Bio-based plastic film and preparation method thereof

Abstract

The invention discloses a bio-based plastic film and a preparation method thereof, and belongs to the technical field of plastic production. According to the method, glucosyltransferase generated by enzyme-producing bacteria is added into a sucrose raw material to catalyze to generate alpha-1, 3-glucan, and TEMPO is used for mediating an oxidation reaction to form an oxidation complex. Finally, the biological plastic film is further prepared through physical-chemical bi-crosslinking. According to the invention, environmental pollution can be effectively relieved, resource reutilization is completed, and the method has important significance for environmental protection and sustainable development of society. The preparation method disclosed by the invention is simple and efficient in preparation process, low in energy consumption and relatively low in cost, has an industrial prospect, and provides a new idea for production innovation of degradable bioplastics.

Description

Technical Field

[0001] The invention relates to the technical field of plastic production, and in particular to a bio-based plastic film and a preparation method thereof. Background Art

[0002] Polymer materials are light in weight, low in cost, and have good mechanical properties. They have gradually become the main materials in various fields. Petroleum-based polymers are often criticized for their serious environmental pollution. Over time, bio-based polymers have gradually attracted people's attention. To date, commercial degradable bioplastics are also constantly developing. Most of the widely used bioplastics are starch-based bioplastics, PLA (polylactic acid), and PBAT (polybutylene adipate terephthalate). However, there are still certain problems: high synthesis cost; harsh degradation conditions, must be rapidly degraded under composting conditions, and still have a harmful effect on the environment to a certain extent; at the same time, bio-based degradable plastics are mostly synthesized from corn starch, or sugar in sugarcane and beets as raw materials, which will compete with people for food, resulting in a waste of resources.

[0003] Therefore, recycling resources and improving the efficiency of degradation have become the top priorities of sustainable development. We focus on sugar wastewater, the main component of which is sucrose, which can participate in the synthesis of bio-based plastics. From this point of view, wastewater is a resource that is placed in the wrong place. If we subject sugar wastewater to the catalysis of glucosyltransferase, we can obtain a product with certain economic value - α-1,3-glucan. This component can be oxidized and physically and chemically modified to improve the dispersibility of bioplastics and their solubility in water. Summary of the invention

[0004] The object of the present invention is to provide a bio-based plastic and a preparation method thereof.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] In a first aspect, the present invention claims a method for preparing a bio-based plastic film, the method comprising the following steps:

[0007] 1) Preparation of glucosyltransferase: fermenting the enzyme-producing bacteria in a fermentation medium containing antibiotics, adding an inducer to induce expression, collecting the supernatant to obtain a sterile enzyme solution, and freezing and storing at -55°C;

[0008] 2) catalytic synthesis of α-1,3-glucan: adding an enzymatic reaction solution containing sucrose to the sterile enzyme solution obtained in step 1) to carry out an enzymatic reaction, centrifuging and discarding the supernatant after the reaction is completed, and adding pure water to dissolve the α-1,3-glucan to obtain an α-1,3-glucan solution;

[0009] 3) Preparation of bio-based plastics: The α-1,3-glucan solution obtained in step 2) is mixed with TEMPO to initiate an oxidation reaction, the TEMPO-oxidation complex obtained by the oxidation reaction is centrifuged to retain the supernatant, and ultrasonically crushed in an ice bath to obtain a dispersion with high uniformity, the dispersion is immersed in a reagent for cross-linking to obtain a physical-chemical double cross-linked body, the physical-chemical double cross-linked body is spread on a PTFE filter membrane, vacuum filtered, and dried to obtain a degradable bio-based plastic film.

[0010] Furthermore, the enzyme-producing bacteria in step 1) is Streptococcus salivarius producing glucosyltransferase or modified Bacillus subtilis after GtfJ gene modification;

[0011] The construction process of the modified Bacillus is as follows: designing primers F1 and R1, performing PCR amplification using genomic DNA of Streptococcus salivarius as a template, connecting the obtained amplified product with a pET28a plasmid double-digested with BamHI and NotI, and constructing a pET28a-GtfJ recombinant plasmid;

[0012] Using pET28a-GtfJ recombinant plasmid as template, the GtfJ gene fragment was amplified by primers F2 and R2 and Gibson ligated with pBA300 vector digested with XbaI to construct the pBA300-GtfJ recombinant vector, which was then transformed into Bacillus WB800N to obtain the modified Bacillus WB800N / pBA300-GtfJ.

[0013] Furthermore, the nucleotide sequences of the primers F1 and R1 are:

[0014] F1: GAAGGAGAAAGGTACATGCACCATCACCATCACCATGAGAATAAAATAC

[0015] R1: CATGGTACCTTTCTCCTCTTTAGTTCAGAACGCGCGGCGGATAC

[0016] The nucleotide sequences of the primers F2 and R2 are:

[0017] F2: GCCGATTACAAAAACATCAGCCCACCATCACCATCACCATGAG

[0018] R2: GCCCGCTCATTAGGCGGGCTGCTTAGTTCAGAACGCGCGGCGGATAC.

[0019] The construction process of the above-mentioned pBA300 vector is as follows:

[0020] (1) Backbone: pXB300 cut with XhoI and AhdI (7419+963 bp), 7419 bp fragment recovered;

[0021] (2) Fragment: Using plasmid pIJ773 (commercially available) as a template and primers aprFor and aprRev, apr resistance gene (1019 bp) was amplified;

[0022] (3) After GB ligation, transfer into DH5a to obtain pBA300 vector.

[0023] aprFor:CTCGATTTGTTTTTCCAGATCACGGTAACTGATGCCGTA

[0024] aprRev:CATCCATAGTTGCCTGACTCCTCAGCCAATCGACTGGCGAG.

[0025] In a specific embodiment of the present invention, the Streptococcus salivarius is Streptococcus salivarius ATCC 25975.

[0026] Furthermore, the antibiotic in step 1) is kanamycin.

[0027] Furthermore, the fermentation conditions in step 1) are: fermentation at 37°C until the OD value is between 0.6-0.8; the induction expression conditions are: adding inducer IPTG (isopropyl-β-D-thiogalactoside), 15-20°C (preferably 16°C), 200rpm, and culturing for 18-20h.

[0028] Furthermore, the enzymatic reaction solution in step 2) is a 342.3 g / L sucrose solution prepared with a citric acid buffer solution having a pH of 5.5 as a solvent, and is filtered and sterilized.

[0029] The citric acid buffer is a conventional laboratory formula. In a specific embodiment of the present invention, the preparation method of the citric acid buffer is as follows: 5.78g of citric acid monohydrate and 21.32g of trisodium citrate are taken, and after complete dissolution, the pH is adjusted to 5.5 with 1M NaOH or HCl, and the volume is fixed to 1L as the citric acid buffer.

[0030] Furthermore, the conditions of the enzymatic reaction in step 2) are: standing reaction at 15-40°C for 20-30h (preferably standing reaction at 30°C for 24h).

[0031] In a specific embodiment of the present invention, the centrifugal conditions after the enzymatic reaction in step 2) are: 10000 rpm, centrifugation for 30 min.

[0032] Furthermore, the pH of the oxidation reaction in step 3) is 9-11, preferably, the pH is 10.

[0033] In a specific embodiment of the present invention, the centrifugation conditions of the TEMPO-oxidation complex in step 3) are: 4000 rpm, centrifugation for 10 min. The ultrasonic disruption conditions are: 50% power, 5 s interval, disruption for 1 h.

[0034] Furthermore, in step 3), the process of immersing the dispersion in the reagent for crosslinking is as follows: adding ECH to the dispersion for chemical crosslinking, and then immersing the wet matrix in a CaCl2 solution for physical crosslinking.

[0035] In a specific embodiment of the present invention, in step 3), the physical-chemical double cross-linked body is spread on a PTFE filter membrane (pore size 0.1 μm, diameter 47 mm) for vacuum filtration; and then dried at 40° C. and 90% relative humidity for 12 hours.

[0036] In a specific embodiment of the present invention, the method for preparing the bio-based plastic specifically comprises the following steps:

[0037] 1) Preparation of glucosyltransferase: Add the enzyme-producing bacteria to LB liquid culture medium containing kanamycin, place in a shaker, and activate and culture for 16 hours at 37°C to obtain seed liquid. Add the seed liquid to the fermentation medium containing kanamycin, place in a shaker, and ferment and culture at 37°C until the OD value is between 0.6-0.8. Add IPTG to the cultured bacterial liquid to induce expression, place in a shaker, 16°C, 200rpm, and culture for 18-20h. Add the induced bacterial liquid to a centrifuge bottle, centrifuge at 10000rpm for 20min. Collect the resulting supernatant and store it in a -55°C freezer for later use.

[0038] 2) Catalytic synthesis of α-1,3-glucan: Add the sterile enzyme solution in step 1) to the enzymatic reaction solution (take 5.78g of citric acid monohydrate and 21.32g of trisodium citrate, adjust the pH to 5.5 with 1M NaOH or HCl after complete dissolution, and make the volume to 1L as citric acid buffer, use this as solvent, prepare 1L of 342.3g / L sucrose solution, filter and sterilize), and let it stand at 30°C for 24h. Centrifuge the product at 10000rpm for 30min, pour off the supernatant, add sterile water to resuspend the obtained glucan, centrifuge again, repeat the operation several times, and after the last centrifugation, add pure water to make the weight of α-1,3-glucan equal to that of the initial enzymatic reaction system, and store it in a -4°C refrigerator for later use.

[0039] 3) Preparation of bio-based plastics: TEMPO was added to the α-1,3-glucan solution in step 2) to initiate an oxidation reaction, and the pH was controlled to 10. The TEMPO-oxidation complex obtained by the oxidation reaction was repeatedly centrifuged at 4000 rpm for 10 min, and the supernatant was poured into a beaker. It was placed in an ultrasonic crusher under ice bath conditions, 50% power, 5s interval, and crushed for 1 hour to ensure high dispersion uniformity. ECH was added to the dispersion for cross-linking, and stirred for 1 hour. A chemical cross-linking reaction was carried out at room temperature for 12 hours. The wet matrix was immersed in a 0.1M CaCl2 solution for 8 hours of physical cross-linking, spread on a PTFE filter membrane (pore size 0.1 μm, diameter 47 mm) and vacuum filtered, and dried at 40°C and 90% relative humidity for 12 hours to obtain a bio-based plastic film.

[0040] In a second aspect, the present invention seeks to protect the bio-based plastic film prepared by the above method.

[0041] The present invention induces the cultivation of enzyme-producing bacteria to generate glucosyltransferase, which has the ability to cut and transfer glucan sugar chains. In the process of glucan synthesis, glucosyltransferase branches and modifies the structure of linear glucan chains by cutting and transferring them, forming rich branched structures. It affects the water solubility, dispersibility and cell wall structure and function of glucan. Under the action of glucosyltransferase generated by enzyme-producing bacteria, sucrose can obtain an intermediate product α-1,3-glucan with certain economic value. Polysaccharides undergo oxidation reaction under the action of TEMPO to form an oxidized complex, which can show high crystallinity, high aspect ratio, high tensile strength, high Young's modulus and low thermal expansion coefficient. A cross-linking agent is added to introduce covalent bonds between the hydroxyl groups of the polysaccharide, and a highly ordered anisotropic structure can be generated by covalent bonds and hydrogen bonds. The present invention proposes a physical-chemical double cross-linking method to synthesize a bio-based plastic film. The oxidized complex in the colloidal suspension is chemically cross-linked by simply mixing with an ECH solution; and then physically cross-linked by immersing in a calcium chloride solution. The carboxylate ions in the oxidized complex have a strong affinity with the metal ions, thereby forming a metal-carboxylate complex. It has good flexibility, good mechanical strength, excellent thermal stability and excellent water resistance.

[0042] The room temperature described in the present invention is 25±10° C., but is not limited thereto.

[0043] Beneficial effects of the present invention:

[0044] The bio-based plastic prepared by the present invention has high mechanical properties and stability. At the same time, sucrose, the main component of sugar wastewater, can be used as a raw material for repeated use, turning waste into treasure, which can effectively alleviate the problem of resource waste and environmental pollution, and is of great significance for environmental and social sustainable development. The preparation process used in the present invention is green, environmentally friendly, simple and efficient, has the advantages of low cost, industrialization possibility, certain innovation, etc., and lays a foundation for the practical application of high-performance bio-based plastics. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is the gel electrophoresis image of the modified Gtfj gene in Comparative Example 1 of the present invention.

[0046] Figure 2 This is a growth curve of the modified Bacillus in Comparative Example 1 of the present invention.

[0047] Figure 3 This is a comparison chart of the yields of α-1,3-glucan produced by different enzyme-producing bacteria in Comparative Example 1 of the present invention.

[0048] Figure 4 This is a comparison chart of the yield and molecular weight of α-1,3-glucan generated at different temperatures and enzymatic reaction times in Comparative Example 2 of the present invention.

[0049] Figure 5 FIG. 1 is a schematic diagram of the chemical formula of the TEMPO catalytic oxidation process of the present invention.

[0050] Figure 6 This is a comparison chart of thermal stability under different crosslinking methods in Comparative Example 3 of the present invention.

[0051] Figure 7 This is a comparison chart of strain-stress changes under different crosslinking methods in comparative example 3 of the present invention.

[0052] Figure 8 This is a comparison chart of tensile strength under different crosslinking methods in Comparative Example 3 of the present invention.

[0053] Fig. 9 This is a comparison chart of Young's modulus under different crosslinking methods in Comparative Example 3 of the present invention.

[0054] Fig.10 The α-1,3-glucan produced in Example 2 of the present invention 1 H-NMR spectrum.

[0055] Fig.11 The α-1,3-glucan produced in Example 2 of the present invention 13 C-NMR spectroscopy.

[0056] Fig.12 Schematic diagram of the chemical formula of the physical-chemical double cross-linking process of Example 2 of the present invention. DETAILED DESCRIPTION

[0057] The present invention will be further described below in conjunction with the embodiments so that those skilled in the art can better understand the present invention. The present invention will be further described below in conjunction with the drawings and embodiments of the specification. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. On the contrary, the present invention covers any substitution, modification, equivalent method and scheme made on the essence and scope of the present invention as defined by the claims.

[0058] Example 1 Construction of modified Bacillus subtilis

[0059] Extract genomic DNA of Streptococcus salivarius ATCC 25975 (Giffard PM, et al. Sequence of the gtfK gene of Streptococcus salivarius ATCC 25975 and evolution of the gtf genes of oral streptococci. J. Gen. Microbiol. 139: 1511-1522, 1993. Hamilton IR. Synthesis and degradation of intracellular polyglucose in Streptococcus salivarius. Can. J. Microbiol. 14: 65-77, 1968.), design primers F1 and R1 to perform PCR amplification using the genomic DNA of Streptococcus salivarius ATCC 25975 as a template, and connect the obtained amplified product with the pET28a plasmid double-digested with BamHI and NotI to construct a pET28a-GtfJ recombinant plasmid;

[0060] The nucleotide sequences of the primers F1 and R1 are:

[0061] F1: GAAGGAGAAAGGTACATGCACCATCACCATCACCATGAGAATAAAATAC

[0062] R1: CATGGTACCTTTCTCCTCTTTAGTTCAGAACGCGCGGCGGATAC

[0063] Using pET28a-GtfJ recombinant plasmid as template, the GtfJ gene fragment was amplified by primers F2 and R2 and Gibson ligated with pBA300 vector digested with XbaI to construct the pBA300-GtfJ recombinant vector, which was then transformed into Bacillus WB800N to obtain the modified Bacillus WB800N / pBA300-GtfJ.

[0064] The nucleotide sequences of the primers F2 and R2 are:

[0065] F2: GCCGATTACAAAAACATCAGCCCACCATCACCATCACCATGAG

[0066] R2: GCCCGCTCATTAGGCGGGCTGCTTAGTTCAGAACGCGCGGCGGATAC.

[0067] The construction process of the pBA300 vector is:

[0068] (1) Backbone: pXB300 cut with XhoI and AhdI (7419+963 bp), 7419 bp fragment recovered;

[0069] (2) Fragment: Using plasmid pIJ773 (commercially available) as a template and primers aprFor and aprRev, apr resistance gene (1019 bp) was amplified;

[0070] (3) After GB ligation, transfer into DH5a to obtain pBA300 vector.

[0071] aprFor:CTCGATTTGTTTTTCCAGATCACGGTAACTGATGCCGTA

[0072] aprRev:CATCCATAGTTGCCTGACTCCTCAGCCAATCGACTGGCGAG.

[0073] Comparative Example 1: Comparison of the production efficiency of α-1,3-glucan by modified Bacillus subtilis and unmodified Streptococcus salivarius

[0074] 1) Induce enzyme production: Take 15mL of the prepared LB liquid medium, put it into a centrifuge tube, add 100μL 50mg / mL kanamycin as an antibiotic, inoculate the modified Bacillus or Streptococcus salivarius (ATCC25975) constructed in Example 1, put it into a shaker, culture at 37°C, and activate it for 16h. Inject the bacterial solution into the fermentation medium at a volume ratio of 1:100, add 700μL of 50mg / mL kanamycin, put it into a shaker, culture at 37°C, and mix until the OD value is between 0.6-0.8. Add 600μL IPTG inducer to the cultured bacterial solution for induction, put it into a shaker, and culture it at 16°C and 200rpm for 18h. Add the induced bacteria to a centrifuge bottle, centrifuge at 10000rpm for 20min. Collect the resulting supernatant and store it in a -55°C freezer for standby use.

[0075] The formula of fermentation medium is: 48mlA+1mlB+1mlC+100ulD+50ulE

[0076] A: 1% peptone, 0.5% yeast extract.

[0077] B: 1.25M disodium hydrogen phosphate, 1.25M potassium dihydrogen phosphate, 2.5M ammonium chloride, 0.25M sodium sulfate.

[0078] C: 25% (v / v) glycerol + 2.5% (g / 100ml) glucose.

[0079] D: 1M magnesium sulfate.

[0080] E: 8.13 g / L FeCl3, 2.2 g / L CaCl2, 1.98 g / L MnCl2·4H2O, 2.88 g / L ZnSO4·7H2O, 0.5 g / L CoCl2·6H2O, 0.48 g / L Na2MoO4·2H2O, 0.12 g / L H3BO3 dissolved in 60 mM HCl.

[0081] A, B, C, and D are sterilized separately by high temperature, and E is sterilized by filtration.

[0082] 2) Synthesis of α-1,3-glucan: Add 12 ml of the sterile enzyme solution in step 1) to 200 mL of the enzymatic reaction solution (take 5.78 g of citric acid monohydrate and 21.32 g of trisodium citrate, adjust the pH to 5.5 with 1 M NaOH or HCl after complete dissolution, and dilute to 1 L as citric acid buffer, use this as solvent, prepare 1 L of 342.3 g / L sucrose solution, filter and sterilize), and let stand at 30°C for 24 hours. Transfer the sample to a centrifuge bottle and centrifuge at 10,000 rpm for 30 minutes, pour off the supernatant, add sterile water to resuspend the obtained glucan, centrifuge again, repeat the operation several times, and after the last centrifugation, add pure water to make the volume of α-1,3-glucan equal to that of the initial enzymatic reaction system, and store in a -4°C refrigerator for later use.

[0083] The genome was extracted from Streptococcus salivarius ATCC 25975, and the GtfJ gene was amplified using primers F1 and R1. The target gene was amplified by PCR using the super-fidelity DNA polymerase system of Novozymes, and the gel electrophoresis image of the modified GtfJ gene was obtained, as shown in the figure below. Figure 1 The growth curve of the modified Bacillus was measured, as shown in Figure 2 The mass of the obtained α-1,3-glucan was measured respectively, as shown in Figure 3 shown.

[0084] The nucleotide sequences of primers F1 and R1 are:

[0085] F1: GAAGGAGAAAGGTACATGCACCATCACCATCACCATGAGAATAAAATAC

[0086] R1: CATGGTACCTTTCTCCTCTTTAGTTCAGAACGCGCGGCGGATAC

[0087] Comparative Example 2: Comparison of α-1,3-glucan production efficiency under different enzymatic temperatures and reaction times

[0088] 1) Induce enzyme production: Take 15mL of the prepared LB liquid medium, put it into a centrifuge tube, add 100μL 50mg / mL kanamycin as an antibiotic, inoculate the modified Bacillus constructed in Example 1, put it into a shaker, culture at 37°C, and activate it for 16h. Inject the bacterial solution into the fermentation medium at a volume ratio of 1:100 (the fermentation medium formula is the same as that of Comparative Example 1), add 700μL of 50mg / mL kanamycin, put it into a shaker, culture at 37°C, and mix until the OD value is between 0.6-0.8. Add 600μL IPTG inducer to the cultured bacterial solution for induction, put it into a shaker, 16°C, 200rpm, and culture for 18h. Add the induced bacteria to a centrifuge bottle, centrifuge at 10000rpm for 20min. Collect the resulting supernatant and store it in a -55°C freezer for standby use.

[0089] 2) Synthesis of α-1,3-glucan: Add 12 ml of the sterile enzyme solution in step 1) to 200 mL of enzymatic reaction solution (the enzymatic reaction solution is the same as that in Comparative Example 1), and let it stand at 30°C for 24 hours, or at 15°C for 72 hours. Transfer the sample to a centrifuge bottle, centrifuge at 10,000 rpm for 30 minutes, pour off the supernatant, add sterile water to resuspend the obtained glucan, centrifuge again, repeat the operation several times, and after the last centrifugation, add pure water to make the volume of α-1,3-glucan equal to that of the initial enzymatic reaction system, and store in a -4°C refrigerator for later use. Measure the mass of the obtained α-1,3-glucan, such as Figure 4 shown.

[0090] Comparative Example 3: Comparison of physical properties of bio-based plastics under different cross-linking states

[0091] 1) Induce enzyme production: Take 15mL of the prepared LB liquid medium, put it into a centrifuge tube, add 100μL 50mg / mL kanamycin as an antibiotic, inoculate the modified Bacillus constructed in Example 1, put it into a shaker, culture at 37°C, and activate it for 16h. Inject the bacterial solution into the fermentation medium at a volume ratio of 1:100 (the fermentation medium formula is the same as that of Comparative Example 1), add 700μL of 50mg / mL kanamycin, put it into a shaker, culture at 37°C, and mix until the OD value is between 0.6-0.8. Add 600μL IPTG inducer to the cultured bacterial solution for induction, put it into a shaker, 16°C, 200rpm, and culture for 18h. Add the induced bacteria to a centrifuge bottle, centrifuge at 10000rpm for 20min. Collect the resulting supernatant and store it in a -55°C freezer for standby use.

[0092] 2) Synthesis of α-1,3-glucan: 12 ml of the sterile enzyme solution in step 1) was added to 200 mL of the enzymatic reaction solution (the enzymatic reaction solution was the same as that in Comparative Example 1), and allowed to stand at 30°C for 24 h. The sample was transferred to a centrifuge bottle and centrifuged at 10,000 rpm for 30 min. The supernatant was poured off, and sterile water was added to resuspend the obtained glucan, and the mixture was centrifuged again. The operation was repeated several times. After the last centrifugation, pure water was added to make the weight of α-1,3-glucan equal to that of the initial enzymatic reaction system, and the mixture was stored in a -4°C refrigerator for later use.

[0093] 3) Preparation of bio-based plastics: The α-1,3-glucan solution in step 2) was transferred to a centrifuge bottle and centrifuged at 10000 rpm for 10 min. The supernatant was poured out, and 10 g of α-1,3-glucan dry matter was added to a mixed solution of 1 g NaBr, 50 mL 6% NaClO solution, and 0.16 g TEMPO (2,2,6,6-tetramethylpiperidin-1-oxyl free radical) to initiate oxidation (e.g. Figure 5 The pH was controlled to 10. The obtained TEMPO-oxidation complex was centrifuged repeatedly at 4000rpm for 10min, and the supernatant was poured into a beaker. It was placed in an ultrasonic crusher under ice bath conditions, 50% power, 5s interval, and crushed for 1h to ensure high dispersion uniformity. The oxidation dispersion was directly dried at 40°C and 90% relative humidity for 12h to obtain a pure bioplastic film (neat), and its physical properties were measured; or 5.71g ECH (epichlorohydrin) was added for cross-linking, and stirred for 1h. The wet matrix was subjected to chemical cross-linking reaction at room temperature for 12h, and dried at 40°C and 90% relative humidity for 12h to obtain a chemically cross-linked bioplastic film (CC), and its physical properties were measured; or the wet matrix was immersed in 0.1M CaCl2 solution for 8h of physical cross-linking, spread on a PTFE filter membrane (pore size 0.1μm, diameter 47mm) for vacuum filtration, and dried at 40°C and 90% relative humidity for 12h to obtain a double-cross-linked bio-based plastic film (DC). The thermal stability was measured separately, such as Figure 6 The stress-strain curves are measured respectively, as shown in Figure 7 As shown. The tensile strength is measured respectively, as Figure 8 As shown. The Young's modulus is measured respectively, as Fig. 9 shown.

[0094] Example 2

[0095] 1) Induce enzyme production: Take 15mL of the prepared LB liquid medium, put it into a centrifuge tube, add 100μL 50mg / mL kanamycin as an antibiotic, inoculate the modified Bacillus constructed in Example 1, put it into a shaker, culture at 37°C, and activate it for 16h. Inject the bacterial solution into the fermentation medium at a volume ratio of 1:100 (the fermentation medium formula is the same as that of Comparative Example 1), add 700μL of 50mg / mL kanamycin, put it into a shaker, culture at 37°C, and mix until the OD value is between 0.6-0.8. Add 600μL IPTG inducer to the cultured bacterial solution for induction, put it into a shaker, 16°C, 200rpm, and culture for 18h. Add the induced bacteria to a centrifuge bottle, centrifuge at 10000rpm for 20min. Collect the resulting supernatant and store it in a -55°C freezer for standby use.

[0096] 2) Synthesis of α-1,3-glucan: Add 12 ml of the sterile enzyme solution in step 1) to 200 mL of the enzymatic reaction solution (the enzymatic reaction solution is the same as that in Comparative Example 1), and let stand at 30°C for 24 hours. Transfer the sample to a centrifuge bottle, centrifuge at 10,000 rpm for 30 minutes, pour off the supernatant, add sterile water to resuspend the obtained glucan, centrifuge again, repeat the operation several times, and after the last centrifugation, add pure water to make the weight of α-1,3-glucan equal to that of the initial enzymatic reaction system, and store in a -4°C refrigerator for later use (its one-dimensional nuclear magnetic resonance spectrum is as follows Fig.10 , Fig.11 shown).

[0097] 3) Preparation of bio-based plastics: 10g of α-1,3-glucan solution in step 2) was added to a mixed solution of 1g NaBr, 50mL 6% NaClO solution, and 0.16g TEMPO to initiate oxidation, and the pH was controlled to 10. The obtained TEMPO-oxidation complex was repeatedly centrifuged at 4000rpm for 10min, and the supernatant was poured into a beaker. It was placed in an ultrasonic crusher under ice bath conditions, 50% power, 5s interval, and crushed for 1h to ensure high dispersion uniformity. 5.71g ECH was added to the oxidation dispersion for cross-linking, and stirred for 1h. The wet matrix was subjected to chemical cross-linking reaction at room temperature for 12h, and the wet matrix was immersed in 0.1M CaCl2 solution for physical cross-linking for 8h (the chemical formula of the double cross-linking process is as follows: Fig.12 As shown), spread on a PTFE filter membrane (pore size 0.1 μm, diameter 47 mm) and vacuum filtered, and dried at 40° C. and 90% relative humidity for 12 h to obtain a double-crosslinked bio-based plastic film.

[0098] Example 3

[0099] 1) Induce enzyme production: Take 15mL of the prepared LB liquid medium, put it into a centrifuge tube, add 100μL 50mg / mL kanamycin as an antibiotic, inoculate Streptococcus salivarius (ATCC 25975), put it into a shaker, culture at 37°C, and activate it for 16h. Inject the bacterial solution into the fermentation medium at a volume ratio of 1:100 (the fermentation medium formula is the same as that of Comparative Example 1), add 700μL of 50mg / mL kanamycin, put it into a shaker, culture at 37°C, and mix until the OD value is between 0.6-0.8. Add 600μL IPTG inducer to the cultured bacterial solution for induction, put it into a shaker, 16°C, 200rpm, and culture for 18h. Add the induced bacteria to a centrifuge bottle, centrifuge at 10000rpm for 20min. Collect the resulting supernatant and store it in a -55°C freezer for standby use.

[0100] 2) Synthesis of α-1,3-glucan: 12 ml of the sterile enzyme solution in step 1) was added to 200 mL of the enzymatic reaction solution (the enzymatic reaction solution was the same as that in Comparative Example 1), and allowed to stand at 15°C for 72 h. The sample was transferred to a centrifuge bottle and centrifuged at 10,000 rpm for 30 min. The supernatant was poured off, and sterile water was added to resuspend the obtained glucan, and the mixture was centrifuged again. The operation was repeated several times. After the last centrifugation, pure water was added to make the weight of α-1,3-glucan equal to that of the initial enzymatic reaction system, and the mixture was stored in a -4°C refrigerator for later use.

[0101] 3) Preparation of bio-based plastics: 10g of α-1,3-glucan solution in step 2) was added to a mixed solution of 1g NaBr, 50mL 6% NaClO solution, and 0.16g TEMPO to initiate oxidation, and the pH was controlled to 10. The obtained TEMPO-oxidation complex was centrifuged repeatedly at 4000rpm for 10min, and the supernatant was poured into a beaker. It was placed in an ultrasonic crusher under ice bath conditions, 50% power, 5s interval, and crushed for 1h to ensure high dispersion uniformity. 5.71g ECH was added to the oxidized dispersion for cross-linking, and stirred for 1h. The wet matrix was subjected to chemical cross-linking reaction at room temperature for 12h, and the wet matrix was immersed in 0.1M CaCl2 solution for physical cross-linking for 8h, spread on a PTFE filter membrane (pore size 0.1μm, diameter 47mm) and vacuum filtered, and dried at 40°C and 90% relative humidity for 12h to obtain a double cross-linked bio-based plastic film.

[0102] Example 4

[0103] 1) Induce enzyme production: Take 15mL of the prepared LB liquid medium, put it into a centrifuge tube, add 100μL 50mg / mL kanamycin as an antibiotic, inoculate the modified Bacillus constructed in Example 1, put it into a shaker, culture at 37°C, and activate it for 16h. Inject the bacterial solution into the fermentation medium at a volume ratio of 1:100 (the fermentation medium formula is the same as that of Comparative Example 1), add 700μL of 50mg / mL kanamycin, put it into a shaker, culture at 37°C, and mix until the OD value is between 0.6-0.8. Add 600μL IPTG inducer to the cultured bacterial solution for induction, put it into a shaker, 16°C, 200rpm, and culture for 18h. Add the induced bacteria to a centrifuge bottle, 10000rpm, and centrifuge for 20min. Collect the resulting supernatant and store it in a -55°C freezer for standby use.

[0104] 2) Synthesis of α-1,3-glucan: 12 ml of the sterile enzyme solution in step 1) was added to 200 mL of the enzymatic reaction solution (the enzymatic reaction solution was the same as that in Comparative Example 1), and allowed to stand at 15°C for 72 h. The sample was transferred to a centrifuge bottle and centrifuged at 10,000 rpm for 30 min. The supernatant was poured off, and sterile water was added to resuspend the obtained glucan, and the mixture was centrifuged again. The operation was repeated several times. After the last centrifugation, pure water was added to make the weight of α-1,3-glucan equal to that of the initial enzymatic reaction system, and the mixture was stored in a -4°C refrigerator for later use.

[0105] 3) Preparation of bio-based plastics: 10g of α-1,3-glucan solution in step 2) was added to a mixed solution of 1g NaBr, 50mL 6% NaClO solution, and 0.16g TEMPO to initiate oxidation, and the pH was controlled to 10. The obtained TEMPO-oxidation complex was centrifuged repeatedly at 4000rpm for 10min, and the supernatant was poured into a beaker. It was placed in an ultrasonic crusher under ice bath conditions, 50% power, 5s interval, and crushed for 1h to ensure high dispersion uniformity. 5.71g ECH was added to the oxidized dispersion for cross-linking, and stirred for 1h. The wet matrix was subjected to chemical cross-linking reaction at room temperature for 12h, and the wet matrix was immersed in 0.1M CaCl2 solution for physical cross-linking for 8h, spread on a PTFE filter membrane (pore size 0.1μm, diameter 47mm) and vacuum filtered, and dried at 40°C and 90% relative humidity for 12h to obtain a double cross-linked bio-based plastic film.

[0106] Example 5

[0107] Preparation of bio-based plastics: 10 g of cellulose powder was added to a mixed solution of 1 g NaBr, 50 mL of 6% NaClO solution, and 0.16 g TEMPO to initiate oxidation, and the pH was controlled to 10. The obtained TEMPO-oxidized body was centrifuged repeatedly at 4000 rpm for 10 min, and the supernatant was poured into a beaker. It was placed in an ultrasonic crusher under ice bath conditions, 50% power, 5s interval, and crushed for 1 h to ensure high dispersion uniformity. The oxidized dispersion was added with 5.71 g ECH for cross-linking, and stirred for 1 h. The wet matrix was subjected to chemical cross-linking reaction at room temperature for 12 h, and the wet matrix was immersed in 0.1 M CaCl2 solution for physical cross-linking for 8 h, spread on a PTFE filter membrane, and vacuum filtered. It was dried at 40 ° C and 90% relative humidity for 12 h to obtain a double cross-linked bio-based plastic film.

Claims

1. A method for preparing a bio-based plastic film, characterized in that: The method comprises the following steps: 1) Preparation of glucosyltransferase: fermenting the enzyme-producing bacteria in a fermentation medium containing antibiotics, adding an inducer to induce expression, and collecting the supernatant to obtain a sterile enzyme solution; 2) catalytic synthesis of α-1,3-glucan: adding an enzymatic reaction solution containing sucrose to the sterile enzyme solution obtained in step 1) to carry out an enzymatic reaction, centrifuging and discarding the supernatant after the reaction is completed, and adding pure water to dissolve the α-1,3-glucan to obtain an α-1,3-glucan solution; 3) Preparation of bio-based plastics: The α-1,3-glucan solution obtained in step 2) is mixed with TEMPO to initiate an oxidation reaction, the TEMPO-oxidation complex obtained by the oxidation reaction is centrifuged to retain the supernatant, and ultrasonically crushed in an ice bath to obtain a dispersion with high uniformity, the dispersion is immersed in a reagent for cross-linking to obtain a physical-chemical double cross-linked body, the physical-chemical double cross-linked body is spread on a PTFE filter membrane, vacuum filtered, and dried to obtain a degradable bio-based plastic film.

2. The preparation method according to claim 1, characterized in that: The enzyme-producing bacteria in step 1) are Streptococcus salivarius producing glucosyltransferase or modified Bacillus subtilis after GtfJ gene modification; The construction process of the modified Bacillus is as follows: designing primers F1 and R1, performing PCR amplification using genomic DNA of Streptococcus salivarius as a template, connecting the obtained amplified product with a pET28a plasmid double-digested with BamHI and NotI, and constructing a pET28a-GtfJ recombinant plasmid; Using pET28a-GtfJ recombinant plasmid as template, the GtfJ gene fragment was amplified by primers F2 and R2 and Gibson ligated with pBA300 vector digested with XbaI to construct the pBA300-GtfJ recombinant vector, which was then transformed into Bacillus WB800N to obtain the modified Bacillus WB800N / pBA300-GtfJ.

3. The preparation method according to claim 2, characterized in that: The nucleotide sequences of the primers F1 and R1 are: F1: GAAGGAGAAAGGTACATGCACCATCACCATCACCATGAGAATAAAATAC R1: CATGGTACCTTTCTCCTCTTTAGTTCAGAACGCGCGGCGGATAC The nucleotide sequences of the primers F2 and R2 are: F2: GCCGATTACAAAAACATCAGCCCACCATCACCATCACCATGAG R2: GCCCGCTCATTAGGCGGGCTGCTTAGTTCAGAACGCGCGGCGGATAC.

4. The preparation method according to claim 1, characterized in that: The antibiotic described in step 1) is kanamycin.

5. The preparation method according to claim 1, characterized in that: The fermentation conditions in step 1) are: fermentation at 37° C. until the OD value is between 0.6 and 0.8; the induction expression conditions are: adding inducer IPTG, 15-20° C., 200 rpm, and culturing for 18-20 hours.

6. The preparation method according to claim 1, characterized in that: The enzymatic reaction solution in step 2) is a 342.3 g / L sucrose solution prepared with a citric acid buffer solution having a pH of 5.5 as a solvent, and is filtered and sterilized.

7. The preparation method according to claim 1, characterized in that: The conditions of the enzymatic reaction in step 2) are: standing and reacting at 15-40°C for 20-30 hours.

8. The preparation method according to claim 1, characterized in that: The pH of the oxidation reaction in step 3) is 9-11.

9. The preparation method according to claim 1, characterized in that: The process of immersing the dispersion in the reagent for crosslinking in step 3) is as follows: adding ECH to the dispersion for chemical crosslinking, and then immersing the wet matrix in a CaCl2 solution for physical crosslinking.

10. The bio-based plastic film prepared by the method according to any one of claims 1 to 8.

Images