High-throughput screening method for RNA splicing phenotype

Abstract

The invention relates to the technical field of gene engineering, in particular to a high-throughput screening method for RNA splicing phenotypes. The method comprises the following steps: constructing a reporter gene and a reporter gene vector, carrying out enzyme digestion on the reporter gene vector and sgRNA, constructing a reporter gene-sgRNA plasmid library, transferring into an HEK293T-CRISPRi cell line, screening and collecting mRNA, and carrying out next-generation sequencing to screen and regulate the sgRNA gene spliced by the reporter gene. The method comprises the following steps: constructing a reporter gene-sgRNA library, enabling reporter gene splicing information and sgRNA information to be on one mRNA, detecting the splicing form of the reporter gene mRNA through next-generation sequencing, determining the influence of a knock-down gene on reporter gene splicing, and determining a regulatory factor of a splicing event. The method avoids noisy points generated when splicing information is converted into protein signals, is high in sensitivity and resolution, and can be widely applied to genetic screening of various RNA splicing events.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a high-throughput screening method for RNA splicing phenotypes. Background Art

[0002] In eukaryotes, pre-mRNA splicing is one of the most critical regulatory steps in the post-transcription process. This process refers to the recognition of the boundaries between exons and introns, splicing sites, and short sequence branch points 18-40 nucleotides upstream of the splicing site polypyrimidine sequence at the 3' end of the intron by the spliceosome, removing introns from the transcribed pre-mRNA, retaining exons and forming mRNA. In the process of efficient transcription processing, specific sequences are also required to recruit different trans-acting regulatory factors, which will play an important role as regulatory factors for the selection of spliceosomes and splicing sites.

[0003] 40 years ago, researchers discovered that membrane-bound antibodies and secreted antibodies are encoded by the same gene, and reported the selective splicing of pre-mRNA for the first time. The number of proteins encoded by the gene was doubled through selective splicing. Although people once thought this was unreasonable, with the development of scientific research, reports of selective splicing of pre-mRNA to encode multiple proteins (or protein subtypes) have emerged one after another. Researchers have found that most human genes undergo selective splicing, producing multiple splicing isomers containing different exon combinations. The selective splicing of RNA has greatly increased the complexity of the genome of higher eukaryotes. At the same time, RNA splicing is tissue-specific. A common phenomenon found in recent studies is that the type of selective splicing varies between tissues. For example, in the liver, the splicing frequency of some selective 3' end splicing sites and selective 5' end splicing sites is about 50-100% higher than in other tissues.

[0004] The basis of an increasing number of human diseases is related to RNA mis-splicing. As mentioned above, RNA splicing is regulated by a complex regulatory mechanism, including many RNA-binding proteins and their interaction networks. In general, splicing diseases result if splicing errors occur. Therefore, mutations in splicing cis-acting elements, spliceosomes or regulatory proteins may affect the accuracy of splicing or alternative splicing. In several studies, changes in pre-mRNA splicing have been demonstrated to be a common pathogenic mechanism. For example, a point mutation on exon 7 of the motor neuron survival gene SMN2 causes the skipping of exon 7 of most transcripts during splicing and shortening of the translated protein, leading to motor neuron survival protein deficiency and motor neuron degenerative diseases, causing spinal muscular atrophy; a point mutation on exon 11 of the lamin A gene LMNA causes the skipping of the last 150bp of exon 11 during splicing, leading to premature termination of protein translation, forming progerin, and causing Hutchinson-Gilford progeria; cystic fibrosis is an autosomal recessive genetic disease caused by a mutation in the cystic fibrosis transmembrane conductance regulator gene CFTR. C>T at 3849+10kb is the most common splicing mutation in CF, resulting in a pseudo-exon with a premature termination codon during splicing. This gene mutation reduces the chloride channel activity of the encoded protein. With the deepening of scientific research, systematic research on splicing diseases is of great significance.

[0005] The screening method combined with CRISPR interference (CRISPRi) technology is a powerful means to systematically study the human RNA splicing phenotype. The CRISPR sequence is a repetitive sequence in the genome of prokaryotes. It is an immune tool produced between bacteria and viruses in the history of life evolution. After infecting bacteria, viruses can integrate genes into the bacterial genome and use bacterial cellular tools to assist viral gene replication. Bacteria have evolved the CRISPR-Cas9 system to remove viral genes from their own genomes. This is a bacterial-specific immune system and an acquired immune system for bacteria to resist the invasion of foreign genetic material such as viruses. The system includes a gene encoding the deoxyribonuclease Cas9 protein and two RNAs, a mature CRISPR RNA (crRNA) and a partially complementary trans-acting CRISPR RNA (tracrRNA). These two RNAs guide the Cas9 protein to destroy foreign DNA. The mechanism by which this bacterial immune system distinguishes self from non-self is that the recognized target DNA binding site contains a protospacer adjacent motif (PAM sequence NGG) juxtaposed with the DNA complementary region. The spacer sequence comes from foreign invading DNA, so it does not induce autoimmunity. This genetic engineering method using RNA to guide the deoxyribonuclease Cas9 has been applied to mammalian cells. In the process of using this system, scientists found that the process can be simplified by using engineered small guide RNA (sgRNA), which contains a hairpin that mimics the tracrRNA-crRNA complex and a short sequence complementary to the target DNA. The Cas9 nuclease can produce sequence-specific double-strand breaks in the target DNA bound to the sgRNA, which are subsequently repaired through the non-homologous end joining pathway. This process often leads to small fragment deletions or insertions, thereby destroying gene function. Therefore, the CRISPR RNA-guided Cas9 nuclease system only requires two molecules: Cas9 protein and sgRNA for targeting genes. It does not require the construction of proteins or expression plasmids. The use of sgRNA for gene editing gives the CRISPR system a powerful advantage. Since Cas9 can cause double-strand breaks in DNA, which is cytotoxic and irreversible, researchers use sgRNA to guide the inactivated Cas9 (dCas9) to bind to the transcription start site of the target gene to inhibit gene transcription. dCas9 has no nuclease activity, but due to the KRAB transcription inhibition domain bound to it, it can still inhibit gene transcription, which is called CRISPR interference (CRISPRi).

[0006] Researchers have used the CRISPR system to conduct a genome-wide large-scale screening in neurons, revealing the splicing regulation mechanism of neuronal microexons that are disrupted in autism. In another study, in order to determine which factors involved in RNA processing are essential in prostate cancer, a genome-wide CRISPR / Cas9 knockout screening was performed, revealing the role of HNRNPL and its target RNA in the growth of prostate cancer. Since the popularization of Sanger sequencing technology, the next-generation sequencing (NGS) technology has developed significantly, capable of single-molecule DNA sequencing and outputting more massive and comprehensive data, with higher sequencing efficiency and wider application capabilities. For example, the Illumina sequencing method is a short-read sequencing technology that performs large-scale sequencing of amplified short-fragment DNA molecules. The NGS process includes three parts: library preparation, method sequencing, and data analysis. The second-generation sequencing technology has played a vital role in the high-throughput requirements of sequencing in several large-scale screening studies. For the first time, researchers conducted a genome-wide CRISPR screen in human neurons, revealing a pathway that controls the neural response to chronic oxidative stress and is associated with neurodegenerative diseases, linking lysosomal failure to ferroptosis. In another study, a large-scale genome-wide screen in neurons using the CRISPR system revealed a neuronal microexon splicing regulatory mechanism that is disrupted in autism.

[0007] In eukaryotes, pre-mRNA splicing is one of the most critical regulatory steps in the post-transcription process. Studies have shown that the basis of more and more human diseases is related to RNA mis-splicing. However, the regulatory factors of most splicing events are still unclear. Although some reports have provided methods for large-scale genetic screening of a splicing disease using the CRISPR system to screen regulatory factors, in most of these previous studies, fluorescent protein signals were needed to sort out the target cell population. Using fluorescent signals to indicate splicing information is a relatively indirect means to convert splicing information into protein signals, which may bring noise, and there is still a lack of screening methods that can apply screening methods to most splicing diseases. Without the help of fluorescent protein signals, there is currently no systematic study of high-throughput screening methods that can widely target RNA splicing phenotypes.

[0008] Therefore, the prior art still needs to be improved and developed. Summary of the invention

[0009] In view of the above-mentioned deficiencies in the prior art, the present invention provides a high-throughput screening method for RNA splicing phenotypes, aiming to solve the problem of how to conduct large-scale genetic screening for various splicing diseases to screen for splicing event regulatory factors without using fluorescent signals to indicate splicing information.

[0010] Specifically, the technical solution of the present invention is as follows:

[0011] The present invention provides a high-throughput screening method for RNA splicing phenotypes, comprising the steps of:

[0012] S1. Designing primer pairs, performing PCR amplification on a DNA template, constructing a reporter gene, and cloning the reporter gene into a vector by homologous recombination to construct a reporter gene vector;

[0013] S2, after enzyme digestion of the reporter gene vector and sgRNA library gene, ligation was performed to construct a reporter gene-sgRNA plasmid library;

[0014] S3, transferring the reporter gene-sgRNA plasmid library into the HEK293T-CRISPRi cell line genome, purifying and collecting mRNA;

[0015] S4. Construct a reporter gene-sgRNA mRNA library, detect the splicing form of the reporter gene mRNA by second-generation sequencing technology, and screen out the sgRNA targeting gene that regulates the splicing of the reporter gene.

[0016] The high-throughput screening method for RNA splicing phenotype, wherein the vector is a lentiviral vector.

[0017] Optionally, the reporter gene vector comprises a sequentially connected EF1α promoter, a reporter gene, a U6 promoter, and a sgRNA library gene.

[0018] The high-throughput screening method for RNA splicing phenotype, wherein the reporter gene is the SMN2 reporter gene, and the SMN2 reporter gene includes a 111bp gene fragment of SMN2 gene exon 6 and a 200bp gene fragment of its subsequent intron, a 54bp gene fragment of SMN2 gene exon 7 and a 261bp gene fragment of its pre-intron and a 444bp gene fragment of its subsequent intron, and a 574bp gene fragment of SMN2 gene exon 8.

[0019] Optionally, the sequence of the SMN2 reporter gene is the nucleotide sequence shown in SEQ ID NO.1.

[0020] Optionally, when the reporter gene is the SMN2 reporter gene, the primer pair is:

[0021] 1F:ggggcacaagcttaattaagaattcataattcccccacctcccatatgtccag,

[0022] 1R:gtggtgtcatttagtgctgctctatgccagcatttcctgcaaatga; or

[0023] 2F:gaaatgctggcatagagcagcactaaatgacaccac,

[0024] 2R:gtaagtcattggtcttaaagtcgactttaaaaaaaaattaaatatttttattatatact.

[0025] The high-throughput screening method for RNA splicing phenotype, wherein the reporter gene is an XBP1 reporter gene, and the XBP1 reporter gene includes a 26bp splicing site at positions 4451-4476 of the XBP1 gene, a 106bp gene fragment before the splicing site, and a 32bp gene fragment after the splicing site.

[0026] Optionally, the sequence of the XBP1 reporter gene is the nucleotide sequence shown in SEQ ID NO.2.

[0027] Optionally, when the reporter gene is an XBP1 reporter gene, the primer pair is:

[0028] xbp1-F: taaGAATTCGGAGTTAAGACAGCGCTTGG,

[0029] xbp1-R:aagtcgacTGTTCTGGAGGGGTGACAAC.

[0030] The high-throughput screening method for RNA splicing phenotypes, wherein the HEK293T-CRISPRi cell line includes a CRISPRi system, and the CRISPRi system knocks down the sgRNA targeting gene.

[0031] Optionally, the Cas nuclease in the CRISPRi system is dCas9 nuclease.

[0032] The present invention has the following beneficial effects:

[0033] The present invention provides a high-throughput screening method for RNA splicing phenotypes, by constructing a reporter gene-sgRNA plasmid library, using the CRISPRi system in the HEK293T-CRISPRi cell line for high-throughput screening, so that the splicing information of the reporter gene and the sgRNA information can be recorded on the same mRNA, and then by second-generation sequencing to detect whether the splicing form of the reporter gene mRNA changes to determine the impact of the knocked-down target gene on the reporter gene splicing, thereby determining the target gene regulating the splicing event. This method also avoids the noise caused by converting the splicing information into a protein signal to determine the splicing form, so the detection sensitivity is high and the resolution is high. The high-throughput screening method for RNA splicing phenotypes of the present invention has the ability to be widely used in the genetic screening of various splicing events, becomes a powerful tool for studying RNA splicing, and is of great significance for systematically studying various splicing events. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a schematic diagram of the reporter gene-sgRNA plasmid library composition and the second-generation sequencing process of the present invention.

[0035] Figure 2 This is a p value and RRAscore distribution diagram of the increased splicing ratio of exon 7 of the SMN2 reporter gene in the embodiment of the present invention.

[0036] Figure 3 These are the results of whole-genome screening in the examples of the present invention when treated with 500 nM thapsigargin Tg for 1 h, 8 h and 24 h, respectively.

[0037] Figure 4 This is the splicing phenotype of endogenous XBP1 at different time points in different gene knockdown cell lines treated with 500 nM thapsigargin Tg in the examples of the present invention. DETAILED DESCRIPTION

[0038] The present invention provides a high-throughput screening method for RNA splicing phenotypes. In order to make the purpose, technical solution and effect of the present invention clearer and more specific, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the scope of protection of the present invention.

[0039] Compared with conventional CRISPR knockout (CRISPR knockout, CRISPRn), using CRISPRi as a means of regulating gene expression has the following advantages:

[0040] 1. No DNA damage toxicity. Conventional CRISPR knockouts can cause DNA double-strand breaks, often leading to strong DNA damage toxicity, thus causing cell apoptosis. Since CRISPRi controls gene expression at the transcriptional level, it does not cause DNA damage toxicity.

[0041] 2. Reversibility. CRISPR knockout will cause permanent changes to the genome, while CRISPRi will not change the DNA sequence and can achieve spatiotemporal regulation to achieve conditional changes in gene expression.

[0042] The inventors came up with the idea of ​​using a genetic screening method based on the CRISPRi system to systematically study some classic splicing events (including neurodegenerative diseases such as SMA), screen out some key regulatory factors that affect splicing forms and verify them. This is a research method that can explore new splicing regulatory mechanisms and find therapeutic targets.

[0043] The present invention provides a high-throughput screening method for RNA splicing phenotypes, comprising the steps of:

[0044] S1. Designing primer pairs, performing PCR amplification on a DNA template, constructing a reporter gene, and cloning the reporter gene into a vector by homologous recombination to construct a reporter gene vector;

[0045] S2, after enzyme digestion of the reporter gene vector and sgRNA library gene, ligation was performed to construct a reporter gene-sgRNA plasmid library;

[0046] S3, transferring the reporter gene-sgRNA plasmid library into the HEK293T-CRISPRi cell line genome, purifying and collecting mRNA;

[0047] S4. Construct a reporter gene-sgRNA mRNA library, detect the splicing form of the reporter gene mRNA by second-generation sequencing technology, and screen out the sgRNA targeting gene that regulates the splicing of the reporter gene.

[0048] Different primers are designed for different reporter genes. The homologous fragments designed on the primers can be recombined with recombinase to form a complete mini reporter gene, which is then cloned between EcoRI and PacI on the lentiviral vector, such as the pMK1334 (addgene Plasmid #127965) vector.

[0049] Design and construct a reporter gene-sgRNA plasmid library, ensuring that each gene has 3-5 sgRNAs for normalization of experimental results, and the library contains a sufficient number of ctrl sgRNAs that cannot knock down genes in the human genome for control. Generally speaking, this method can be used to study splicing events of interest and construct corresponding reporter genes.

[0050] The process of constructing different types of cell lines that stably express the CRISPRi system is as follows: the plasmid expressing the CRISPRi system is transfected and stably integrated into the CLYBL "safe harbor" site or other sites of HEK293T, iPSC and other cell lines through the Talen-mediated gene knock-in method. This is a verified "safe harbor" site that can be transferred into DNA fragments, ensuring that the transferred genes can be transcribed normally. In addition, inserting exogenous target fragments at this site has no known side effects on cells and has high efficiency. After the cell line is constructed, the cell line with the CRISPRi system is confirmed to have a gene knockdown effect by infecting it with sgRNA known to have a gene knockdown effect through lentivirus.

[0051] The reporter gene-sgRNA plasmid library constructed above was used to perform multiple high-throughput screenings in the HEK293T-CRISPRi cell line, a tool cell line, focusing on RNA-binding proteins or the whole genome. CRISPRi screening was used to systematically identify regulatory factors that play an important regulatory role in various splicing events. The reporter gene splicing information and sgRNA information can be recorded on the same mRNA. The second-generation sequencing of the mRNA sequence is directly used to reduce the noise caused by the conversion of splicing information into protein signals in conventional methods. Therefore, the detection sensitivity and resolution are high. Judging from the results of screening different splicing events using this method, this method can screen out the regulatory factors of these splicing events.

[0052] In some embodiments, the vector is a lentiviral vector. The lentiviral vector may be a pMK1334 (addgene Plasmid #127965) vector.

[0053] In some specific embodiments, the reporter gene vector includes a sequentially connected EF1α promoter, a reporter gene, a U6 promoter, and a sgRNA library gene.

[0054] When the sgRNA transcribed by the U6 promoter takes effect in the cell, the splicing of the precursor messenger RNA (pre-mRNA) reporter gene transcribed by the EF1α promoter will change with the changes in the intracellular transcription environment. Since the mRNA transcribed by the EF1α promoter contains the sgRNA sequence, the second-generation sequencing can be used to detect whether the splicing form of the mRNA has changed to determine the effect of the knocked-down gene on the splicing of the reporter gene, thereby determining the key regulatory factors that regulate the splicing event.

[0055] In some embodiments, the reporter gene is an SMN2 reporter gene, which includes a 111bp gene fragment of exon 6 of the SMN2 gene and a 200bp gene fragment of the subsequent intron, a 54bp gene fragment of exon 7 of the SMN2 gene and a 261bp gene fragment of the front intron and a 444bp gene fragment of the subsequent intron, and a 574bp gene fragment of exon 8 of the SMN2 gene.

[0056] In some specific embodiments, the sequence of the SMN2 reporter gene is the nucleotide sequence shown in SEQ ID NO.1.

[0057] By screening the regulatory factors that regulate the splicing of exon 7 of the SMN2 gene on a large scale, the alternative splicing exon 7, part of the front and back intron sequences, part of exon 6 and the complete exon 8 sequence of the SMN2 gene were intercepted. The purpose is to only intercept the region where alternative splicing occurs, so that the reporter gene sequence is as short as possible, and to construct a short SMN2 reporter gene that can correctly reflect the splicing form of the disease gene. Normally, exon 7 is skipped in 90% of the transcripts of the SMN2 gene, causing most of the expressed motor neuron survival protein to lose its original function and degrade quickly. In the treatment of spinal muscular atrophy, improving the retention of exon 7 during SMN2 gene splicing and thus increasing the expression of SMN protein is an effective treatment method, so a systematic study of SMN2 splicing has therapeutic significance.

[0058] In some specific embodiments, when the reporter gene is the SMN2 reporter gene, the primer pair is:

[0059] 1F:ggggcacaagcttaattaagaattcataattcccccacctcccatatgtccag,

[0060] 1R:gtggtgtcatttagtgctgctctatgccagcatttcctgcaaatga; or

[0061] 2F:gaaatgctggcatagagcagcactaaatgacaccac,

[0062] 2R:gtaagtcattggtcttaaagtcgactttaaaaaaaaattaaatatttttattatatact.

[0063] In some embodiments, the reporter gene is an XBP1 reporter gene, and the XBP1 reporter gene includes a 26 bp splicing site at positions 4451-4476 of the XBP1 gene, a 106 bp gene fragment before the splicing site, and a 32 bp gene fragment after the splicing site. In some specific embodiments, the sequence of the XBP1 reporter gene is the nucleotide sequence shown in SEQ ID NO.2.

[0064] The endoplasmic reticulum is a network structure composed of branched tubules and flat cysts, which controls the synthesis, folding and processing of more than 1 / 3 of the proteins in the cell. As a membrane compartment, the endoplasmic reticulum is very sensitive to stimuli that affect its structural integrity and function. External stimuli (such as viral infection, nutrient deficiency, etc.) often lead to misfolding of proteins in the endoplasmic reticulum. Excessive accumulation of unfolded or misfolded proteins makes it impossible for the endoplasmic reticulum to metabolize the excessive protein load, thus triggering endoplasmic reticulum stress. Endoplasmic reticulum stress activates the unfolded protein response to restore cellular homeostasis. IRE1α-mediated alternative splicing of XBP1 is one of the main effector pathways of the endoplasmic reticulum unfolded protein response and is also the most conserved in function. After receiving the signal of endoplasmic reticulum stress, IRE1α is first phosphorylated and forms a dimer to activate the endonuclease activity. XBP1 mRNA is the only known enzymatic substrate of mammalian IRE1. Under normal physiological conditions, mature XBP1 mRNA can express a non-spliced ​​protein XBP1u. When cells are under ER stress, XBP1u mRNA undergoes secondary splicing in the cytoplasm under the action of activated IRE1α, resulting in a shift in the open reading frame and the production of a transcriptionally active isoform XBP1s. After XPB1s enters the nucleus, it initiates a series of gene transcriptions to eliminate the abnormal accumulation of misfolded proteins in the cell. When cells are under the physiological state of ER stress for a long time, the splicing ratio of the transcription factor XBP1 changes dynamically. The nucleotide sequence of 50-100bp before and after the splicing site of XBP1 is intercepted and tandemly expressed in a plasmid with the sgRNA sequence. Combined with CRISPRi technology, high-throughput screening and second-generation sequencing can be performed to know the splicing of the reporter gene corresponding to each sgRNA, thereby screening out the key genes that affect splicing changes, which is conducive to further studying the mechanism of action of long-term ER stress and may provide new ideas for the prevention and treatment of diseases related to ER stress.

[0065] In some specific embodiments, when the reporter gene is an XBP1 reporter gene, the primer pair is:

[0066] xbp1-F: taaGAATTCGGAGTTAAGACAGCGCTTGG,

[0067] xbp1-R:aagtcgacTGTTCTGGAGGGGTGACAAC.

[0068] In some embodiments, the HEK293T-CRISPRi cell line comprises a CRISPRi system, and the CRISPRi system knocks down the sgRNA targeted gene.

[0069] In some specific embodiments, the Cas nuclease in the CRISPRi system is dCas9 nuclease.

[0070] In the HEK293T-CRISPRi cell line transferred with the reporter gene-sgRNA plasmid, the CRISPRi system can knock down the sgRNA targeted gene. Since the mRNA transcribed by the EF1α promoter also contains the sgRNA sequence, the splicing information of the reporter gene and the sgRNA information can be recorded on the same mRNA. Therefore, by detecting whether the splicing form of the XBP1 / SMN2 reporter gene mRNA has changed through second-generation sequencing, it is possible to determine the effect of the knocked-down target gene on the splicing of the reporter gene, thereby determining the key regulatory factors that regulate the XBP1 / SMN2 splicing events.

[0071] The scheme of the present invention is further described below with specific embodiments.

[0072] Example 1

[0073] (1) Construction of SMN2 reporter gene

[0074] The reporter gene was constructed from the human genome by PCR amplification and homologous recombination.

[0075] Taking the construction of SMN2 reporter gene as an example, exon 6 (111 bp) and part of the intron (200 bp) following it of SMN2 gene were intercepted; exon 7 (54 bp) and its front part of the intron (261 bp) and the whole intron (444 bp) following it and exon 8 (574 bp) were recombined together to construct SMN2 reporter gene. After downloading the SMN2 gene sequence from the benchling (https: / / www.benchling.com / ) website, primers were designed using SnapGene:

[0076] 1F:ggggcacaagcttaattaagaattcataattcccccacctcccatatgtccag,

[0077] 1R:gtggtgtcatttagtgctgctctatgccagcatttcctgcaaatga;

[0078] 2F:gaaatgctggcatagagcagcactaaatgacaccac,

[0079] 2R:gtaagtcattggtcttaaagtcgactttaaaaaaaaattaaatatttttattatatact.

[0080] After amplification from the human genome by traditional PCR amplification, the DNA was purified; since the homologous fragments designed on the primers can be recombined with the recombinase to form a complete mini reporter gene, it was then cloned between EcoRI and PacI on pMK1334 (addgene Plasmid #127965). The specific process is as follows:

[0081] About 1 million cultured human cell line HEK293T cells were collected and lysed with 50 μL DNA lysis buffer (lucigen-MA150E-QuickExtract TM Total DNA was extracted with DNAExtraction Solution and diluted 20 times as a DNA template for reporter gene experiments. The laboratory had previously optimized the PCR reaction system, as shown in Table 1.

[0082] Table 1 Reporter gene amplification reaction system

[0083]

[0084] PCR amplification procedure:

[0085]

[0086] Add 2 μL DNA Loading Buffer to the PCR product for electrophoresis detection. At the same time, treat 1 μg of pMK1334 plasmid vector with 1 μL EcoRI and 1 μL PaI endonuclease (NEB) at 37°C, add 5 μL buffer, make up to 50 μL with water, react for 2 hours, and mix with 5 μL DNA Loading Buffer.

[0087] The above mixture was electrophoresed on 1% agarose gel (containing nucleic acid dye) at 120V for 40 minutes. After the electrophoresis, the gel imaging system was used to take pictures. The PCR product and the enzyme digestion product with the expected size band were cut out and purified by DNA gel purification kit (transGen- After purification with Quick Gel Extraction Kit, the recombinant enzyme (Hieff Universal One Step Cloning Kit) to recombinant the vector and the insert fragment. Then add 10 μL of the recombinant product to 100 μL of competent cells (stble3 competent cells), incubate for 30 minutes, heat shock at 42°C for 1 minute, plate on an ampicillin antibiotic LB culture plate, culture overnight, pick bacteria for amplification the next day and send samples to a sequencing company for Sanger sequencing to verify that the cloned sequence is correct. The expanded cultured bacteria are used with a small extraction kit ( HiPure Plasmid MiniPrepKit was used to extract the plasmid. The sgRNA on this plasmid has no targeted gene. This plasmid was transfected into HEK293T cells using PEI / liposomes, and RNA was collected (Yeasen- Cell / Tissue Total RNA Kit), and reverse transcription kit ( IV One-Step gDNA Removal and cDNA Synthesis SuperMix) reverse transcribes RNA into cDNA, PCR amplifies the mRNA of the transferred exogenous reporter gene, and runs electrophoresis to detect its splicing to confirm that the reporter gene can normally reflect the splicing of the gene.

[0088] (2) Construction of SMN2 reporter gene-sgRNA plasmid library

[0089] Enzyme digestion of the previously constructed pMK1334-SMN2 reporter gene vector: digest 2.5ug (50ul system) with BstXI and BlpI, two tubes, cut the gel to the corresponding length after TAE running, and store the recovered product at 4 degrees Celsius (similar steps are consistent with the previous introduction).

[0090] The library purchased from addgene (addgene: Pooled Libraries#83971, #83972, #83973, #83974, #83975, #83976, #83977) is powdered sgRNA. After dissolution, test PCR amplification (20ul system) was performed, and 5ul PCR product was taken for TAE gel running verification; when it was confirmed that the band was correct, 3 tubes of 50ul system PCR were repeated, and the PCR product was purified and recovered using a kit.

[0091]

[0092] The cells were digested with BstXI and BlpI at 37°C and run on a precast PAGE gel (10% in TBE) at 160V for 90 min.

[0093] To recover the PAGE gel: stain with gel stain blue, then cut the gel, use a 1.5ml Ep tube with a qubit tube (use a 5ml syringe needle to pierce the bottom of the tube), place the gel inside for high-speed centrifugation at 20,000rpm for 10min, at room temperature, and then fragment it. Then add 250ul ddH2O to each tube, vortex to mix, and then place the recovered gel on a 70-degree heat block for 1 hour. Vortex is required, then centrifuge at 20,000g for 5min, absorb the supernatant for the first time, insert the gun tip into the gel, absorb more water, and note that the gel will settle at the bottom, and the DNA products are all in the supernatant water; the second time, 20,000g, 3min centrifugation, this time the broken gel is at the bottom of the tube, continue to absorb about 200ul.

[0094] Precipitate DNA: about 200ul DNA solution + 25ul 2M NaCl + 8ul DNABE down (DNA microprecipitant) + 600ul anhydrous ethanol (high salt, anhydrous ethanol is to reduce the solubility of DNA). After adding, vortex, and then store at -20℃ for at least 2 hours, preferably overnight.

[0095] Centrifuge at 4 degrees for 40 minutes, 20,000 g, and the white DNA precipitate will form at the bottom of the tube. Wash twice with 80% ethanol (80% ethanol needs to be prepared freshly before use) and dry in a clean bench for 3 minutes. Add 10 ul of ddH2O and measure the concentration using qubit.

[0096] Ligation library system:

[0097] T4 ligase 1μL + 2μL buffer

[0098] 500ng of the previously digested vector

[0099] Purified restriction digested library DNA 4ng

[0100] Make up to 20ul with water;

[0101] Ligate overnight at 16°C (cannot ligate at room temperature because the library requires high coverage)

[0102] For every 20ul of the ligation system, add 180ul ddH2O and prepare the sedimentation system: about 200ul of DNA solution + 25ul2MNaCl + 8ul DNABE down (DNA micro-precipitant) + 600ul of anhydrous ethanol. After adding, vortex and then incubate at -20℃ for more than 2 hours, preferably overnight. Centrifuge at 4 degrees for 30-40min, 20000g, the DNA will precipitate white at the bottom of the tube, then wash twice with 80% ethanol (80% ethanol needs to be prepared immediately before use), put it in the clean bench to dry for 3min; add 10ul ddH2O to resuspend, and after resuspending, it can be temporarily placed at 4 degrees. Add ddH2O to dilute the library ligation product to 10ng / ul, take the ligation product, transform the chemical competence (same as the previous method), and observe the bacterial growth as a test.

[0103] Count the number of plates with chemical competence and make an estimate. The estimated ratio is about 1000 times that of chemical competence and electroporation. HST08 cells (Takara) were thawed on ice for 5 minutes. At the same time, SOC medium needed to be thawed and then revived. The composition is richer than LB, it is an accelerated medium, and there is no antibiotics. First, warm to room temperature, then put on ice to precool (to prevent temperature difference stimulation after electroporation); precool the electroporation cup, the volume inside should not exceed 25ul, add about 20ng of plasmid to 50ul competent cells, and divide each 50ul into 2 electroporation cups, 0.2kΩ, 25μF, 1.5kV electroporation.

[0104] After electroporation, add SOC as soon as possible, and gently wash out the competent cells in the electroporation cup with SOC (use a 1ml pipette tip to blow and wash), and treat at 37℃ shaking for 1h. At the same time, take out the 24*24 ampicillin LB plate (if it is wet, it needs to be dried in a clean bench) and preheat it at 37 degrees, then evenly spread 1ml of cells on the 24*24 plate; at the same time, prepare a small 10cm ampicillin LB plate, take 10μl of the revived bacteria (add 90ul LB for dilution) for a total of 100μl, evenly spread the plate to estimate the number of colonies.

[0105] After overnight incubation at 37°C, observe the 10 cm plate containing 10 μl of bacterial solution tested the day before and estimate whether the number of colonies is sufficient to contain all sgRNAs.

[0106] Use a scraper to scrape the bacteria off the 24*24 plate. Note that the cell scraper should be used in one direction. Rotate the plate to scrape and try to avoid breaking the agarose gel. Collect the bacteria in a 50ml centrifuge tube. The extracted plasmid is the SMN2 reporter gene-sgRNA plasmid library, which is used to package lentivirus. The composition of the SMN2 reporter gene-sgRNA plasmid library is as follows: Figure 1As shown, since the mRNA transcribed by the EF1α promoter contains the sgRNA sequence, the splicing information of the SMN2 reporter gene and the sgRNA information can be recorded on the same mRNA.

[0107] (3) Construction of SMN2 reporter gene-sgRNA library cell line

[0108] The plasmid expressing the CRISPRi system was transfected and stably integrated into the CLYBL "safe harbor" site or other sites of HEK293T by Talen-mediated gene knock-in method. This is a verified "safe harbor" site that can be transferred into DNA fragments, ensuring that the transferred gene can be transcribed normally. In addition, inserting exogenous target fragments at this site has no known side effects on cells and has high efficiency. This cell line was developed by the inventors based on previous research (Tian, ​​R., Abarientos, A., Hong, J., Hashemi, SH, Yan, R., N., Leng, K., Nalls, MA, Singleton, AB, Xu, K., et al. (2021). Genome-wide CRISPRi / a screens in human neurons link lysosomalfailure to ferroptosis.) was constructed. The library plasmid was stably transferred into the genome of the HEK293T cell line that stably expressed dCas9 by lentiviral transfection. The lentiviral packaging used the universal third-generation lentiviral packaging method. Taking the screening of a library containing 6000 sgRNAs as an example, the specific operations are as follows:

[0109] 15ug library plasmid plus 15ug third-generation lentiviral packaging plasmid mixture (mass ratio 1:1:1) were transfected into a 15cm dish of HEK293T cells using PEI (Yeason-Polyethylenimine Linear (PEI) MW40000 (rapid lysis) linear PEI transfection reagent (rapid lysis) MW40000). The cell attachment time was about 20 hours, and the confluence was about 70%. After 48 hours, the virus supernatant was collected and infected with about 20×10^6 HEK293T cell lines stably expressing dCas9, and the virus infection efficiency was about 30%. After 48 hours, puromycin was added to sieve and expanded the culture. About 6×10^6 cells (about 1000 copies of each sgRNA) were collected, and total RNA (Yeason- Cell / Tissue Total RNAKit), mRNA purification magnetic beads (BeyoMag TMOligo(dT)25MagneticBeads(mRNAMagneticBeads)) was used to extract mRNA, and then reverse transcription kit( IV One-Step gDNARemoval and cDNA Synthesis SuperMix) was used to reverse transcribe mRNA into cDNA (10 ng / ul), and the sample was prepared for PCR amplification of the transferred exogenous reporter gene and sgRNA mRNA for library construction and next-generation sequencing.

[0110] (4) Construction of SMN2 reporter gene-sgRNA mRNA library and next-generation sequencing

[0111] The reporter gene and sgRNA sequences introduced into the cells are amplified by PCR. The primers contain the adapters required for next-generation sequencing, which is convenient for subsequent detection. The rear primers are universal primers. One of the rear primers is as follows, where the bold sequencing adapters may vary according to the requirements of the sequencing company, but are also unified and universal on the market.

[0112] oSeq_dual_p7:CAAGCAGAAGACGGCATACGAGATCAGTGGATGTGACTGGAG TTCAGACGTGTGCTCTTCCGATCTCGACTCGGTGCCACTTTTTC.

[0113] The forward primer is adjusted according to the different reporter genes. For example, the forward primer information for the SMN2 screening experiment is as follows:

[0114] oSeq_SMN2_p5:AATGATACGGCGACCACCGAGATCTACACGATATCGAACACT CTTTCCCTACACGACGCTCTTCCGATCTgtacatgagtggctatcatactggc;

[0115] oSeq_SMN2_p5_i2:AATGATACGGCGACCACCGAGATCTACACAGCGCTAGACA CTCTTTCCCTACACGAGCTCTTCCGATCTgtacatgagtggctatcatactggc.

[0116] All cDNA templates were amplified using the above primers, and the PCR products were combined and purified. The PCR system is shown in Table 2:

[0117] Table 2 PCR reaction system for cDNA library construction

[0118]

[0119]

[0120] Magnetic beads (Yeason- DNA Selection Beads (SMN2-sgRNA library length 1400 bp) was used to sort the amplified product DNA (SMN2-sgRNA library length 1400 bp) and provided it to Berry for Illumina double-end sequencing. The process diagram of the second-generation sequencing is shown in the figure. Figure 1 As shown. Based on the sequencing results, the reporter gene splicing sequence and its corresponding sgRNA sequence were analyzed by bioinformatics, and then compared with the control group, it can be seen that the effect of interfering with a certain gene on the reporter gene splicing. The sgRNA sequence targets gene A, and the corresponding reporter gene splicing ratio is significantly increased compared with the control group, indicating that knocking down this gene can increase the splicing ratio of the reporter gene.

[0121] like Figure 2 As shown in the figure, a large number of regulatory factors that promote the retention of SMN2 exon 7 were screened in the splicing screening of SMN2. Knocking down these genes can significantly increase the proportion of SMN2 exon 7 retention, so these regulatory factors have the research potential to regulate SMN2 splicing. Normally, exon 7 is skipped in 90% of the transcripts of the SMN2 gene, causing most of the expressed motor neuron survival protein to lose its original function and quickly degrade. In the treatment of spinal muscular atrophy, improving the retention of exon 7 during SMN2 gene splicing and thus increasing the expression of SMN protein is an effective treatment method, so systematic research on SMN2 splicing has therapeutic significance.

[0122] Example 2

[0123] (1) Construction of XBP1 reporter gene

[0124] The reporter gene was constructed from the human genome by PCR amplification and homologous recombination.

[0125] Taking the construction of XBP1 reporter gene as an example, the 106BP before and 32BP after the splicing site of XBP1 were amplified from the mRNA of XBP1 gene to construct XBP1 reporter gene. After downloading the XBP1 cDNA sequence from the benchling (https: / / www.benchling.com / ) website, SnapGene was used to design primers:

[0126] xbp1-F:taaGAATTCGGAGTTAAGACAGCGCTTGG,

[0127] xbp1-R:aagtcgacTGTTCTGGAGGGGTGACAAC.

[0128] After amplification from the human genome by traditional PCR amplification, the DNA was purified; since the homologous fragments designed on the primers can be recombined with the recombinase to form a complete mini reporter gene, primers were designed for different reporter genes. The XBP1 reporter gene was then cloned between EcoRI and PacI on pMK1334 (addgene Plasmid #127965). The specific process is as follows:

[0129] About 1 million cultured human cell line HEK293T cells were collected and lysed with 50 μL DNA lysis buffer (lucigen-MA150E-QuickExtract TM Total DNA was extracted with DNAExtraction Solution and diluted 20 times as a DNA template for constructing reporter gene experiments. The laboratory had previously optimized the PCR reaction system, as shown in Table 3.

[0130] Table 3 Reporter gene amplification reaction system

[0131]

[0132]

[0133]

[0134] Add 2 μL DNA Loading Buffer to the PCR product for electrophoresis detection. At the same time, treat 1 μg of pMK1334 plasmid vector with 1 μL EcoRI and 1 μL PaI endonuclease (NEB) at 37°C, add 5 μL buffer, make up to 50 μL with water, react for 2 hours, and mix with 5 μL DNA Loading Buffer.

[0135] The above mixture was electrophoresed on 1% agarose gel (containing nucleic acid dye) at 120V for 40 minutes. After the electrophoresis, a gel imaging system was used to take pictures. The bands of PCR products and enzyme digestion products that met the expected size were cut out and purified by DNA gel purification kit (transGen- After purification with Quick Gel Extraction Kit, the recombinant enzyme (Hieff Universal One Step Cloning Kit) to recombinant the vector and the insert fragment. Then add 10 μL of the recombinant product to 100 μL of competent cells (stble3 competent cells), incubate for 30 minutes, heat shock at 42°C for 1 minute, plate on an ampicillin antibiotic LB culture plate, culture overnight, pick bacteria for amplification the next day and send samples to a sequencing company for Sanger sequencing to verify that the cloned sequence is correct. The expanded cultured bacteria are used with a small extraction kit ( HiPure Plasmid MiniPrep Kit was used to extract the plasmid. The sgRNA on this plasmid has no targeted gene. This plasmid was transfected into HEK293T cells using PEI / liposomes, and RNA was collected (Yeasen- Cell / Tissue Total RNA Kit), and reverse transcription kit ( IV One-Step gDNA Removal and cDNA Synthesis SuperMix) reverse transcribes RNA into cDNA, PCR amplifies the mRNA of the transferred exogenous reporter gene, and runs electrophoresis to detect its splicing to confirm that the reporter gene can normally reflect the splicing of the gene.

[0136] (2) Construction of XBP1 reporter gene-sgRNA plasmid library

[0137] Enzyme digestion of the previously constructed pMK1334-XBP1 reporter gene vector: digest 2.5ug (50ul system) with BstXI and BlpI, two tubes, run the gel on TAE and cut the gel to the corresponding length, recover the product and store it at 4 degrees (similar steps are consistent with those described above).

[0138] The library purchased from addgene (addgene: Pooled Libraries#83971, #83972, #83973, #83974, #83975, #83976, #83977, etc. In this case, a whole genome library expressed in HEK293T cells was selected) is a powdered sgRNA. After dissolution, a test PCR amplification (20ul system) is performed, and then 5ul of PCR product is taken for TAE gel running verification; when it is confirmed that the band is correct, repeat 3 tubes of 50ul system PCR, and the PCR product is purified and recovered using a kit.

[0139]

[0140] The cells were digested with BstXI and BlpI at 37°C and run on a precast PAGE gel (10% in TBE) at 160V for 90 min.

[0141] To recover the PAGE gel: stain with gel stain blue, then cut the gel, use a 1.5ml Ep tube with a qubit tube (use a 5ml syringe needle to pierce the bottom of the tube), place the gel inside for high-speed centrifugation at 20,000rpm for 10min, at room temperature, and then fragment it. Then add 250ul ddH2O to each tube, vortex to mix, and then place the recovered gel on a 70-degree heat block for 1 hour. Vortex is required, then centrifuge at 20,000g for 5min, absorb the supernatant for the first time, insert the gun tip into the gel, absorb more water, and note that the gel will settle at the bottom, and the DNA products are all in the supernatant water; the second time, 20,000g, 3min centrifugation, this time the broken gel is at the bottom of the tube, continue to absorb about 200ul.

[0142] Precipitate DNA: about 200ul DNA solution + 25ul 2M NaCl + 8ul DNABE down (DNA microprecipitant) + 600ul anhydrous ethanol (high salt, anhydrous ethanol is to reduce the solubility of DNA). After adding, vortex, and then store at -20℃ for at least 2 hours, preferably overnight.

[0143] Centrifuge at 4 degrees for 40 minutes, 20,000 g, and the DNA will be precipitated as a white pellet at the bottom of the tube. Wash twice with 80% ethanol (80% ethanol needs to be prepared freshly), and dry in a clean bench for 3 minutes; add 10 ul of ddH2O, and then measure the concentration with qubit.

[0144] Ligation library system:

[0145] T4 ligase 1μL + 2μL buffer

[0146] 500ng of the previously digested vector

[0147] Purified restriction digested library DNA 4ng

[0148] Make up to 20ul with water;

[0149] Connect overnight at 16 degrees (cannot connect at room temperature because the library requires high coverage)

[0150] For every 20ul of the ligation system, add 180ul ddH2O and prepare the sedimentation system: about 200ul of DNA solution + 25ul2MNaCl + 8ul DNABE down (DNA micro-precipitant) + 600ul of anhydrous ethanol. After adding, vortex and then -20℃ for at least 2 hours, preferably overnight ligation. Centrifuge at 4 degrees for 30-40min, 20000g, then the DNA will be a white precipitate at the bottom of the tube, then wash twice with 80% ethanol (80% ethanol needs to be prepared immediately before use), put it in the clean bench to dry for 3min; add 10ul ddH2O to resuspend, and after resuspending, it can be temporarily placed at 4 degrees. Add ddH2O to dilute the library ligation product to 10ng / ul, take the ligation product, transform the chemical competence, and observe the bacterial growth as a test.

[0151] Count the number of plates with chemical competence and make an estimate. The estimated ratio is about 1000 times that of chemical competence and electroporation. HST08 cells (Takara) were thawed on ice for 5 minutes. At the same time, SOC medium needed to be thawed and then revived. The composition is richer than LB, it is an accelerated medium, and there is no antibiotics. First, warm to room temperature, then put on ice to precool (to prevent temperature difference stimulation after electroporation); precool the electroporation cup, the volume inside should not exceed 25ul, add about 20ng of plasmid to 50ul competent cells, and divide each 50ul into 2 electroporation cups, 0.2kΩ, 25μF, 1.5kV electroporation.

[0152] After electroporation, add SOC as soon as possible, and gently wash out the competent cells in the electroporation cup with SOC (use a 1ml pipette tip to blow and wash), and treat at 37℃ shaking for 1h. At the same time, take out the 24*24 ampicillin LB plate (if it is wet, it needs to be dried in a clean bench) and preheat it at 37 degrees, then evenly spread 1ml of cells on the 24*24 plate; at the same time, prepare a small 10cm ampicillin LB plate, take 10μl of the revived bacteria (add 90ul LB for dilution) for a total of 100μl, evenly spread the plate to estimate the number of colonies.

[0153] After overnight incubation in a 37°C oven, observe the 10 cm plate containing 10 μl of bacterial solution from yesterday's test and estimate whether the number of colonies is sufficient to contain all sgRNAs.

[0154] Use a scraper to scrape the bacteria off the 24*24 plate. Note that the cell scraper should be used in one direction. Rotate the plate to scrape and try to avoid breaking the agarose gel. Collect the bacteria in a 50ml centrifuge tube. The extracted plasmid is the XBP1 reporter gene-sgRNA plasmid library, which is used to package lentivirus. The composition of the XBP1 reporter gene-sgRNA plasmid library is as follows: Figure 1As shown, since the mRNA transcribed by the EF1α promoter contains the sgRNA sequence, the splicing information of the XBP1 reporter gene and the sgRNA information can be recorded on the same mRNA.

[0155] (3) Construction of XBP1 reporter gene-sgRNA library cell line

[0156] The plasmid expressing the CRISPRi system is transfected and stably integrated into the CLYBL "safe harbor" site or other sites of HEK293T through the Talen-mediated gene knock-in method. This is a verified "safe harbor" site that can be transferred into DNA fragments, ensuring that the transferred gene can be transcribed normally. In addition, inserting exogenous target fragments at this site has no known side effects on cells and has high efficiency. The library plasmid is stably transferred into the genome of this HEK293T cell line that stably expresses dCas9 by lentiviral transfection. The lentiviral packaging uses the universal third-generation lentiviral packaging method. Taking the screening of a library containing 6000 sgRNAs as an example, the specific operations are as follows:

[0157] 15ug library plasmid plus 15ug third-generation lentiviral packaging plasmid mixture (mass ratio 1:1:1) were transfected into a 15cm dish of HEK293T cells using PEI (Yeason-Polyethylenimine Linear (PEI) MW40000 (rapid lysis) linear PEI transfection reagent (rapid lysis) MW40000). The cell attachment time was about 20 hours, and the confluence was about 70%. After 48 hours, the virus supernatant was collected and infected with about 20×10^6 HEK293T cell lines stably expressing dCas9, and the virus infection efficiency was about 30%. After 48 hours, puromycin was added to sieve and expanded the culture. About 6×10^6 cells (about 1000 copies of each sgRNA) were collected, and total RNA (Yeason- Cell / Tissue Total RNAKit), mRNA purification magnetic beads (BeyoMag TM Oligo(dT)25MagneticBeads(mRNAMagneticBeads)) was used to extract mRNA, and then reverse transcription kit( IV One-Step gDNARemoval and cDNA Synthesis SuperMix) was used to reverse transcribe mRNA into cDNA (10 ng / ul), and the sample was prepared for PCR amplification of the transferred exogenous reporter gene and sgRNA mRNA for library construction and next-generation sequencing.

[0158] (4) Construction of XBP1 reporter gene-sgRNA mRNA library and next-generation sequencing

[0159] The reporter gene and sgRNA sequences introduced into the cells are amplified by PCR. The primers contain the adapters required for next-generation sequencing, which is convenient for subsequent detection. The rear primers are universal primers. One of the rear primers is as follows, where the bold sequencing adapters may vary according to the requirements of the sequencing company, but are also unified and universal on the market.

[0160] oSeq_dual_p7:CAAGCAGAAGACGGCATACGAGATCAGTGGATGTGACTGGAG TTCAGACGTGTGCTCTTCCGATCTCGACTCGGTGCCACTTTTTC.

[0161] The forward primer is adjusted according to the different reporter genes. The forward primer information for the XBP1 screening experiment is as follows:

[0162] oSeq_XBP1_p5_i1:AATGATACGGCGACCACCGAGATCTACACACATAGCGACA CTCTTTCCCTACACGACGCTCTTCCGATCTGGCGGAAGCCAAGGGGAATG;

[0163] oSeq_XBP1_p5_i2:AATGATACGGCGACCACCGAGATCTACACGTGCGATAACA CTCTTTCCCTACACGACGCTCTTCCGATCTGGCGGAAGCCAAGGGGAATG.

[0164] All cDNA templates were amplified using the above primers, and the PCR products were combined and purified. The PCR system is shown in Table 4:

[0165] Table 4 PCR reaction system for cDNA library construction

[0166]

[0167]

[0168] Magnetic beads (Yeason-Hieff DNA Selection Beads (DNA Selection Beads) were used to sort the amplified DNA (XBP1-sgRNA library length 755 bp) and provided to Berry for Illumina double-end sequencing. The process diagram of the second-generation sequencing is shown in the figure. Figure 1As shown. Based on the sequencing results, bioinformatics analysis of the reporter gene splicing sequence and its corresponding sgRNA sequence, and then compared with the control group, we can know the impact of interfering with a certain gene on the reporter gene splicing. If the sgRNA sequence targets a certain gene for knockdown, the corresponding reporter gene splicing ratio is significantly increased compared with the control group, indicating that knocking down this gene can increase the splicing ratio of the reporter gene.

[0169] In the splicing screening of XBP1, the cells were induced to produce endoplasmic reticulum stress under different drug treatment time of thapsigargin Tg, and the results of whole genome screening were as follows: Figure 3 As shown, a large number of regulatory factors known to affect XBP1 splicing under endoplasmic reticulum stress (such as ERN1, VMP1, etc.) were screened. These result targets were verified, and it was found that the screened genes were indeed able to regulate the splicing of XBP1 at different time points compared with the ctrl sgRNA. Among them, the ERN1 gene ranked first in several screenings of this method, that is, knocking down this gene can extremely significantly inhibit the splicing of XBP1, and ERN1 is the gene encoding IRE1, and activated IRE1 has nuclease activity, causing XBP1 splicing; at the same time, a comprehensive analysis of the top-ranked targets in the screening results, the repeatability of the two repeated experiments, and whether the two sgRNAs have similar effects, was performed, and some genes were selected for separate verification. Figure 4 As shown, it can be found that knockdown of PREB and SEC24A can inhibit the splicing of XBP1, while knockdown of CTRL and SLC35B1 can promote the splicing of XBP1, which is consistent with the splicing phenotype of the reporter gene in the screening results.

[0170] Traditional large-scale screening methods are only used in the study of special cases. There is currently no high-throughput screening method for various RNA splicing events. The high-throughput screening method for RNA splicing phenotypes provided by the present invention has the ability to be widely used in genetic screening of various splicing events. It is hoped that this high-throughput screening method can be applied to different splicing diseases and become a powerful tool for studying RNA splicing.

[0171] It should be understood that the application of the present invention is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A high-throughput screening method for RNA splicing phenotypes, characterized in that: Includes steps: S1. Designing primer pairs, performing PCR amplification on a DNA template, constructing a reporter gene, and cloning the reporter gene into a vector by homologous recombination to construct a reporter gene vector; S2, after enzyme digestion of the reporter gene vector and sgRNA library gene, ligation was performed to construct a reporter gene-sgRNA plasmid library; S3, transferring the reporter gene-sgRNA plasmid library into the HEK293T-CRISPRi cell line genome, purifying and collecting mRNA; S4. Construct a reporter gene-sgRNA mRNA library, detect the splicing form of the reporter gene mRNA by second-generation sequencing technology, and screen out the sgRNA targeting gene that regulates the splicing of the reporter gene.

2. The high-throughput screening method for RNA splicing phenotype according to claim 1, characterized in that: The vector is a lentiviral vector.

3. The high-throughput screening method for RNA splicing phenotype according to claim 1 or 2, characterized in that: The reporter gene vector comprises a sequentially connected EF1α promoter, a reporter gene, a U6 promoter, and a sgRNA library gene.

4. The high-throughput screening method for RNA splicing phenotype according to claim 1, characterized in that: The reporter gene is an SMN2 reporter gene, which includes a 111bp gene fragment of SMN2 gene exon 6 and a 200bp gene fragment of its subsequent intron, a 54bp gene fragment of SMN2 gene exon 7 and a 261bp gene fragment of its front intron and a 444bp gene fragment of its subsequent intron, and a 574bp gene fragment of SMN2 gene exon 8.

5. The high-throughput screening method for RNA splicing phenotype according to claim 4, characterized in that: The sequence of the SMN2 reporter gene is the nucleotide sequence shown in SEQ ID NO.

1.

6. The high-throughput screening method for RNA splicing phenotype according to claim 5, characterized in that: The primer pairs are: 1F:ggggcacaagcttaattaagaattcataattcccccacctcccatatgtccag, 1R:gtggtgtcatttagtgctgctctatgccagcatttcctgcaaatga; or 2F:gaaatgctggcatagagcagcactaaatgacaccac, 2R:gtaagtcattggtcttaaagtcgactttaaaaaaaaattaaatatttttattatatact.

7. The high-throughput screening method for RNA splicing phenotype according to claim 1, characterized in that: The reporter gene is an XBP1 reporter gene, which includes a 26 bp splicing site at positions 4451-4476 of the XBP1 gene, a 106 bp gene fragment before the splicing site, and a 32 bp gene fragment after the splicing site.

8. The high-throughput screening method for RNA splicing phenotype according to claim 7, characterized in that: The sequence of the XBP1 reporter gene is the nucleotide sequence shown in SEQ ID NO.

2.

9. The high-throughput screening method for RNA splicing phenotype according to claim 8, characterized in that: The primer pairs are: xbp1-F: taaGAATTCGGAGTTAAGACAGCGCTTGG, xbp1-R:aagtcgacTGTTCTGGAGGGGTGACAAC.

10. The high-throughput screening method for RNA splicing phenotype according to claim 1, characterized in that: The HEK293T-CRISPRi cell line includes a CRISPRi system, the CRISPRi system knocks down the sgRNA targeting gene, and the Cas nuclease in the CRISPRi system is a dCas9 nuclease.

Images