Application of the PbeARF2 gene, an ARF-like transcription factor from Pyrus pyrifolia
By stably overexpressing the PbeARF2 gene, an ARF-like transcription factor in Pyrus pyrifolia, the problem of low iron absorption efficiency in plants under iron deficiency stress was solved, thereby improving the plant's resistance to iron deficiency and its iron absorption capacity, and promoting the improvement of plant varieties.
Patent Information
- Application Number
- CN202510200242.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-24
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2045-02-24
AI Technical Summary
The lack of existing technologies on the function of the plant ARF2 gene under iron deficiency stress leads to low iron absorption efficiency in plants under iron deficiency conditions, making it impossible to effectively improve the iron deficiency resistance of plant varieties.
Biological experiments were conducted to verify that the PbeARF2 gene, an ARF-like transcription factor from Pyrus pyrifolia, and its encoded protein were stably overexpressed in plants, which improved the plant's resistance to iron deficiency stress, promoted root acidification and iron reductase activity, and enhanced leaf chlorophyll content.
It significantly improved the iron absorption capacity of transgenic plants under iron-deficient conditions, enhanced root acidification and iron reductase activity, and increased leaf chlorophyll content, laying the theoretical foundation for the improvement of highly iron-deficient plant varieties.
Smart Images

Figure CN119899867B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, and in particular to the application of the PbeARF2 gene, an ARF-like transcription factor from Pyrus pyrifolia. Background Technology
[0002] Auxin response factors (ARFs) are an important class of transcription factors in the auxin signaling pathway. A typical ARF protein contains three conserved domains: an N-terminal DNA-binding domain (DBD), a middle region (MR), and a C-terminal interaction domain (CTD). These conserved domains are also present at the C-terminus of Aux / IAA and participate in protein-protein interactions through interactions with the auxin / indoleacetic acid (Aux / IAA) family dimer and ARFs. At low auxin levels, Aux / IAA proteins in plants interact with ARF proteins, preventing ARFs from effectively regulating downstream target genes and thus shutting down the auxin signaling pathway. Conversely, when auxin levels increase, the binding of auxin receptors to auxin in plants is enhanced. This binding promotes a tighter association between the receptor and Aux / IAA proteins, enabling them to participate in synergistic effects across multiple auxin transduction pathways.
[0003] Studies have shown that there is crosstalk between iron deficiency signals and auxin signals, and auxin response factor (ARF) genes play a crucial role in plant iron uptake. For example, the ARF double knockout mutant arf7arf19 typically does not cause delayed lateral roots (LRs), but under iron deficiency conditions, the number of LRs further increases, thus affecting iron uptake in Arabidopsis thaliana (Vandna Raie et al., 2015). Compared with the wild type, the OsARF16 mutant can enhance the iron deficiency resistance of rice under iron deficiency conditions (Shen et al., 2015). Knocking out OsARF12 also alters the abundance of mitochondrial regulation (OsMIR), iron (Fe) regulatory transporter 1 (OsIRT1), and postembryonic short root 1 (OsSPR1) in rice roots, leading to a decrease in root iron content (Qi et al., 2011). Due to the large number of plant auxin response factor (ARF) genes, there are currently no reports on the role of plant ARF2 genes in the regulation of iron deficiency in plants. Summary of the Invention
[0004] The purpose of this invention is to provide an application of the PbeARF2 gene, an ARF-type transcription factor in *Pyrus pyrifolia*, to address the problems existing in the prior art. This invention, through biological experiments, demonstrates for the first time the function of the PbeARF2 gene and its encoded protein in promoting iron absorption in plants under iron deficiency stress, laying a theoretical foundation for plant variety improvement and the creation of plant varieties with high iron deficiency resistance.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides the application of the PbeARF2 gene, an ARF-like transcription factor from *Pyrus pyrifolia*, or related biological materials in any of the following:
[0007] 1) Improve plant resistance to iron deficiency stress;
[0008] 2) The degree to which plant roots become acidified;
[0009] 3) Increase the activity of ferric reductase in plants under iron deficiency stress;
[0010] 4) Cultivate plant varieties with high resistance to iron deficiency stress;
[0011] 5) Increase the chlorophyll content in plant leaves under iron deficiency stress;
[0012] The nucleotide sequence of the PbeARF2 gene is shown in SEQ ID NO.1.
[0013] Optionally, the relevant biological materials include the protein encoded by the PbeARF2 gene, a recombinant plasmid containing the PbeARF2 gene, and a recombinant microorganism containing the recombinant plasmid.
[0014] Optionally, the protein encoded by the PbeARF2 gene has the amino acid sequence shown in SEQ ID NO.2.
[0015] Optionally, the plants include Arabidopsis thaliana and Pyrus pyrifolia.
[0016] The present invention also provides a method for improving the resistance of plants to iron deficiency stress, comprising the step of using genetic transformation technology to stably overexpress the PbeARF2 gene in the plant to improve the plant's resistance to iron deficiency stress.
[0017] Optionally, the plants include pear and Arabidopsis thaliana.
[0018] The present invention also provides a method for cultivating plants with high resistance to iron deficiency stress, comprising the step of using genetic transformation technology to stably overexpress the PbeARF2 gene in the plant to obtain transgenic plants with high resistance to iron deficiency stress.
[0019] Optionally, the plants include pear and Arabidopsis thaliana.
[0020] The present invention discloses the following technical effects:
[0021] This invention, through biological experiments, demonstrates for the first time the function of the PbeARF2 ARF transcription factor gene and its encoded protein in promoting iron uptake in *Pyrus pyrifolia* under iron deficiency stress. Transforming *Arabidopsis thaliana* and *Pyrus pyrifolia* with this gene, this invention found that plants stably overexpressing this gene significantly promoted iron uptake in transgenic plants under iron deficiency conditions. Simultaneously, it also significantly increased root acidification and the activity of iron reductase (FCR) in transgenic plants. This invention lays a theoretical foundation for plant variety improvement and the creation of plant varieties with high iron deficiency resistance. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 The graph shows the relative expression level of the PbeARF2 gene under iron deficiency treatment in Example 2. Pear seedlings were treated with iron deficiency for 0, 6, 12, 24 and 48 hours, and the expression level of the PbeARF2 gene at each time point of iron deficiency treatment was analyzed.
[0024] Figure 2 Phenotypic images of Arabidopsis thaliana seedlings overexpressing PbeARF2 in Example 4 in MS medium with normal iron content (+Fe) and iron deficiency (-Fe), where PbeARF2-OE-1 and PbeARF2-OE-2 represent two overexpressing transgenic lines, and WT is wild type;
[0025] Figure 3 The results of FCR (ferric reductase) activity detection (A) and data statistics (B) of transgenic Arabidopsis thaliana lines (PbeARF2-OE-1, PbeARF2-OE-2) and wild-type material (WT) in +Fe and -Fe culture in Example 4 are shown.
[0026] Figure 4 The chlorophyll content of transgenic Arabidopsis thaliana lines (PbeARF2-OE-1, PbeARF2-OE-2) and wild-type material (WT) in Example 4 under +Fe and -Fe culture conditions;
[0027] Figure 5 The phenotypic diagrams of PbeARF2 overexpressing *Pyrus pyrifolia* cultured under normal iron content (+Fe) and iron deficiency (-Fe) conditions in Example 5 are shown. PbeARF2-OE-1 and PbeARF2-OE-2 represent two overexpressing transgenic lines, and WT represents the wild type.
[0028] Figure 6 The chlorophyll content of transgenic pear lines (PbeARF2-OE-1, PbeARF2-OE-2) and wild-type material (WT) in Example 5 under +Fe and -Fe culture conditions;
[0029] Figure 7 The image shows the phenomena observed in Example 5 when transgenic pear lines (PbeARF2-OE-1, PbeARF2-OE-2) and wild-type material (WT) were cultured in medium supplemented with bromocresol purple pH indicator under normal iron content (+Fe) and iron deficiency (-Fe) conditions.
[0030] Figure 8 The results (A) and statistical data (B) for detecting FCR (ferric reductase) activity in transgenic pear lines (PbeARF2-OE-1, PbeARF2-OE-2) and wild-type material (WT) under +Fe and -Fe cultures in Example 5 are shown. Detailed Implementation
[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0032] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0033] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0034] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0035] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0036] Example 1: Obtaining the PbeARF2 gene
[0037] Young pear leaves were ground into powder in liquid nitrogen, and the RNA extraction kit was prepared according to the instructions. After obtaining RNA, cDNA was synthesized using a cDNA reverse transcription kit and stored at -20°C.
[0038] Based on the coding sequence of the PbeARF2 gene in *Pyrus pyrifolia*, specific upstream and downstream amplification primers P1 and P2 were designed using Primer Premier 5 software.
[0039] Upstream amplification primer P1: ATGACGTCATCGGAGGTTTC (SEQ ID NO.3),
[0040] Downstream amplification primer P2: CTATGCATATGGAAGTGGTTGAG (SEQ ID NO.4).
[0041] Using cDNA from *Pyrus pyrifolia* as a template, the PbeARF2 gene was amplified by PCR using DNA polymerase. The amplification system consisted of 25 μL DNA polymerase, 2 μL cDNA, 2 μL upstream primer, 2 μL downstream primer, and 19 μL sterile water. The amplification conditions were: 95℃ pre-denaturation for 1 min, 95℃ denaturation for 15 s, 60℃ annealing for 15 s, and 72℃ extension for 40 s, for 35 cycles; followed by a final extension at 72℃ for 1 min. The amplified products were detected by agarose gel electrophoresis. After detection, the gel was excised and recovered. The recovered products were sequenced by a sequencing company to obtain the complete sequence of the amplified product. The nucleotide sequence of the amplified PbeARF2 gene is shown in SEQ ID NO.1.
[0042]
[0043] The amino acid sequence encoded by the PbeARF2 gene is shown in SEQ ID NO.2:
[0044] MTSSEVSIRDNCGNQRGETFSSGFSDHNDARNAGEGHNGRSTVSAAGRDAETALYTELWHACAGPLVTVPRERELVFYFPQGHIEQVEASTNQVADQQMPVYNLPSKILCRVINVSLKAEPDTDEVFAQVTLLPESNQDENAVEKEPPPPPPPRFQVHSFCKTLTASDTSTHGGFSVLRRHADECLPPLDMSRQPPTQELGAKDLHGNEWRFRHIFRGQPRRHLLQSGWSVFVSSKRLVAGDAFIFLRGENGELRVGVRRAMRQQGSVPSSVISSHSMHLGVLATAWHAIITGTMFTVYYKPRTSPAEFIVPFDQYMESVKNNYSIGMRFKMRFEGEEAPEQRFTGTIIGMEDADTKRWRDSKWRCLKVRWDETSTIPRPERVSPWKIEPALAPPAVNPLPMPRPKRSRTNMVPSSPDSSVLTREVGLSKANVDPVMPGGFSRVLQGQELPTLRASFAESESDTAEKSVAWPPSMDEEKIDGVCASRRYGSENWMSSVRHEPTYTDLLSGFGNNGDSSNGICPPFVDQGVVSSNSMRKHSLDKEGKYNLHSWSVLPSSLSLSLDSNQKGRLGNKSYQAQGNSRYGGFGESSVMNGQRVEHPHGNWMMPPPPSPFENLANAREIVPRPQMLLDKHEAVKPKDGNYKLFGIPLITPDPALSHRNAMNESPRNNQAHTFESDLKSEKSRGSKSIDNPMAVSEPALQISQQHTRDAQGKSQGGSTRSCTKVHKQGIALGRSVDLTKFNNYEELIAELDMLFEFGGELMSPKKNWMIVYTDDEGDMMLVGDDPWQEFCSIVRKIFIYTREEVQKMNPGTLNAHGEDNLSLGAEGVDARVGKSQPLPYA(SEQ ID NO.2).
[0045] Example 2 Expression analysis of the PbeARF2 gene
[0046] Tissue culture seedlings of rooted *Pyrus pyrifolia* were selected and subjected to iron deficiency treatment after their growth stabilized. Samples were taken at 0h, 6h, 12h, 24h, and 48h after treatment, and quickly frozen in liquid nitrogen and stored at -80℃. Total RNA was then extracted from the samples using an RNA extraction kit and reverse transcribed into cDNA.
[0047] Quantitative primers P3 and P4 were designed based on the PbeARF2 sequence;
[0048] P3: CCGACCTTGAGAGCCAGTTTT (SEQ ID NO.5);
[0049] P4: ACCATTATTCCCGAAGCCTGA (SEQ ID NO. 6).
[0050] Using the *Pyracantha fortuneana* internal reference gene Actin as a control, the reaction system was prepared according to the kit instructions, with each reaction repeated three times. The reaction program on the StepOne Real-time PCR System was set as follows: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 15 s, 60℃ annealing for 15-20 s, and 72℃ extension for 20-30 s, for 40 cycles. -ΔΔCT The calculation method was used to analyze and calculate the results of quantitative fluorescence. The results showed that the expression level of PbeARF2 was highest at 6 hours after iron deficiency treatment (e.g., Figure 1 (As shown).
[0051] Example 3 Construction of overexpression vector for PbeARF2 gene
[0052] The PbeARF2 gene was constructed into an overexpression vector, and two restriction enzyme sites, KpnI and BamHI, were selected on the overexpression vector pCAMBIA1305. PbeARF2 primers were then designed, with corresponding vector homologous sequences added before and after the primers. The primers are as follows:
[0053] P5: acggaattcgagctcggtaccATGACGTCATCGGAGGTTT (SEQ ID NO.7);
[0054] P6: caggtcgactctagaggatccTTATCGAAACCTCCGATGAC (SEQ ID NO. 8).
[0055] The pCAMBIA1305 vector was double-digested using two restriction endonucleases, KpnI and BamHI, to obtain a linearized vector.
[0056] Using pear leaf cDNA as a template, the complete coding sequence of PbeARF2 was amplified using primers P1 and P2. The cDNA was recovered using a kit, linearized, and then ligated into a vector to obtain the pCAMBIA1305-PbeARF2 overexpression vector, which was transformed into *E. coli* (DH5α) competent cells. The ligation product was then placed on ice for 5 min, followed by incubation in a 42°C metal bath for 1 min, and then on ice again for 10 min. Antibiotic-free LB medium was then added to the tubes, and the tubes were incubated at 37°C with shaking for 1 h. Bacterial cells were then collected and plated on plates containing the corresponding antibiotics. After 12 h, single colonies were picked and propagated in liquid LB medium containing the same concentration of kanamycin sulfate. PCR and agarose gel electrophoresis were used to detect the presence of the target band for further sequencing. After successful sequencing alignment, 50% glycerol was added, and the cells were stored at -80°C.
[0057] Example 4: Arabidopsis genetic transformation and screening
[0058] Transgenic Arabidopsis thaliana was obtained using Agrobacterium-mediated inflorescence infection. Arabidopsis plants in full bloom were selected, and excess flower pods were removed, leaving only flower buds. Infection solutions were then prepared; MS liquid medium was supplemented with sucrose (final concentration 30 g / L) and Silwet L-77 (final concentration 200 μl / L). Agrobacterium tumefaciens containing the PbeARF2 overexpression vector was activated and cultured to OD200. 600 =0.8~1.0. Centrifuge Agrobacterium, discard the supernatant, and resuspend the Agrobacterium precipitate in the infection solution. Then, completely immerse the Arabidopsis inflorescence in the infection solution for 60 seconds. After infection, completely wrap the flower with plastic wrap to retain moisture and incubate in the dark for 1 day. Remove the plastic wrap the next day, and reinfect after 5-6 days. Wash the seeds, dry them, and sow them evenly on a selection medium containing hygromycin. Incubate in a light incubator. After the seedlings have grown 2-3 true leaves, extract leaf DNA from the seedlings with normal growth and well-developed root systems for identification. Positive plants are designated as T0 plants. Harvest T0 generation seeds. Continue to plant the obtained positive lines and harvest seeds from each plant.
[0059] (1) Identification of iron deficiency resistance (MS medium method): Take an appropriate amount of transgenic Arabidopsis seeds and wild-type seeds into 2mL centrifuge tubes, wash the seeds, air dry them, and then sow them into normal MS and iron-deficient MS solid medium. Incubate normally at 28℃ in a light incubator and observe phenotypic differences. Throughout the growth process, MS plates are placed vertically.
[0060] After two weeks of growth on the culture medium, the degree of leaf yellowing varied among different plant lines. The results showed that on a medium with normal iron content, there was no significant difference in growth status and yellowing degree between wild-type and transgenic plants; however, on an iron-deficient medium, the leaves of Arabidopsis plants overexpressing PbeARF2 were significantly greener than those of wild-type plants (e.g., ...). Figure 2 (As shown).
[0061] (2) Determination of iron deficiency physiological indicators: FCR activity and chlorophyll content were analyzed in wild-type and PbeARF2-overexpressing Arabidopsis thaliana under normal and iron-deficient conditions, respectively. The results showed no significant differences in FCR activity in roots or chlorophyll content in leaves between PbeARF2-overexpressing Arabidopsis thaliana and wild-type Arabidopsis thaliana grown on medium with normal iron content. Figure 3 and Figure 4 Iron-deficient treatment resulted in significantly higher FCR activity in Arabidopsis roots overexpressing PbeARF2 compared to wild-type Arabidopsis roots (e.g., ...). Figure 3 (as shown); and, the chlorophyll content in the leaves of plants overexpressing PbeARF2 was significantly higher than that in wild-type plants (as shown). Figure 4 (As shown in the figure). This indicates that overexpression of PbeARF2 significantly promotes iron uptake in Arabidopsis plants under iron deficiency stress.
[0062] Example 5: Genetic transformation and iron deficiency treatment of Pyrus pyrifolia
[0063] Using the pCAMBIA1305-PbeARF2 overexpression vector constructed in Example 3, plasmids were extracted and transformed into Agrobacterium tumefaciens competent cells to obtain Agrobacterium rhizogenes successfully transformed with the PbeARF2 gene. Root transformation was performed on healthy, uniform pear seedlings for 2-3 weeks. Seedlings were obliquely cut from the base of the stem, and the treated seedlings were directly immersed in a glass beaker containing a suspension of Agrobacterium rhizogenes. The treated seedlings were then vacuum-sealed for 10 minutes. Finally, they were transplanted into soil and grown in a high-humidity environment at 25°C with a 16h / 8h day / night light cycle to obtain two transgenic pear plants, PbeARF2-OE-1 and PbeARF2-OE-2.
[0064] Iron deficiency resistance assessment: Two transgenic pear varieties, PbeARF2-OE-1 and PbeARF2-OE-2, and WT plants were cultured in iron-rich Hoagland nutrient solution for 7 days, followed by 5 days of further culture in an iron-deficient environment. Under iron-deficient conditions, although all plants retained some green leaves, the chlorosis of the leaves in the WT plants was more pronounced than that in the transgenic PbeARF2 line (e.g., ...). Figure 5 (As shown). Furthermore, this invention also measured chlorophyll content, and the results showed that under iron-deficient conditions, the chlorophyll content of the transgenic PbeARF2 line was still higher than that of the WT (as shown). Figure 6 (As shown).
[0065] Iron deficiency physiological indicators were measured: The treated plants were transferred to a medium supplemented with bromocresol purple, a pH indicator. Results showed that under iron-deficient conditions, the rhizosphere acidification of the transgenic PbeARF2 line was more pronounced than that of the WT line, which was visually evident from the yellowing of the medium around the rhizosphere (e.g., ...). Figure 7 (As shown). The relative FCR activity of transgenic PbeARF2-positive plants and WT plants was detected. The results showed that under iron-deficient conditions, the relative FCR activity of transgenic PbeARF2-positive plants was significantly higher than that of WT plants (as shown). Figure 8 (As shown).
[0066] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Application of overexpressing the PbeARF2 gene, a type of ARF transcription factor in *Pyrus pyrifolia*, or related biological materials in any of the following: 1) Improve plant resistance to iron deficiency stress; 2) Cultivate plant varieties with high resistance to iron deficiency stress; The nucleotide sequence of the PbeARF2 gene is shown in SEQ ID NO.1; The relevant biological material is a protein encoded by the PbeARF2 gene, the amino acid sequence of which is shown in SEQ ID NO.2; a recombinant plasmid containing the PbeARF2 gene; and a recombinant microorganism containing the recombinant plasmid. The plants mentioned are Arabidopsis thaliana and Pyrus pyrifolia.
2. A method for improving plant resistance to iron deficiency stress, characterized in that, The method includes the step of using genetic transformation technology to stably overexpress the PbeARF2 gene as described in claim 1 in the plant to improve the plant's resistance to iron deficiency stress; The plants mentioned are pear and Arabidopsis thaliana.
3. A method for cultivating plants highly resistant to iron deficiency stress, characterized in that, The method includes the step of using genetic transformation technology to stably overexpress the PbeARF2 gene as described in claim 1 in the plant to obtain a transgenic plant with high resistance to iron deficiency stress; The plants mentioned are pear and Arabidopsis thaliana.
Citation Information
Patent Citations
Pyrus betulaefolia bHLH transcription factor gene PbeHLH155 and application thereof
CN116836993A