Melon fruit skin stripe SNP marker, detection method and application

Abstract

The application discloses a SNP marker of melon fruit skin stripe, a detection method and application, and belongs to the technical field of molecular markers. The SNP marker of the melon fruit skin stripe is closely linked to a dominant control fruit skin stripe gene; the nucleotide sequence shown in SEQ ID NO. 1 is highly linked to the melon fruit skin stripe trait, and the nucleotide sequence shown in SEQ ID NO. 2 is highly linked to the melon fruit skin non-stripe trait. The SNP molecular marker obtained by the application can be used for quickly and accurately identifying the fruit skin stripe trait of the melon at any growth period of the melon, and has the advantages of high efficiency and few limiting factors. The SNP marker improves the efficiency of breeding the melon fruit skin stripe trait, and shortens the breeding period. The application has important significance for melon molecular marker assisted selection breeding, improving the hybrid breeding and seed production efficiency of the melon, and guaranteeing the seed production quality.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular markers, and more particularly to a SNP marker for melon fruit peel strip, a detection method and application thereof. BACKGROUND

[0002] Melon (Cucumis melo L.) is an important cucurbitaceae crop widely planted in the world, and is also a fruit-type economic crop. It is evaluated as the fifth largest fruit in the world due to its planting area and annual consumption. Melon species originated from the Ethiopian plateau in Africa, and China is the secondary center of origin of melon species, with rich melon germplasm resources. Melon cultivation in China has a long history. There are records of melon cultivation as early as 3000 years ago, and many excellent melon varieties were bred in the Jin Dynasty. In the 1st century BC, melon cultivation methods were written in the book "Yin Duwei Shu". As a global melon cultivation power, China ranks first in the world in terms of cultivation area. Therefore, as one of the important melon crops in China, melon plays an important role in the adjustment of agricultural structure and the development of rural economy.

[0003] China has been a major melon cultivation and consumption country, with the largest cultivation area and yield in the world. As one of the important commercial traits of melon, fruit peel strip not only directly affects consumers' evaluation and willingness to purchase the variety, but also reflects the environmental and climatic conditions experienced by the variety during growth. Due to the influence of factors such as different regions, different seasons, and cultivation methods, melon fruit peel strip has very high diversity. These diverse characteristics enable consumers to have a more comprehensive understanding of the environment and growth conditions of the variety, and to choose the best quality and most desirable product that meets their taste preferences and needs.

[0004] Currently, there are some reports on the genetic law and gene positioning of fruit peel strip of cucurbitaceae crops, but only a few related genes have been cloned. Therefore, it is increasingly important to clarify the genetic law of melon fruit peel strip and fine map the genes regulating melon fruit peel strip, which provides a theoretical basis for melon fruit quality and breeding. Currently, melon fruit peel strip QTL / gene co-location is located in 11 segments, and fruit peel strip genes QTL / gene are mainly located in the long arm segment of chromosome 2. ntc2.1 and Mt-2 are located for fruit peel strip traits, and NS-S04 located on chromosome 4 of melon is also a positioning result for melon fruit peel strip as strip, but the regulation principle of fruit peel strip gene has not been explained. In recent years, the reported domestic and foreign researches show that the melon fruit peel strip trait is a recessive trait.

[0005] Therefore, it is an urgent problem for those skilled in the art to provide a SNP marker for melon fruit peel strip, a detection method and application thereof. SUMMARY

[0006] In view of this, the present invention provides a SNP marker, detection method and application for dominant control of melon peel stripes. Specifically, a molecular marker SNP_PS is provided that is tightly linked to the melon peel stripe trait. This molecular marker can be used to accurately detect whether the melon has peel stripes at the seedling stage, thereby providing assistance for the establishment of a molecular marker-assisted technology system for the melon peel stripe trait.

[0007] Based on previous research, the present invention uses a melon material 'YT-930' with peel stripes to construct a genetic population. Through genetic analysis of the peel stripe trait, a new single dominant peel stripe control gene (PS) was discovered, filling the gap in the field of melon stripe research.

[0008] In order to achieve the above object, the present invention adopts the following technical solutions:

[0009] A SNP marker for melon peel stripes, the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1 or SEQ ID NO.2; wherein the nucleotide sequence shown in SEQ ID NO.1 is highly linked to the melon peel stripe trait, and the nucleotide sequence shown in SEQ ID NO.2 is highly linked to the melon peel non-stripe trait.

[0010] Furthermore, a primer pair for detecting the SNP marker is provided, and the nucleotide sequences of the primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0011] Furthermore, a kit for detecting the SNP marker is provided, wherein the kit comprises the primer pair.

[0012] Furthermore, the SNP marker, the primer pair or the kit is used in melon breeding.

[0013] Furthermore, a method for detecting the striped trait of melon peel is provided, which determines whether the melon peel has stripes by detecting whether the melon to be tested contains the SNP marker.

[0014] Furthermore, the method for detecting the stripe trait of melon peel comprises the following specific steps:

[0015] (1) extracting genomic DNA of the melon to be tested;

[0016] (2) performing PCR amplification on genomic DNA of melon using a primer pair to obtain a PCR amplification product; the nucleotide sequences of the primer pair are shown in SEQ ID NO. 3 and SEQ ID NO. 4;

[0017] (3) sequencing the PCR amplification product to obtain a sequencing result; and comparing the sequencing result with the SNP marker to determine the melon peel stripe trait to be tested;

[0018] Alternatively, the PCR amplification product is digested with RsaI, and the result is displayed by gel electrophoresis to determine the peel stripe trait of the melon to be tested.

[0019] Furthermore, the specific operation of determining the melon peel stripe trait through sequencing results is as follows: when the sequencing result of the PCR amplification product is consistent with the sequence of SEQ ID NO.1, it indicates that the melons of the plant have the peel stripe trait; when the sequencing result of the PCR amplification product is consistent with the sequence of SEQ ID NO.2, it indicates that the melons of the plant have the peel non-stripe trait;

[0020] The specific operation of determining the melon peel stripe trait through enzyme digestion results is: when the PCR amplification product is two bands of 229bp and 121bp or four bands of 229bp, 191bp, 121bp and 38bp after enzyme digestion, the melons of this plant have the striped peel trait; when the PCR amplification product is three bands of 191bp, 121bp and 38bp after enzyme digestion, the melons of this plant have the non-stripe peel trait.

[0021] Through the above technical solutions, it can be seen that compared with the existing technology, the present invention discloses a SNP marker, detection method and application for melon peel stripes. By using BSA technology to identify SNPs, molecular markers are developed based on the identified SNPs and published melon genome data, and the F2 segregating population is scanned. In combination with the peel stripe phenotype of the population plants, molecular markers that are more closely linked to the peel stripe regulatory gene are developed. Currently, the developed molecular marker SNP_PS is closely linked to the peel stripe regulatory gene locus, and is therefore more helpful for the establishment of a molecular marker-assisted breeding system for melon peel stripe traits. The molecular markers of the present invention can be applied to melon breeding practice simply, quickly and with high throughput. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0023] Figure 1The accompanying drawings are schematic diagrams of the phenotypes of the parent (Y101) with no fruit stripes and the parent (YT-930) with fruit stripes, as well as the F1 generation individuals and F2 generation segregating populations constructed from the two parents; F2-S represents individuals with fruit stripes in the F2 generation segregating population; F2-P represents individuals without fruit stripes in the F2 generation segregating population;

[0024] Figure 2 The accompanying drawings are electrophoretic patterns of the polymorphism of the molecular marker SNP_PS of the present invention in the parents (Y101 and YT-930), F1 and F2 generation plants. DETAILED DESCRIPTION

[0025] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0026] Melon peel stripe-free material 'Y101' see patent: 202310021431.5.

[0027] The material with striped peel 'YT-930' is 'Yuntian-930'. See the reference: Gene expression characteristics of the interaction between wild melon 'Yuntian-930' and powdery mildew fungus. Liu Changming, Xianfeng, Tian Zhiguo, et al. Acta Phytopathologica Sinica 44(1): 65-73 (2014).

[0028] Example 1

[0029] like Figure 1 As shown, the melon peel stripe-free material 'Y101' was selected, and its fruit had a light green base and no stripes; the fruit peel stripe material 'YT-930' had a yellow fruit with dark green wide stripes. The present invention used 'Y101' as the male parent and 'YT-930' as the female parent to hybridize and obtain the F1 generation plants. The fruits of the F1 generation individuals were light yellow-green with dark green wide stripes ( Figure 1 F1). The F1 generation plants were self-pollinated to construct the F2 segregating population. The F2 generation population showed two phenotypes: the fruit had a light yellow-green base with dark green wide stripes ( Figure 1 F2-S) and yellow fruit without stripes ( Figure 1 F2-P).

[0030] Total DNA from leaves of the parental, F1, and F2 segregating populations was extracted using the CTAB method: the upper young leaves were quickly ground into a powder in liquid nitrogen and placed in a 1.5 ml centrifuge tube; 800 μl of preheated CTAB extraction buffer was added and the tube was incubated at 65°C in a water bath for 30 min; an equal volume of chloroform / isopropanol (with a volume ratio of chloroform to isopropanol of 24:1) was added, mixed, and centrifuged at 8000 rpm for 10 min; the supernatant was transferred to a new centrifuge tube, 2 / 3 of the volume of isopropanol was added, and the tube was gently mixed by inverting; the tube was centrifuged at 12000 rpm for 10 min; the supernatant was discarded, and the precipitate was rinsed with 75% ethanol by volume. The remaining liquid was then aspirated and dried. After drying for 3-5 min, the tube was dissolved in 100 μl of ddH2O (containing 0.1% RNase) and stored at 4°C until use.

[0031] Thirty 'Y101' and 'YT-930' plants were sampled and mixed, and total DNA was extracted from each pool to form two mixed pools. DNA-seq sequencing was performed on the two mixed pools using the HiSeq2500 paired-end sequencing technology on the Illumina platform. Then, the DNA-seq data of the two pools were analyzed using a developed program (a script written in Perl language, Marker_SNPs_V1.pl). The process is as follows: the DNA-seq data of the two mixed pools were aligned to the melon reference genome (http: / / cucurbitgenomics.org / v2 / organism / 23; Cucumis melo cv.DHL92) using Bowtie2 software, and then Tophat and Samtools software were used to search for SNPs in the alleles in the two pools.

[0032] Primers were designed based on the identified SNP locus (Chr02:26131255) and its flanking sequence in the reference genome (see SEQ ID NO. 3 and SEQ ID NO. 4). PCR amplification (PCR fragments containing SNPs) was performed using DNA extracted from the parental, F1, and F2 segregating populations as templates. The PCR amplification program was as follows: 94°C for 5 minutes; 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 40 seconds, 35 cycles; and 72°C for 5 minutes. The PCR product was cut with the corresponding restriction endonuclease (RsaI) and the results were visualized using 7.5% polyacrylamide gel electrophoresis. The polymorphic bands for the parental, F1, and F2 segregating populations are shown in the table. Figure 2The sequence of the amplified product is SEQ ID NO. 1 and SEQ ID NO. 2; the PCR fragment amplified from the striped pericarp plant 'YT-930' has one enzyme cutting site, and shows two bands with lengths of 229 bp and 121 bp on the polyacrylamide gel electrophoresis; while the PCR product amplified from the non-striped pericarp plant 'Y101' has two enzyme cutting sites, and can be cut into three small fragments with lengths of 191 bp, 121 bp and 38 bp. The F1 is a hybrid, and the PCR amplified product after enzyme cutting has four bands (229 bp, 191 bp, 121 bp and 38 bp). In the F2 separation population, the PCR amplified product after enzyme cutting has two bands (229 bp and 121 bp) or four bands (229 bp, 191 bp, 121 bp and 38 bp), then the melon of the plant has the striped pericarp trait; when the PCR amplified product after enzyme cutting has three bands (191 bp, 121 bp and 38 bp), then the melon of the plant has the non-striped pericarp trait. Therefore, the polymorphic molecular marker capable of distinguishing the striped pericarp and non-striped pericarp plants is obtained.

[0033] Upstream primer: CATTTCAAAATGTTTTTTCTAAAGGTTACTGATATAGTA; SEQ ID NO. 3;

[0034] Downstream primer: GTCACTCTCATGGTATATCTC; SEQ ID NO. 4.

[0035] The application obtains two nucleotide sequences (named as SNP_PS) of the molecular marker, SEQ ID NO. 1 and SEQ ID NO. 2, both with a length of 350 bp, and the specific position on the chromosome is Chr02:26131216-26131565.

[0036] CATTTCAAAATGTTTTTTCTAAAGGTTACTGATATAGTAAGATACACCATCGTCATATTTTCATATTTTAGTTGAATTTTGCATGAGTTAATCAAATACACCAATGTAATATTTACTATTGTTTTTTGATCGAATGATATATTATACATTACTTGATATGATATGCTTCATATTTGA TGCACAAACAATCTTACTTTTCTTTCCATTTTAAAATCTGGTATATAGATGTACTCAAATGCAGAGTATAAAGTATAAATATTCTATATAAAATATTAAATATGTCAAAACTAAACTTAACTATACAACGTTGATAGCATATTAATATAATTGAGATATACCATGAGAGTGAC; SEQ ID NO.1.

[0037] CATTTCAAAATGTTTTTTCTAAAGGTTACTGATATA GTAC GATACACCATCGTCATATTTTCATATTTTAGTTGAATTTTGCATGAGTTAATCAAATACACCATGTAATATTTACTATTGTTTTTTGATCGAATGATATATTATACATTACTTGATATGATATGCTTCATATTTGATGCACAAACAATCTTACTTTTCTTTCCATTTTAAAATCTGGTATATAGAT GTAC SEQ ID NO. 2.

[0038] The nucleotide sequence SEQ ID NO.1 obtained in the present invention is highly linked to the melon peel striped trait;

[0039] The nucleotide sequence SEQ ID NO. 2 obtained in the present invention is highly linked to the melon peel stripe-free trait.

[0040] The method for detecting whether a melon peel has stripes using the molecular markers of the present invention comprises extracting genomic DNA from the melon to be tested, performing PCR amplification on the genomic DNA of the melon using the primer pair designed above to obtain a PCR amplification product, and sequencing or RsaI enzyme digesting the PCR amplification product and then performing gel electrophoresis detection.

[0041] The specific operation of determining whether the melon peel has stripes based on the sequencing results is as follows: sequencing to obtain its nucleotide sequence, comparing the detected nucleotide sequence with the SEQ ID NO.1 sequence to see if they are consistent. If they are consistent (the band can be digested by the restriction endonuclease RsaI to form two fragments), it indicates that the melons of this plant have a striped peel trait; if they are inconsistent, but consistent with the SEQ ID NO.2 sequence (the band can be digested by the restriction endonuclease RsaI to form three fragments), it indicates that the melons of this plant have a non-striped peel trait.

[0042] The specific operation of determining whether the melon peel has stripes through enzyme digestion results is as follows: when the PCR amplification product is two bands (229bp and 121bp) or four bands (229bp, 191bp, 121bp and 38bp) after enzyme digestion, the melons of this plant have the striped peel trait; when the PCR amplification product is three bands (191bp, 121bp and 38bp) after enzyme digestion, the melons of this plant have the non-striped peel trait.

[0043] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A SNP marker for melon peel stripes, characterized in that: The nucleotide sequences of the SNP markers are shown in SEQ ID NO.1 and SEQ ID NO.2; wherein, the nucleotide sequence shown in SEQ ID NO.1 is highly linked to the melon peel striped trait, and the nucleotide sequence shown in SEQ ID NO.2 is highly linked to the melon peel striped trait.

2. Use of the SNP marker according to claim 1 in molecular marker-assisted breeding for melon peel stripe traits, characterized in that: The melons are F1 generation plants of the male parent 'Y101' and the female parent 'YT-930' and a self-pollinated F2 generation segregating population.

3. A method for detecting melon peel stripe traits, characterized in that: determining whether the melon has stripes on its peel by detecting whether the melon contains the SNP marker according to claim 1; The specific steps are as follows: (1) Extracting genomic DNA from the melon to be tested; (2) performing PCR amplification on genomic DNA of melon using a primer pair to obtain a PCR amplification product; the nucleotide sequences of the primer pair are shown in SEQ ID NO. 3 and SEQ ID NO. 4; (3) sequencing the PCR amplification product to obtain a sequencing result; and comparing the sequencing result with the SNP marker according to claim 1 to determine the peel stripe trait of the melon to be tested; or performing RsaI digestion on the PCR amplification product, and then displaying the result by gel electrophoresis to determine the peel stripe trait of the melon to be tested; The specific operation of determining the melon peel stripe trait through sequencing results is as follows: when the sequencing result of the PCR amplification product is consistent with the sequence of SEQ ID NO.1, it indicates that the melons of the plant have the peel stripe trait; when the sequencing result of the PCR amplification product is consistent with the sequence of SEQ ID NO.2, it indicates that the melons of the plant have the peel non-stripe trait; The specific operation of determining the melon peel stripe trait through enzyme digestion results is as follows: if the PCR amplification product is digested by enzymes and is two bands of 229 bp and 121 bp or four bands of 229 bp, 191 bp, 121 bp and 38 bp, the melon of this plant has the peel stripe trait; When the PCR amplification product is digested with enzymes, it will be three bands of 191 bp, 121 bp and 38 bp, which means that the melon of this plant has the trait of no stripes on the skin; The melons are F1 generation plants of the male parent 'Y101' and the female parent 'YT-930' and a self-pollinated F2 generation segregating population.

Images