Non-amplified CRISPR / Cas12a mycoplasma pneumoniae nucleic acid detection kit and detection method

Abstract

The invention discloses a non-amplified CRISPR / Cas12a mycoplasma pneumoniae nucleic acid detection kit and a detection method, and relates to the field of medical detection.The detection kit comprises a crRNA library corresponding to a conserved sequence of a mycoplasma pneumoniae P1 fragment; the CRISPR / Cas12a reaction system comprises a Buffer, a Cas12a enzyme and a single-chain double light labeled DNA (ssDNA) probe; and fluorescence detection test paper. According to the invention, a new non-amplified CRISPR / Cas12a mycoplasma pneumoniae nucleic acid detection strategy of a crRNA library is adopted, detection targets can be effectively increased under the condition that the concentration of a nucleic acid molecule substrate is not increased, and fluorescence signals generated by non-specific cleavage are increased, so that the detection sensitivity is effectively improved.

Description

Technical Field

[0001] The present invention relates to the field of medical detection, and in particular to a CRISPR / Cas12a non-amplification CRISPR / Cas12a Mycoplasma pneumoniae nucleic acid detection kit and a detection method. Background Art

[0002] Mycoplasma pneumoniae is an atypical pathogen that can cause human respiratory infections and belongs to the Mycoplasmataceae family. It is the main pathogen that causes mycoplasma pneumonia and can also cause upper respiratory tract infections such as bronchitis and pharyngitis. After mycoplasma infection, ordinary upper respiratory tract infections can develop into a series of serious respiratory diseases such as fatal pneumonia. Mycoplasma pneumoniae is the smallest prokaryotic organism that can reproduce on artificial synthetic culture media and presents "poached egg-shaped" colonies without cell wall structures. Mycoplasma does not have a mature nucleus and its cell structure is very simple. The genome is a circular double helix with a size between 500 and 2200 kb and a low G+C content. The P1 protein gene of mycoplasma is highly conserved, with a size of about 5000 bp, encoding an adhesion protein with a molecular weight of about 170 kd. It has multiple antigenic determinants and is a key protein for mycoplasma pneumoniae to adhere to the host. Among them, the difference in the gene sequence of the RepMP region of the P1 protein can serve as an important basis for the typing of Mycoplasma pneumoniae.

[0003] Isolation and culture is the gold standard for detecting mycoplasma, but due to its strict culture conditions and long time required, it is difficult to adapt to the needs of clinical application. At present, the detection of MP still relies on traditional laboratory detection methods such as colloidal gold serological antibody detection and PCR nucleic acid detection. Among them, immunological methods such as colloidal gold based on antigen-antibody reaction are fast, portable, and inexpensive, but many interference factors, low specificity and sensitivity limit its practical application; in addition, nucleic acid detection based on PCR method has gradually entered the clinic in recent years. Although PCR method has good sensitivity and specificity, it relies on expensive instruments and equipment, strict experimental conditions and personnel qualification access requirements. Its application scenarios are usually limited to central laboratories and are difficult to promote to bedside point-of-care testing (POCT).

[0004] Studies have found that CRISPR / Cas, as a molecular detection technology, has the advantages of simple operation, short detection time, portable instruments, and point-of-care testing (POCT), which can make up for the shortcomings of existing technologies. After CRISPR / Cas specifically recognizes the target sequence under the guidance of gRNA, it activates its nonspecific cleavage activity to convert the detection target signal into a detection signal. However, the detection sensitivity of the CRISPR / Cas system is low without in vitro amplification, so it is first necessary to amplify the detected target sequence in vitro to improve the detection sensitivity. Therefore, CRISPR / Cas12 is combined with in vitro nucleic acid amplification technology to improve its detection sensitivity, but this process is prone to cross-contamination and requires additional operation steps, which increases the complexity of the detection process. Therefore, it is necessary to further optimize the nucleic acid detection process based on CRISPR / Cas non-amplification technology to improve detection sensitivity, maintain detection specificity and continuously reduce detection time.

[0005] In summary, how to effectively solve the problem of low non-amplification sensitivity of CRISPR / Cas is the bottleneck for its commercial application, so the present invention aims to solve this problem. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a non-amplified CRISPR / Cas12a Mycoplasma pneumoniae nucleic acid detection kit and detection method, comprising: crRNA library corresponding to the conserved sequence of Mycoplasma pneumoniae P1 fragment; CRISPR / Cas12a reaction system, which includes Buffer, Cas12 enzyme and single-stranded dual-photolabeled DNA (ssDNA) probe; Fluorescent test strips.

[0007] Preferably, the crRNA library is a crRNA library sequence obtained by analyzing the conservation of Mycoplasma pneumoniae nucleic acid sequences and designing using CRISPR-ERA software.

[0008] A method for detecting CRISPR / Cas12a Mycoplasma pneumoniae nucleic acid, based on the CRISPR / Cas12a non-amplified CRISPR / Cas12a Mycoplasma pneumoniae nucleic acid detection kit described in the above scheme, characterized in that the detection method comprises the following steps: S01, DNA was extracted from the Mycoplasma pneumoniae sample; S02, amplifying the extracted DNA using a PCR reaction system to obtain three specific target DNA fragments, target1, target2 and target3; S03, diluting the product after amplification of the PCR reaction system in step S02 by 10 times in a gradient manner to obtain DNA solutions of target1, target2 and target3 of different concentrations; S04, using the CRISPR / Cas12a reaction system to screen the obtained DNA solutions of target1, target2 and target3 of different concentrations for single crRNA detection activity, so as to screen and obtain active crRNA; S05. Obtain active crRNA, and perform combination screening of 2, 4, and 6 crRNAs for each target crRNA to determine the optimal crRNA combination system for each target; S06, further combining the determined optimal crRNA combination reaction systems of each target to form a multi-target combination comprising target1, target2 and target3, and screening to obtain an optimal multi-target combination reaction system; S07. Under the condition of 37°C, a fluorescence detection instrument was used to collect fluorescence signals every 30 seconds, for a total of 180 times, and the change process of the real-time fluorescence signal intensity was analyzed and detected to optimize the reaction system of the best crRNA and target; S08. Perform a test strip test on the reaction system of the optimal crRNA and target, place the test strip in a reaction tube, react for 5 minutes, and then read the signal.

[0009] Preferably, the method for extracting DNA from the sample in step S01 is a magnetic bead method.

[0010] Preferably, the DNA solutions of different concentrations in step S03 include 10000 pM, 1000 pM, 100 pM, 10 pM, 1 pM, 0.1 pM, and 0.01 pM.

[0011] Preferably, the CRISPR / Cas12a reaction system in step S04, step S05 and step S06 includes adding 3 µl of Buffer, adding 25 nM to 30 nM of Cas12a enzyme, using a single-stranded double-photolabeled DNA (ssDNA) probe with a concentration of 300 to 450 nM, and the final DNA concentrations of target1, target2 and target3 are 10000, 1000, 100, 10, 1, 0.1, and 0.01 pM, and the concentration of each crRNA is 300 nM to 450 nM, and finally, enzyme-free H2O is added to keep the total volume of the liquid at 30 µl.

[0012] The technical effects and advantages of the present invention are as follows: a non-amplified CRISPR / Cas12a method for detecting Mycoplasma pneumoniae nucleic acid is established by constructing an optimized crRNA library, which effectively solves the key limitation problem of dependence on special instruments and professionals in the Mycoplasma pneumoniae PCR detection process, as well as the difficulty in realizing rapid bedside detection, thereby shortening the detection time; secondly, the present invention optimizes the detection system by designing a mixed detection reaction system of library crRNA, thereby optimizing and improving the problem of low sensitivity of CRISPR / Cas12a non-amplified nucleic acid detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a schematic diagram of the detection principle proposed by the present invention.

[0014] Figure 2 A schematic diagram of designing a crRNA library for the Mycoplasma pneumoniae genome P1 proposed in the present invention, and then screening results of CRISPR / Cas12a multi-target detection activity based on the library crRNA.

[0015] Figure 3 This is a schematic diagram of the results of the library crRNA combination proposed in the present invention for detecting the activity of mycoplasma targeted DNA.

[0016] Figure 4 Schematic diagram of the test strip test results of the CRISPR / Cas12a multi-target detection activity based on library crRNA proposed in the present invention. DETAILED DESCRIPTION

[0017] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments. The embodiments of the present invention are provided for the purpose of illustration and description, and are not intended to be exhaustive or to limit the present invention to the disclosed forms. Many modifications and variations will be apparent to those of ordinary skill in the art. The embodiments are selected and described in order to better illustrate the principles and practical applications of the present invention, and to enable those of ordinary skill in the art to understand the present invention and thereby design various embodiments with various modifications suitable for specific uses.

[0018] Example 1 A CRISPR / Cas12a non-amplification CRISPR / Cas12a Mycoplasma pneumoniae nucleic acid detection kit, comprising: crRNA library corresponding to the conserved sequence of Mycoplasma pneumoniae P1 fragment; CRISPR / Cas12a reaction system, which includes Buffer, Cas12 enzyme and single-stranded dual-photolabeled DNA (ssDNA) probe; Fluorescent test strips.

[0019] The crRNA library mentioned above is obtained by analyzing the conservation of the Mycoplasma pneumoniae nucleic acid sequence and using CRISPR-ERA software to design the crRNA sequence of the library. Specifically: The sequence numbers of the mixed crRNA library sequence combination CRISPR / Cas12a detection reaction system combination are: F1-RPA-MP:GCCTTGTCCAAGTCCACTTGGATTCTCATCCT, R1-RPA-MP: CAAACCAAAGCCGCCAAAGGGGTTAAAGGTG; F2-RPA-MP:GATCACTTGGATCCCAAGGCCATGACCGCGA, R2-RPA-MP: GTCAACCAGTTACAGTAGCACTGGTACCAGTTG; F3-RPA-MP:ACCCCACTCGCTGAACTGTTAGATGGGGAAG, R3-RPA-MP: GGTAACACTGAGCACAATCACAACAATAGGTACAG.

[0020] The crRNA and reaction system for mycoplasma specifically recognized by CRISPR / Cas12 include crRNA1~21, where the crRNA sequences are: crRNA-1ACCGCATCAACCACCTTTGC; crRNA-2CGTTACGCCGGTATGACCTC; crRNA-3GCTACACCCGCCCTGACGAG; crRNA-4TTGACTGCCACTGCCGGCAG; crRNA-5ACCCGTGAGGGGGAGGGAGG; crRNA-6GAAGTTAAACCCGAAACGC; crRNA-7GTCGCGCGTGGGCGTTTGCG; crRNA-8TGGGACTGAAAGGCGCGCGA; crRNA-9ATGGCGGGCAGACGGTCGCG; crRNA-10AAAAGGAAGCTGACTCCGAC; crRNA-11ACTTGGGCGTTTCTTCAACTG; crRNA-12AAAGCCCTGCTTGGTGTTTT; crRNA-13AGTATAGGTGTCTTTAGGGT; crRNA-14GTGTTTGGGTGGCAATGGCCA; crRNA-15CCCACCCAGTCACCGATCTG; crRNA-16ATCCGGTAACTATGTTGGTG; crRNA-17AAGGTCTTGAGCTTTGACAC; crRNA-18ACCAGTGACCTGATTACGTG; crRNA-19GTTGGGTATCTTGATCAGGT; crRNA-20GGGTTCACACTTGCTGGGAT; crRNA-21GTCAGGAGACTTGAACTTCA.

[0021] Example 2 like Figure 1-4 As shown, the method for detecting CRISPR / Cas12a pneumoniae nucleic acid using Example 1 includes the following steps: S01. DNA was extracted from the Mycoplasma pneumoniae sample using a commercial kit magnetic bead method. S02, amplifying the extracted DNA using a PCR reaction system to obtain three specific target DNA fragments, target1, target2 and target3; S03, diluting the product after amplification of the PCR reaction system in step S02 by 10 times in a gradient manner to obtain DNA solutions of target1, target2 and target3 of different concentrations, wherein the DNA solutions include 10000 pM, 1000 pM, 100 pM, 10 pM, 1 pM, 0.1 pM and 0.01 pM; S04, using the CRISPR / Cas12a reaction system to screen the obtained DNA solutions of target1, target2 and target3 of different concentrations for single crRNA detection activity, so as to obtain active crRNA in combination; S05. Obtain active crRNA after combination, and perform combination screening of 2, 4, and 6 crRNAs for each target crRNA to determine the best crRNA combination for each target; S06, further combining the determined optimal crRNA combination of each target to form a multi-target combination comprising target1, target2 and target3, and screening to obtain an optimal multi-target combination reactant; S07. Under the condition of 37℃, the fluorescence signal was collected every 30s by using a fluorescence detection instrument, and a total of 180 times were collected. The change process of the real-time fluorescence signal intensity was analyzed and detected to optimize the reaction system of the best crRNA and target ( Figure 2 and Figure 3 ); S08, the optimal crRNA and target reaction system is tested with a test strip, the test strip is placed in a reaction tube and reacted for 5 minutes before reading the signal ( Figure 4 ).

[0022] The CRISPR / Cas12a reaction system is required for the screening of single crRNA detection activity in step S04, the combined screening of crRNA in step S05, and the formation of a multi-target combination including target1, target2, and target3 in step S06. The specific process is to add 3µl of buffer, 25nM~30nM of Cas12 enzyme, 300~450nM of single-stranded double-photolabeled DNA (ssDNA) probe, 10000pM, 1000pM, 100pM, 10pM, 1pM, 0.1pM, 0.01pM of target1, target2, and target3, and the concentration of each crRNA (1~21) is 300nM~450nM. Finally, enzyme-free water H2O is added to keep the total volume of the liquid at 30 µl.

[0023] In summary, the non-amplified CRISPR / Cas12a detection of Mycoplasma pneumoniae nucleic acid was established by constructing a crRNA library, which effectively solved the key limitation problem of dependence on special instruments and professionals in the Mycoplasma pneumoniae PCR detection process, as well as the difficulty in achieving rapid bedside detection, thereby shortening the detection time; secondly, the present invention optimizes the detection system by designing a mixed detection reaction system of library criRNA, thereby optimizing and improving the problem of low sensitivity of CRISPR / Cas12a non-amplified nucleic acid detection.

[0024] Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field and related fields without creative work should fall within the scope of protection of the present invention. The structures, devices and operating methods not specifically described and explained in the present invention are implemented according to the conventional means in the field unless otherwise specified and limited.

Claims

1. A non-amplified CRISPR / Cas12a Mycoplasma pneumoniae nucleic acid detection kit and detection method, characterized in that: include: crRNA library corresponding to the conserved sequence of Mycoplasma pneumoniae P1 fragment; CRISPR / Cas12a reaction system, which includes Buffer, Cas12a enzyme and single-stranded dual-photolabeled DNA (ssDNA) probe; Fluorescent test strips.

2. A CRISPR / Cas12a non-amplification CRISPR / Cas12a Mycoplasma pneumoniae nucleic acid detection kit according to claim 1, characterized in that, The crRNA library is a crRNA library sequence obtained by analyzing the conservation of Mycoplasma pneumoniae nucleic acid sequences and designing using CRISPR-ERA software.

3. A method for detecting Mycoplasma pneumoniae nucleic acid using CRISPR / Cas12a, based on the CRISPR / Cas12a non-amplified CRISPR / Cas12a Mycoplasma pneumoniae nucleic acid detection kit according to any one of claims 1 to 2, characterized in that: The detection method comprises the following steps: S01, DNA was extracted from the Mycoplasma pneumoniae sample; S02, amplifying the extracted DNA using a PCR reaction system to obtain three specific target DNA fragments, target1, target2 and target3; S03, diluting the product after amplification of the PCR reaction system in step S02 by 10 times in a gradient manner to obtain DNA solutions of target1, target2 and target3 of different concentrations; S04, using the CRISPR / Cas12a reaction system to screen the obtained DNA solutions of target1, target2 and target3 of different concentrations for single crRNA detection activity, so as to obtain active crRNA in combination; S05. Obtain active crRNA after combination, and perform combination screening of 2, 4, and 6 crRNAs for each target crRNA to determine the best crRNA combination for each target; S06, further combining the determined optimal crRNA combination of each target to form a multi-target combination comprising target1, target2 and target3, and screening to obtain an optimal multi-target combination reaction system; S07. Under the condition of 37°C, a fluorescence detection instrument was used to collect fluorescence signals every 30 seconds, for a total of 180 times, and the change process of the real-time fluorescence signal intensity was analyzed and detected to optimize the reaction system of the best crRNA and target; S08. Perform a test strip test on the reaction system of the optimal crRNA and target, place the test strip in a reaction tube, react for 5 minutes, and then read the signal.

4. A method for detecting Mycoplasma pneumoniae nucleic acid using CRISPR / Cas12a according to claim 3, characterized in that: The method for extracting DNA from the sample in step S01 is a magnetic bead method.

5. A method for detecting Mycoplasma pneumoniae nucleic acid using CRISPR / Cas12a according to claim 3, characterized in that: The DNA solutions of different concentrations in step S03 include 10000 pM, 1000 pM, 100 pM, 10 pM, 1 pM, 0.1 pM, and 0.01 pM.

6. A method for detecting Mycoplasma pneumoniae nucleic acid using CRISPR / Cas12a according to claim 3, characterized in that: The CRISPR / Cas12a reaction system in step S04, step S05 and step S06 includes adding Buffer with a concentration of 3 µl, adding Cas12 enzyme with a concentration of 25 nM to 30 nM, using a single-stranded double-photolabeled DNA (ssDNA) probe with a concentration of 300 to 450 nM, and the final DNA concentrations of target1, target2 and target3 are 10000 pM, 1000 pM, 100 pM, 10 pM, 1 pM, 0.1 pM, and 0.01 pM, and the concentration of each crRNA is 300 nM to 450 nM, and finally H2O is added to keep the total volume of the liquid at 30 µl.

Images