamin A, 0.5×N-2 supplement, 0.1 mM 2-mercaptoethanol, and 100 μg / mL normocin, wherein the basal culture medium is composed of advanced DMEM / F-12 and neurobasal culture medium in a volume ratio of 1:

1.

5. The construction method according to claim 4, characterized in that, The method for preparing the decellularized pigskin includes the following steps: (A1) Take pig skin, clean and sterilize it, freeze it at -80℃ for 4 hours, thaw it at room temperature, and repeat the freezing and thawing process 10 times; (A2) After the last thaw, the pig skin was placed in 2% SDS and shaken at 350 rpm at room temperature for 36 h; then the pig skin was removed and placed in 1% Triton X-100 containing 2% penicillin and streptomycin antibiotics and shaken at 350 rpm at room temperature for 12 h. (A3) Remove the pig skin and place it in a 4% sodium deoxycholate aqueous solution. Shake at 200 rpm and room temperature for 2 h. Remove the pig skin and wash it with distilled water, remove the protein with 3.4 M NaCl solution, remove the nucleic acid with a solution containing 10 μg / mL DNase and 5 μg / mL RNase, dry it, and sterilize it to obtain the product.

6. Tissue-engineered skin organoids prepared by the construction method according to any one of claims 1 to 5.

7. The application of tissue-engineered skin organoids according to claim 6 in disease model construction, drug screening, and toxicity testing.

8. The use of the tissue-engineered skin organoids according to claim 6 in the preparation of drugs for treating skin damage and promoting skin repair and regeneration.

9. A method for preparing a UVB-induced skin organoid aging model, characterized in that, Includes the following steps: Take the tissue-engineered skin organoids described in claim 6, add them to PBS buffer, irradiate with UVB for 5-10 min, then add skin organoid maturation culture medium and continue culturing for 24 h to obtain the product.

10. The preparation method according to claim 9, characterized in that, The UVB irradiation wavelength was 302 nm and the intensity was 900 μW / cm. 2 .

11. A UVB-induced skin organoid aging model prepared by the preparation method according to claim 9 or 10.

Citation Information

Patent Citations

  • Novel method for constructing tissue engineering skin

    CN102462864A

  • KR20240043723A