Sclerotinia sclerotiorum gene SsVSP19 related to pathogenicity and application

Abstract

The invention discloses a pathogenicity-related sclerotinia sclerotiorum gene SsVSP19 and application thereof, and belongs to the technical field of microbial genetic engineering, the pathogenicity-controlling gene SsVSP19 from sclerotinia sclerotiorum provided by the invention has a DNA sequence as shown in SEQ ID No: 1, and consists of 1298 nucleotides; the amino acid sequence of the protein coded by the provided SsVSP19 gene is as shown in SEQ ID No: 2, and the protein consists of 332 amino acids; the SsVSP19 gene can be applied to the field of plant sclerotinia sclerotiorum gene engineering. The gene SsVSP19 for controlling pathogenicity of sclerotinia sclerotiorum is knocked out, so that the pathogenicity of the gene SsVSP19 has defects, and the gene SsVSP19 can be applied to reducing the pathogenicity of sclerotinia sclerotiorum.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial genetic engineering, and in particular relates to the application of genes for controlling fungal pathogenicity and encoded proteins thereof in the field of plant protection. Background Art

[0002] Sclerotinia sclerotiorum (Lib) de Bary belongs to the phylum Ascomycota, is a type of worldwide plant pathogen, and is a typical necrotrophic plant pathogen. Sclerotinia sclerotiorum is extremely destructive and has a wide host range. It can infect important economic crops such as soybean, rapeseed, and sunflower to cause sclerotinia disease, which is a major global disease with strong epidemicity, wide distribution, and serious damage. Soybean Stem Rot is the main disease affecting its development, with a 20%-30% reduction in production in general years, and a 50% or more reduction in production in severely affected plots. In particular, with climate change and adjustments in planting structure, the occurrence and harm of soybean sclerotinia disease have increased. In the life history of Sclerotinia sclerotiorum, sclerotia, ascocarps, and infection pads are the most important fruiting bodies, and their development determines the occurrence, prevalence, and degree of harm of sclerotinia disease.

[0003] The infection of Sclerotinia sclerotiorum to plants can be divided into two stages. In the first stage, the hyphae contact the plant epidermis, and the hyphae tips differentiate to form infection pads, and then form infection spikes, and penetrate the cuticle of the host epidermis by generating mechanical pressure and secreting cutinase, and then form bulbous subcutaneous hyphae. In the second stage, the subcutaneous hyphae continue to expand under the plant cuticle, and then differentiate to form subcutaneous infection hyphae. The infection hyphae kill host cells by secreting oxalic acid, toxins, cell wall degrading enzymes, effector proteins and some virulence-related secreted proteins, causing plant tissue necrosis and death of the host plant.

[0004] For many years, chemical fungicides have been widely used as the main tool to control Sclerotinia due to limited genetic resources for crop breeding programs. However, the long-term use of chemical fungicides not only leads to the pollution of the agricultural ecological environment and the destruction of the ecological balance, but also leads to the development of Sclerotinia resistance and the presence of chemical residues in stored products. Therefore, exploring the growth, development and pathogenic mechanism of Sclerotinia on a molecular basis can provide us with new directions for the prevention and control of Sclerotinia.

[0005] Sclerotinia has long been considered a necrotrophic fungus, but more and more studies have shown that it is actually a semi-biotrophic fungus. During the short biotrophic stage, Sclerotinia suppresses plant immunity and promotes infection by secreting effector proteins. It is predicted that there are nearly 100 candidate effector proteins in Sclerotinia. Effector proteins play a key role in the pathogenicity of Sclerotinia. Identifying the target of effector proteins in plants will help understand the interaction mechanism between plants and Sclerotinia, which is conducive to the breeding of disease-resistant varieties. Summary of the invention

[0006] The purpose of the present invention is to provide a gene for controlling pathogenicity and a protein encoded by the gene. The secretory protein SsVsp19 involved in the present invention does not affect the nutritional growth and sclerotia formation of Sclerotinia sclerotiorum, nor does it affect the formation of infection pads, but positively regulates the pathogenicity of Sclerotinia sclerotiorum.

[0007] The pathogenicity control gene provided by the present invention is derived from Sclerotinia sclerotiorum, and is named Virulence secretory protein 19 (SsVsp19). Its ID number in the Sclerotinia sclerotiorum reference genome is Ss_cle05g042460, and has the DNA sequence shown in SEQ ID No: 1 in the sequence table. The gene consists of 1298 nucleotides, including 5 exons, which are respectively located between nucleotides 1 to 217, nucleotides 271 to 338, nucleotides 395 to 593, nucleotides 672 to 1114, and nucleotides 1227 to 1297 at the 5' end of SEQ ID No: 1, and the total length of the coding region is 999 nucleotides.

[0008] The present invention provides a protein encoded by the SsVSP19 gene, which has an amino acid sequence shown in SEQ ID No: 2 in the sequence table, and the sequence consists of 332 amino acids.

[0009] The pathogenicity-controlling gene SsVSP19 from Sclerotinia sclerotiorum can be applied in the field of plant antibacterial sclerotinia genetic engineering.

[0010] The pathogenicity controlling gene SsVSP19 from Sclerotinia sclerotiorum can be knocked out to make its pathogenicity defective, which can be used to reduce the pathogenicity of Sclerotinia sclerotiorum.

[0011] The present invention proves that the deletion of the SsVSP19 gene leads to a significant reduction in the pathogenicity of Sclerotinia sclerotiorum, indicating that the SsVSP19 gene is a gene required for Sclerotinia sclerotiorum to cause crop sclerotinia disease. Therefore, clarifying its gene function and its interaction mechanism with the host can effectively control the occurrence of sclerotinia disease, that is, an important use of the SsVSP19 gene provided by the present invention is that the expression of the gene and the expression, modification and localization of the protein product encoded by it can be used as an important candidate target site for reducing the pathogenicity of Sclerotinia sclerotiorum. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Schematic diagram of the knockout strategy of SsVSP19 gene of Sclerotinia sclerotiorum (gene replacement by homologous recombination);

[0013] Among them: HYG is the hygromycin resistance gene, SsVSP19-LB / SsVSP1919-RB are the upstream and downstream fragments of the SsVSP19 gene respectively; primers SsVSP19-FP1 / RP1, SsVSP19-FP2 / RP2, M13R / NLC38, M13F / NLC37 are used to verify mutants;

[0014] Figure 2 This is the electrophoresis diagram of PCR verification of the SsVSP19 gene deletion mutant strain;

[0015] Among them: SsVSP19-FP1 / RP1, SsVSP19-FP2 / RP2, M13R / NLC38, M13F / NLC37 are the primers used, and the corresponding positions are shown in Figure 2 ; ΔSsvsp19-4 and ΔSsvsp19-5 are two independently obtained SsVSP19 gene deletion mutants, and WT is the wild-type strain UF-1;

[0016] Figure 3 This is the electrophoresis diagram of PCR verification of the SsVSP19 gene complemented strain;

[0017] Figure 4 It is a graph of the relative expression levels of the deletion mutant of the SsVSP19 gene, the complemented strain of the SsVSP19 gene and the wild-type strain UF-1 verified by real-time fluorescence quantitative PCR (qRT-PCR);

[0018] Figure 5 Comparative photos of the culture characteristics of the SsVSP19 gene deletion mutant, the SsVSP19 gene complementation strain and the wild-type strain UF-1;

[0019] Among them: the culture medium used was PDA, cultured at 25°C, and observed and photographed at 12h, 36h, 48h, and 14d after inoculation; WT was the wild-type strain UF-1 of Sclerotinia sclerotiorum, and ΔSsvsp19-4 and ΔSsvsp19-5 were two independently obtained SsVSP19 gene deletion mutants.

[0020] Figure 6 A chart showing the quantitative analysis of the colony sizes formed by the deletion mutant of the SsVSP19 gene, the complemented strain of the SsVSP19 gene and the wild-type strain UF-1;

[0021] Among them: the tested strains and culture conditions are the same as above, the colony diameter is measured for the same time as above, and converted into relative size. ** indicates significant difference at the p<0.01 level.

[0022] Figure 7A chart showing the quantitative analysis of the dry weight of sclerotia formed by the deletion mutant of the SsVSP19 gene, the complemented strain of the SsVSP19 gene and the wild-type strain UF-1;

[0023] Figure 8 Comparative photos of the infection pads of the SsVSP19 gene deletion mutant, the SsVSP19 gene complemented strain and the wild-type strain;

[0024] Wherein: the bacterial cake (mycelium side facing downward) was inoculated on a glass slide, placed in a humidified box, cultured in a dark incubator at 25°C, and the infected pad was photographed at 6h, 12h, 24h, and 48h;

[0025] Fig. 9 It is a graph of quantitative grayscale analysis of the infection pad of the SsVSP19 gene deletion mutant, the SsVSP19 gene complemented strain and the wild-type strain;

[0026] Among them: the culture method is the same as above, and the time points for quantitative analysis of the gray scale of the infected pad are the same as above;

[0027] Fig.10 The photos are comparisons of pathogenicity between the SsVSP19 gene deletion mutant, the SsVSP19 gene complemented strain and the wild-type strain;

[0028] The selected hosts were Arabidopsis thaliana, soybean William 82 (W82), soybean Jidou 1, and oil bean. The detached leaves were inoculated with bacterial cakes, and the evaluation was performed at multiple time points after inoculation. WT was the wild-type strain UF-1 of Sclerotinia sclerotiorum, and ΔSsvsp19-4 and ΔSsvsp19-5 were two independently obtained SsVSP19 gene deletion mutants.

[0029] Fig.11 It is a quantitative analysis of the size of lesions produced by the mutant and control strains of the SsVSP19 gene infecting the host;

[0030] Among them: the tested strains and inoculation methods are the same as above, and the leaf spot area is measured and calculated at multiple time points after inoculation to compare the pathogenicity of each strain. *** indicates significant difference at the p<0.001 level. DETAILED DESCRIPTION

[0031] The present invention is described below in conjunction with the accompanying drawings. The methods in the following embodiments are all conventional methods unless otherwise specified.

[0032] Example 1 Knockout of SsVSP19 gene

[0033] 1) Homologous recombination of target gene

[0034] by

[0035] SsVsp19-FP1 (5'-CTTACACCGAATCGCTGAAG-3'), SsVSP19-RP1 (5'-TCCTGTGTGAAATTGTTATCCGCTT GTTGGAACCGAAACCTCA-3'), SsVSP19-FP2 (5'-GTCGTGACTGGGAAAACCCTGGCGGTTATGTGAGGGAGGCGG A-3'), SsVSP19-RP2 (5'-GGACACGGGTAGATATGTGATG-3'), using the genomic DNA of Sclerotinia sclerotiorum UF-1 as a template, amplified 800-1000bp fragments upstream and downstream of the gene, respectively, and fused with the hygromycin resistance gene (HYG) using the Split-marker technology method, and then transferred into the protoplasts of Sclerotinia sclerotiorum UF-1.

[0036] Perform PCR detection according to the reaction in Table 1 and the procedure in Table 2:

[0037]

[0038]

[0039] The Sclerotinia sclerotiorum UF-1 used in the present invention was kindly donated by Professor Jeffrey A. Rollins of the University of Florida, USA.

[0040] 2) Transformation of Sclerotinia sclerotiorum

[0041] a. Preparation of Sclerotinia sclerotiorum protoplasts

[0042] Use an inoculation needle to pick up the wild type of Sclerotinia sclerotiorum (UF-1) stored at 4℃ on PDA solid medium, and activate and culture in a 25℃ incubator for 1-2 days. Use a sterile puncher to take an appropriate number of fresh mycelium cakes on the outer edge and inoculate them in YPSU liquid medium, culture at 25℃ for 2-3 days, remove the agar blocks on the white bacterial film, wash the bacterial film in sterile water 2-3 times, wash it once in 0.7M NaCl solution, cut the washed bacterial film into pieces in a sterilized culture dish with sterile scissors, and transfer it to a conical flask containing enzymatic solution (0.2g Driselase-crash enzyme, 0.2g cellulase, dissolved in 20mL 0.7M NaCl solution, fully mixed and dissolved with a magnetic stirrer, 7000rpm, centrifuged at room temperature for 5min, and filtered with a 45μm filter), and lyse at 25℃, 100rpm in the dark for 2-3h.

[0043] Filter the lysate with a cell sieve, add an equal volume of pre-cooled 0.7M NaCl solution, centrifuge at 4°C, 3000rpm for 5min, discard the supernatant, resuspend in 10mL STC, centrifuge at 3000rpm for 5min, discard the supernatant, and repeat this step once. Add appropriate amount of STC to resuspend so that the protoplast concentration is about 1×10 8 Pipette a small amount of the resuspension and dilute it tenfold, then observe the protoplast concentration under a microscope.

[0044] b. PEG3350-Cacl2-mediated genetic transformation of Sclerotinia sclerotiorum protoplasts

[0045] Add 15 μL of the left and right homologous fragments and 5 μL of sodium heparin to the prepared protoplasts, and place on ice in the dark for 20 minutes. Add 200 μL of PEG, pipette and mix, and place on ice for 10 minutes. Repeat once. Add 800 μL of PEG, pipette and mix, and incubate at 25°C for about 20 minutes.

[0046] c. Screening of Sclerotinia sclerotiorum transformants

[0047] Add the mixed solution to the Rm lower solid culture medium (59.9 g sucrose, 0.25 g hydrolyzed casein, 3.75 g agar, 0.25 g yeast extract powder), and culture it in a dark incubator at 25°C for 12-16 hours. Then, cover it with 10 mL of RM upper culture medium (34.2 g sucrose, 0.1 g hydrolyzed casein, 1 g agar, 0.1 g yeast extract powder) containing 60 uL hygromycin, and culture it in a 25°C incubator for 5-8 days. At this time, single hyphae can be observed emerging from the surface of the culture medium.

[0048] Pick a single hypha tip and inoculate it on a PDA solid plate containing HYG resistance. After 1 day, pick the hypha tip and screen it again. Repeat this step 4-6 times to obtain transformants. The obtained transformants are inoculated on a hygromycin PDA plate covered with cellophane. After the hyphae fill the culture medium, the transformant hyphae are collected and DNA is extracted for verification.

[0049] 3) Validation of deletion mutants

[0050] Four pairs of primers were selected to screen the transformants by PCR amplification. The amplification results that met the following results were determined to be SsVsp19 gene deletion mutants: the primer NLC37 (5'-GGATGCCTCCGCTCGAAGTA-3') of the hygromycin resistance gene was paired with the primer UF1 (5'-GGACGAGGAAGTTCAACAGA-3') on the genome outside the upstream homology arm to amplify the expected size (2.7 kb) of the recombinant fragment (no amplification band in the wild-type strain); the primer NLC38 (5'-CGTTGCAAGACCTGCCTGAA-3') of the hygromycin resistance gene was paired with the primer DR1 (5'-GGCACTCCCCTCGCATACCG-3') on the genome outside the downstream homology arm to amplify the expected size (2.8 kb) of the recombinant fragment (no amplification band in the wild-type strain); the primers M13F (CGCCAGGGTTTTCCCAGTCACGAC) and

[0051] M13R (AGCGGATAACAATTTCACACAGGA) can amplify a 2.7kb fragment (no amplification band in the wild-type strain); while the internal primers F (5'-ATGGTCTCGTCGCTTCCTGC-3') and R (5'-TCACTCACATAACACTGTA-3') in the coding region have no amplification band (the wild-type strain can amplify a 1kb fragment). RNA from the knockout mutant and UF-1 strain was extracted and reverse transcribed. The reverse transcribed cDNA was taken and the expression level of SsVsp19 was detected by real-time fluorescence quantitative PCR. After a series of verifications, two independent SsVSP19 gene deletion mutants were obtained: ΔSsvsp19-4 and ΔSsvsp19-5, which were used for subsequent functional analysis (see Figure 3 ).

[0052] Example 2 Effect of SsVSP19 gene on hyphal growth of Sclerotinia sclerotiorum

[0053] The plate culture method was used to evaluate the variation of mycelial growth and other related phenotypes of the SsVSP19 mutant. A sterile punch was used to punch out the bacterial cakes of the strain to be tested, and they were inoculated in the center of the PDA culture medium and cultured in the dark at 25°C. The mutants were observed at 12h, 36h, 48h, 7d, and 14d, respectively, and it was found that there were no significant differences in colony morphology, mycelial growth rate, and sclerotial morphology (see Figure 4 ). The above results show that the SsVSP19 gene has no effect on the growth and development of hyphae and the formation of sclerotia.

[0054] Example 3 Effect of the SsVSP19 gene on the formation of Sclerotinia sclerotiorum infection pads

[0055] The wet box dark culture method was used to evaluate the variation of infection pad formation of SsVSP19 mutants. Use a sterile puncher to punch out an appropriate amount of strain cake, inoculate the cake (mycelium side down) on a hydrophobic interface slide, place it in a wet box, and culture it in a 25℃ incubator in the dark. Grayscale analysis of the infection pad was performed at 6h, 12h, 24h, and 48h. The results showed that the infection pad formation and morphology of the strain with the SsVSP19 gene were not significantly different from those of the wild type of Sclerotinia sclerotiorum.

[0056] Example 4 Effect of SsVSP19 gene on pathogenicity of Sclerotinia sclerotiorum

[0057] The in vitro leaf inoculation method was used to evaluate the changes in the pathogenicity of the SsVSP19 mutant. Fresh leaves with uniform growth were placed in a black seedling tray. A hole puncher was used to punch out the bacterial cake of the strain to be tested. The leaves were inoculated face down on the leaves of Arabidopsis thaliana, soybean William 82 variety (W82), soybean Jidou No. 1 variety, and oil beans. Water was sprayed to keep them moist. The leaves were covered with a moisturizing cover to keep the humidity of the inoculation environment greater than 75%. The disease incidence of Arabidopsis thaliana was evaluated after 24 hours, and the disease incidence of soybean and oil beans was evaluated after 48 hours. The lesion area was calculated using Image J, and three biological replicates were performed. The experimental results showed that the lesion area of ​​the SsVSP19 mutant on different hosts was significantly smaller than that of UF-1 (see Figure 6 ). The results of this study indicate that SsVSP19 is a key pathogenic gene that is essential for S. sclerotiorum to infect the host. If this gene or the protein it encodes loses its activity, the ability of S. sclerotiorum to infect the host and cause disease will be greatly inhibited.

Claims

1. The use of the SsVSP19 gene in reducing the pathogenicity of Sclerotinia sclerotiorum, characterized in that: Specifically, the pathogenicity of Sclerotinia sclerotiorum to different hosts is reduced by knocking out the SsVSP19 gene, and the DNA sequence of the SsVSP19 gene is shown in SEQ ID No:1.

Images