Self-cleavage ribozyme and capping rate determination method applied by self-cleavage ribozyme

Abstract

The invention relates to a self-cleavage ribozyme and application thereof in mRNA capping rate determination, and belongs to the technical field of biology. The self-cleavage ribozyme is Pistol ribozyme, a secondary structure of the Pistol ribozyme contains three stems and two rings, the two rings are connected through a pseudoknot, a specific cleavage site of the Pistol ribozyme is located between sequences G-U, the two sides of the G-U are a P2 stem and a P3 stem, and the P2 stem and the P3 stem of the Pistol ribozyme are designed to be reversely complementary with sequences on the two sides of the G-U in 5 'UTR of RNA to be detected. The self-cleavage ribozyme can effectively cleave 5'end fragments of mRNA, the cleaved fragments can be quantitatively analyzed through LC-MS, then the cap adding efficiency of mRNA is calculated, and the method is easy to operate, low in cost and suitable for rapid analysis of the cap adding efficiency of a large number of samples.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, in particular to a self-cleaving ribozyme and a capping rate determination method of the applied self-cleaving ribozyme. Background Art

[0002] With the in-depth study of mRNA structure and its mechanism of action, mRNA is increasingly becoming the most promising nucleic acid therapy in biomedical applications. mRNA is a versatile tool that can be used for therapeutic protein replacement, gene editing, cell therapy, vaccines, etc. Almost any protein can be introduced through mRNA, thereby expressing gene editing tools or antigens in cells as needed.

[0003] Compared with DNA-based approaches, mRNA-based approaches that express bioactive protein levels have principle advantages. mRNA constructs can reduce or even eliminate vector-induced immunogenicity, allowing repeated dosing. mRNA-based vaccines have achieved impressive preclinical research results in a variety of fields, including oncology, infectious diseases, and allergies. mRNA-based vaccines can be produced at low cost in a highly flexible and scalable production process and will become a revolutionary, disruptive technology in the field of vaccinology. Equally impressive results have been achieved in stem cell research and diseases caused by genetic defects. Now, mRNA technology seems to have reached a level where mRNA-based protein or gene replacement therapies can be envisioned. Therefore, mRNA, rather than DNA, which has been favored for decades, will become the basis for new nucleotide-based drugs. This may well be the beginning of a revolution in medicine based on mRNA.

[0004] In 1990, in vitro transcribed mRNA was fully expressed in mouse skeletal muscle cells by direct injection, becoming the first successful attempt at in vivo expression of mRNA, thus demonstrating the feasibility of mRNA vaccine development. In 1992, the first report on the therapeutic effect of exogenous mRNA was published, showing that injection of vasopressin mRNA into the brain temporarily reversed diabetes insipidus in rats. In 1993, studies showed that mRNA stimulated immune responses in mice. After the first mRNA-based pharmaceutical company was established in 1997, a large number of groups began to study and develop mRNA-based drugs. In 2000, the first mRNA clinical trial for cancer. In 2005, studies showed that nucleoside-modified RNA can reduce innate immune responses. In 2009, the first mRNA-based CAR-T cell therapy. In mice, injection of messenger RNA (mRNA) encoding tumor-associated antigens can induce antitumor immune responses, thus providing a broadly applicable immunotherapy approach. In 2012, preclinical studies showed protective vaccination using mRNA and self-amplifying mRNA (SAM). In 2020, multiple mRNA vaccines were deployed against SARS-CoV-2.

[0005] The three main therapeutic areas where mRNA drugs are currently being explored are immunotherapy, protein replacement therapy, and regenerative medicine applications. Cancer immunotherapy, infectious disease vaccines, allergy tolerance, protein replacement, genome engineering, gene editing, genetic reprogramming of cells, and tissue engineering.

[0006] Whether it is used to make vaccines or as an mRNA drug, its 5' end cap structure is essential for the structural integrity of mature mRNA. In 2020, the "Technical Guidelines for Pharmaceutical Research of mRNA Vaccines for Prevention of Novel Coronavirus" issued by the Center for Drug Evaluation of the National Medical Products Administration proposed that process control tests should be conducted on the products of the mRNA production process steps, such as capping rate, length of poly (A) tail products, mRNA sequence integrity, sequence accuracy, purity, mRNA concentration, concentration of side reaction products, residual protein, residual DNA, sterility, endotoxin, etc., among which the capping rate is used as an important criterion for the quality control of mRNA stock solution.

[0007] Whether mRNA is capped or not, there is only a difference of one methyl or one nucleotide, so it is difficult to distinguish whether mRNA is capped or not through conventional separation and analysis methods. Researchers who detect the mRNA capping rate have discovered this problem and have used different methods to detect the mRNA capping rate.

[0008] In the early days, Janusz Stepinski et al. used related RNases to degrade isotope-labeled RNA into single nucleotides to study the capping rate and capping direction. The feature of RNase T2's base-free specificity for mRNA degradation is used to determine whether there is a cap structure at the 5' end of mRNA. When RNase T2 is used to degrade mRNA generated using α-phosphate group-P32 nucleotides, if the 5' end of RNA has a normal m7GpppG, then after RNase T2 degradation, m7GpppG32p with a 32p label will be formed. When the isotope-labeled mRNA cap structure is positive, the mRNA is first treated with tobacco acid pyrophosphatase (TAP) and then degraded with RNase T2, pG32p will be obtained. On the contrary, when the isotope-labeled mRNA cap structure is reversed, the mRNA is treated with the same two enzymes together, only pm7G32p will be obtained. The capping efficiency and capping direction can be quantified by analyzing the isotope-labeled nucleotides (cap structures) obtained by enzymatic degradation by gel electrophoresis or HPLC. However, the RNA samples used to analyze this method must be isotope-labeled, and this method cannot be extended to the field of quality control testing of clinical mRNA production.

[0009] In 2014, Shire Human Genetic Therapies publicly applied for a patent: Quantitative assessment of messenger RNA capping efficiency, providing a method for quantifying mRNA capping efficiency, especially in vitro synthesized mRNA. In some embodiments, the method according to the invention includes providing an mRNA sample containing capped mRNA and uncapped mRNA, providing a cap-specific binding substance under conditions that allow the formation of a complex between the cap-specific binding substance and the capped mRNA, and quantitatively determining the amount of the complex relative to the control, thereby quantifying the mRNA capping efficiency.

[0010] In 2016, Michael Beverly et al. used RNaseH digestion and streptavidin magnetic beads to analyze the capping of mRNA by LC-MS, thereby quantitatively analyzing the capping rate. Since the molecular weight of the full-length mRNA is too large to be directly used for mass spectrometry analysis, the 5' end fragment was digested with RNaseH and then used for LC-MS.

[0011] In 2022, NEB researcher G. Brett Robb conducted a detailed study on whether RNase H can produce more homogeneous cleavage fragments. Based on earlier studies, they designed a 24 nt RNase H probe to mediate RNase H cleavage within the Loop loop of the secondary structure of the FLuc-RNA 5' end sequence (33nt). Under the same reaction conditions, Escherichia coli RNase H and Thermomyces RNase H have similar cleavage efficiencies (98% and 96.6%, respectively), and both can produce two types of cleavage products (23nt and 24nt). However, Thermomyces RNase H produces more 24nt cleavage products than Escherichia coli RNase H.

[0012] Due to the heterogeneity of RNaseH cleavage sites, additional bands will be generated in addition to the expected bands. In contrast, ribozymes have very specific cleavage sites, and the 5' cleavage products produced only have two bands - the 5' cleavage product band with a cap structure and the 5' cleavage product band without a cap structure.

[0013] In 2022, Katalin Karikó designed a series of hammerhead ribozymes that specifically cleave mRNA at specific sites in the 5'UTR of mRNA. IVT mRNA is cleaved by hammerhead ribozymes, releasing 10-30nt short 5' cleavage products with or without a cap structure at the 5' end. Long-chain RNA (full-length mRNA / long 3' cleavage product without cleavage) is removed using a silica gel column, and hammerhead ribozymes and 5' cleavage products are purified. Finally, urea-denatured polyacrylamide gel electrophoresis or LC-MS is used to visualize and quantitatively analyze the ratio of 5' cleavage products with cap structure / 5' cleavage products without cap structure to obtain the capping efficiency. Compared with RNase H-mediated cleavage reactions, hammerhead ribozyme-mediated cleavage reactions obviously have great advantages, with a single cleavage site and no non-specific bands in the cleavage reaction products. However, there are disadvantages such as sequence-specific limitations and low enzyme activity, which affect the accuracy and breadth of capping rate detection. Summary of the invention

[0014] The purpose of the present invention is to solve the problem of low accuracy of existing capping rate detection.

[0015] In order to achieve the above object, the technical solution provided by the present invention is: The invention discloses a self-cleaving ribozyme, which is a Pistol ribozyme. The secondary structure of the Pistol ribozyme contains three stems and two loops, the two loops are connected by a pseudoknot, the specific cleavage site of the Pistol ribozyme is between the sequences GU, the two sides of GU are P2 stem and P3 stem, and the P2 stem and P3 stem of the Pistol ribozyme are designed to be reverse complementary to the sequences on both sides of GU in the 5'UTR of the RNA to be tested.

[0016] Preferably, the Pistol ribozyme is designed according to the env27 Pistol ribozyme sequence, the P2 stem is four reverse complementary to the four bases on the right side of the sequence GU in the 5'UTR of the RNA to be tested, and the P3 stem is reverse complementary to the N bases on the left side of the sequence.

[0017] Preferably, the Pistol ribozyme comprises three P3 stem sequences of different lengths, which are reverse complementary to the left base of the sequence GU in the 5'UTR of the RNA to be detected, and are 6nt, 11nt, and 14nt respectively.

[0018] Preferably, the 6nt Pistol ribozyme sequence is ACUCGUUUGAGCGAGUAUUUCAGGGGUUAGGCUCAAAGCGCAGAAG.

[0019] Preferably, the 11nt Pistol ribozyme sequence is ACUCGUUUGAGCGAGUAUUUCAGGGGUUAGGCUCAAAGCGCAGAAGAAUAC.

[0020] Preferably, the 14nt Pistol ribozyme sequence is ACUCGUUUGAGCGAGUAUUUCAGGGGUUAGGCUCAAAGCGCAGAAGAAUACUAG.

[0021] A method for determining mRNA capping rate, the method using the above-mentioned self-cleaving ribozyme, the method comprising the following steps: S1, treating the RNA to be tested with Pistol ribozyme to generate capped 5' cleavage fragments and uncapped 5' cleavage fragments; S2. After purifying the generated 5' cleavage fragments, the capping rate was calculated by LC-MS analysis.

[0022] Preferably, the calculation of the capping rate by LC-MS analysis in step S2 is specifically to determine whether the RNA is capped by obtaining the nucleus-cytoplasm ratio by LC-MS, and calculate the capping rate by the intensity values ​​of the 5' capped fragments and the 5' uncapped fragments, capping rate = (sum of the intensity values ​​of the 5' capped fragments) / (sum of the intensity values ​​of the 5' capped fragments + sum of the intensity values ​​of the 5' uncapped fragments) * 100%.

[0023] Preferably, the RNA to be tested in step S1 is BNT_162b2 mRNA, the RNA to be tested includes capped and uncapped RNA, the capped RNA is obtained by co-transcriptional capping, and the cap structure is Cap1; the concentration ratio of the RNA to be tested to the Pistol ribozyme is 1:1~1:10.

[0024] Preferably, the purification in step S2 is specifically to purify the 5' cleavage product from the reaction system to prepare an aqueous solution of RNA, wherein the aqueous solution of the 5' cleavage fragment is purified by RNeasy mini kit.

[0025] Preferably, in step S1, the RNA to be tested and the Pistol ribozyme are denatured at 75-95° C. for 3 minutes, and then annealed when the temperature drops to 20-30° C. The temperature decrease rate is 0.1 degrees Celsius per second, and the Pistol ribozyme is reverse complementary to the 5'UTR of the RNA to be tested.

[0026] Preferably, the concentration of the inducer MgCl2 added in step S1 is 5-30 mM, and the enzyme cleavage reaction time is 0.5-3 h.

[0027] Compared with the prior art, the technical solution provided by the present invention has the following beneficial effects: The invention discloses a self-cleaving ribozyme and a capping rate determination method for the application thereof. The self-cleaving ribozyme is a Pistol ribozyme, the secondary structure of the Pistol ribozyme contains three stems and two loops, the two loops are connected by a pseudoknot, the specific cleavage site of the Pistol ribozyme is between the sequences GU, the two sides of GU are P2 stem and P3 stem, and the P2 stem and P3 stem of the Pistol ribozyme are designed to be reverse complementary to the sequences on both sides of GU in the 5'UTR of the RNA to be tested. The self-cleaving ribozyme of the invention can effectively cut the 5' end fragment of mRNA, and the cut fragments can be quantitatively analyzed by LC-MS, so as to calculate the capping efficiency of mRNA. The method is simple to operate, low in cost, and suitable for rapid analysis of the capping efficiency of a large number of samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1This is a schematic diagram of the principle of Pistol ribozyme cleaving mRNA in Example 1; Figure 2 This is the urea denatured polyacrylamide gel electrophoresis image of the mixed sample after cleavage by the Pistol ribozyme Pt-14 of Example 1; Figure 3 The urea-denatured polyacrylamide gel electrophoresis diagram of the 5'-cleavage products after the 5'-UTR region of mRNA was cleaved by Pistol ribozymes (Pt-6, Pt-11, Pt-14) of different lengths in Example 1; Figure 4 The urea-denatured polyacrylamide gel electrophoresis diagram of the purified 5'-cleavage products after the 5'-UTR region of mRNA was cleaved by Pistol ribozymes (Pt-6, Pt-11, Pt-14) of different lengths in Example 1; Figure 5 This is a mass spectrum of the LC-MS analysis of the 5'-cleavage products of mRNA by Pistol ribozymes of different lengths (Pt-6, Pt-11, Pt-14) in Example 1. DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to better understand the solution of the present application, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present application.

[0030] It should be noted that the terms "first", "second", etc. in the specification and claims of the present application and the above-mentioned drawings are used to distinguish similar objects, and are not necessarily used to describe a specific order or sequential order. It should be understood that the data used in this way can be interchanged where appropriate, so that the embodiments of the present application described here. In addition, the terms "including" and "having" and any of their variations are intended to cover non-exclusive inclusions, for example, a process, method, system, product or device comprising a series of steps or units is not necessarily limited to those steps or units clearly listed, but may include other steps or units that are not clearly listed or inherent to these processes, methods, products or devices.

[0031] In the present application, the terms "upper", "lower", "left", "right", "front", "back", "top", "bottom", "inner", "outer", "middle", "vertical", "horizontal", "lateral", "longitudinal" and the like indicate positions or positional relationships based on the positions or positional relationships shown in the drawings. These terms are mainly used to better describe the present application and its embodiments, and are not used to limit the indicated devices, elements or components to have a specific orientation, or to be constructed and operated in a specific orientation.

[0032] In addition, some of the above terms may be used to express other meanings in addition to indicating orientation or positional relationship. For example, the term "on" may also be used to express a certain dependency or connection relationship in some cases. For those of ordinary skill in the art, the specific meanings of these terms in this application can be understood according to specific circumstances.

[0033] In addition, the terms "installed", "set", "provided with", "connected", "connected", and "socketed" should be understood in a broad sense. For example, it can be a fixed connection, a detachable connection, or an integral structure; it can be a mechanical connection, or an electrical connection; it can be a direct connection, or an indirect connection through an intermediate medium, or it can be an internal connection between two devices, elements, or components. For those of ordinary skill in the art, the specific meanings of the above terms in this application can be understood according to specific circumstances.

[0034] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present application will be described in detail below with reference to the accompanying drawings and in combination with the embodiments. Example

[0035] The experimental instruments and materials used in this embodiment are as follows: PCR instrument, Bio-Rad; UV-visible spectrophotometer, Thermo Fisher Scientific; Mini centrifuge, Eppendorf; Refrigerated microcentrifuge, Hettich; Large-system automated nucleic acid extraction instrument, Geneon Biotech; ChemiDoc imager, Bio-Rad; Adenosine-5'-triphosphate disodium, Shanghai Yuanye Biotechnology Co., Ltd.; Uridine-5'-triphosphate trisodium salt, Shanghai Yuanye Biotechnology Co., Ltd.; Cytidine-5'-triphosphate disodium salt, Shanghai Yuanye Biotechnology Co., Ltd.; Guanosine-5'-triphosphate trisodium, Shanghai Yuanye Biotechnology Co., Ltd.; m7G(5′)ppp(5′)(2′-OMeA)pG, Hongene Biotech; T7 RNA Polymerase (10× Transcription buffer), Vazyme; Nucleic acid extraction kit, Geneon Biotech; Urea, Sangon Biotech; HEPES, Sangon Biotech; Sodium chloride, Sangon Biotech; Magnesium chloride hexahydrate, Sangon Biotech; RNeasy Mini Kit (50), Qiagen.

[0036] The process of this embodiment is as follows: 1. Synthesis and purification of capped and uncapped mRNA (1) In vitro transcription of uncapped mRNA This example uses in vitro transcription to synthesize uncapped mRNA. A restriction endonuclease linearized plasmid is used as a transcription template, and in vitro transcription of RNA is initiated by T7 RNA polymerase to obtain uncapped mRNA. The reaction system is shown in Table 1. Transcription is performed using T7 RNA polymerase, Vazyme (Nanjing Novogene Biotechnology Co., Ltd.), catalog number: DD4101, and the specific operation is referred to the instruction manual.

[0037] Table 1

[0038] Add the system in sequence according to Table 1, mix well, and incubate at 37 °C for 3 h.

[0039] (2) Synthesis of capped mRNA by co-transcriptional capping In this example, the capped mRNA was prepared by co-transcription. After the transcription template plasmid was linearized with restriction endonucleases, the RNA was transcribed in vitro by T7 RNA polymerase, and the capped mRNA was synthesized according to the co-transcription capping reaction system in Table 2. m7G(5')ppp(5')(2'-OMeA)pG Hongene Biotech (Shanghai Zhaowei Biotechnology Co., Ltd.) item number: ON-134 was used for co-transcription capping. For details, please refer to the instructions.

[0040] Table 2

[0041] Add the system in sequence according to Table 2, mix well, and incubate at 37 °C for 3 h.

[0042] (3) In vitro transcription / co-transcription capping product purification steps: The transcription product was purified using a nucleic acid extraction kit through a large-system automated nucleic acid extractor. Samples were added to a 48-deep-well plate according to Table 2. After the nucleic acid extractor was powered on and self-checked, the mRNA purification program was selected for purification. RNA purification was performed using an mRNA magnetic bead purification kit (Zhejiang Hanwei Technology Co., Ltd.), item number: M1335-100, and a large-system automated nucleic acid extractor (Zhejiang Hanwei Technology Co., Ltd.), item number: HW-24HB. For detailed operations, see the instructions.

[0043] Table 2

[0044] After the sample is added, place the 48-deep-well plate in the card slot of the extractor and run the program. After the program is finished, collect the eluted RNA sample, and the RNA concentration is measured using a UV-visible spectrophotometer, and the purity is 20 mg / ml. The in vitro transcription product and purified RNA are analyzed and verified by 8M urea and 6% PAGE. The collected RNA is stored at -20°C or used in subsequent experiments.

[0045] 2. RNA cleavage by self-cleaving ribozymes (1) Design of self-cleaving ribozymes The secondary structure of the Pistol ribozyme contains three stems and two loops, and the two loops are connected by a pseudoknot. The specific cleavage site of the Pistol ribozyme is between the sequences GU, and the two sides of GU are the P2 stem and the P3 stem. The P2 stem and the P3 stem of the Pistol ribozyme are designed to be reverse complementary to the sequences on both sides of GU in the 5'UTR of the RNA to be tested. The sequence design is based on the env27 Pistol ribozyme sequence. The P2 stem is four reverse complementary to the four bases on the right side of the sequence GU in the 5'UTR of the RNA to be tested, and the P3 stem is reverse complementary to the N bases on the left side of the sequence. Figure 1 As shown. Three different lengths of Pistol ribozymes were designed, namely Pt-6 (SEQ ID NO.2), Pt-11 (SEQ ID NO.3), and Pt-14 (SEQ ID NO.4).

[0046] (2) Enzyme digestion reaction The Pistol ribozyme digestion reaction system is shown in Table 3.

[0047] Table 3

[0048] After mixing the components except MgCl2 in the above table, place in PCR instrument for enzyme digestion reaction. The reaction program is 95℃5min, 25℃5min (0.1℃ / sec), 37℃1h. When the temperature drops to 25℃, add the inducer MgCl2. The reaction system is used for subsequent operations or stored at -20℃.

[0049] The capped and uncapped 40nt short RNAs were mixed in the ratio of 0, 20, 40, 60, 80, 100, and the RNA mixture was digested with Pistol ribozyme Pt-14. The reaction results were detected by 8M Urea, 21% PAGE.

[0050] The results are as follows Figure 2 As shown, the ribozyme Pt-14 has a cutting effect on short RNA, and as the proportion of capped samples in the mixed sample increases, the capping rate also increases, showing an overall linear change.

[0051] Figure 3 The urea-denatured polyacrylamide gel electrophoresis of the 5'-cleavage products of the 5'-UTR region of mRNA after cleavage by Pistol ribozymes of different lengths (Pt-6, Pt-11, Pt-14) is shown. The 5'-cleavage products can be observed from the gel image. The 5'-cleavage products of the capped RNA differ by 1nt from the 5'-cleavage products of the uncapped RNA. Figure 3 It can be clearly observed that the molecular weight of the 5' cleavage product band of the capped RNA is greater than that of the uncapped 5' cleavage product. Therefore, it can be determined that the RNA has a cap structure, and the capping rate can be roughly calculated by grayscale analysis.

[0052] 3. Purification of enzyme digestion products Adjust the sample volume to 100 µL with RNase-free H2O. Add 350 µL of Buffer RLT and mix. Add 250 µL of ethanol (100%) to the diluted RNA and mix by pipetting. Transfer the sample (700 µL) to the RNeasy Mini Spin column. Centrifuge at 12,000 rpm for 15 seconds.

[0053] Collect the flow-through, add 50 µL of Buffer RLT to the flow-through, mix well, then add 500 µL of ethanol (100%) and mix well with a pipette. Transfer the sample (1250 µL) twice to a new RNeasy Mini Spin column. Centrifuge at 12,000 rpm for 15 seconds.

[0054] Add 500 µL of Buffer RPE to the RNeasy Mini Spin column. Centrifuge at 12,000 rpm for 2 minutes to wash the column membrane. Discard the flow-through, add 500 µL of 100% ethanol to the RNeasy Mini Spin column, and centrifuge at 12,000 rpm for 2 minutes to wash the column membrane.

[0055] Discard the flow-through and centrifuge the empty column at 12,000 rpm for 1 minute to evaporate the ethanol.

[0056] Place the RNeasy Mini Spin column in a new 1.5 mL collection tube. Add 50 µL of RNase-free H2O directly to the column membrane. Centrifuge at 13,000 rpm for 2 minutes to elute the RNA.

[0057] The collected RNA was tested for size and quality by 8M Urea and 21% PAGE. Figure 4 The 5' cleavage product of capped RNA is 24 nt, and the cleavage product of uncapped RNA is 23 nt. Figure 3 It can be seen that the RNA concentration increased after purification, with only one small fragment band and a small amount of ribozyme bands, and the band edges were clear, which can be used for subsequent LC-MS analysis.

[0058] 4. LC-MS detection of capping rate The short fragments obtained by separation and purification were subjected to liquid chromatography-mass spectrometry (LC-MS) capping rate analysis. The capping rate is calculated by using LC-MS to obtain the nucleus-cytoplasm ratio to determine whether the RNA is capped, and the capping rate is calculated by the intensity value of the 5' capped fragment and the 5' uncapped fragment. Capping rate = (sum of the intensity values ​​of the 5' capped fragment) / (sum of the intensity values ​​of the 5' capped fragment + sum of the intensity values ​​of the 5' uncapped fragment) * 100%. The LC-MS analysis results are as follows Figure 5 The molecular weight of the fragments cleaved by the three ribozymes from the same mRNA was the same, and the capping rates of the 5' cleavage products of the three ribozymes were all greater than 95% by LC-MS (capping rate was 95.8±0.2%), which was consistent with the results of polyacrylamide gel electrophoresis analysis.

[0059] Table 4 shows the theoretical cleavage sequence and molecular weight for reference by LC-MS.

[0060]

[0061] In summary, the method provided by the present invention can effectively cut the 5' end fragment of mRNA, and can quantitatively analyze the cut fragments through LC-MS, and then calculate the capping efficiency of mRNA. This method is simple to operate and low in cost, and is suitable for rapid analysis of the capping efficiency of a large number of samples.

[0062] Sequence Listing: SEQ ID NO.1: BNT_162b2 mRNA sequence SEQ ID NO.2: short RNA sequence AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAG SEQ ID NO.3: Ribozyme Pt-6 sequence ACUCGUUUGAGCGAGUAUUUCAGGGGUUAGGCUCAAAGCGCAGAAG SEQ ID NO.4: Ribozyme Pt-11 sequence ACUCGUUUGAGCGAGUAUUUCAGGGGUUAGGCUCAAAGCGCAGAAGAAUAC SEQ ID NO.5: Ribozyme Pt-14 sequence ACUCGUUUGAGCGAGUAUUUCAGGGGUUAGGCUCAAAGCGCAGAAGAAUACUAG The above-described embodiments only express a certain implementation mode of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the patent scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A self-cleaving ribozyme, characterized in that: The self-cleaving ribozyme is a Pistol ribozyme, the secondary structure of which contains three stems and two loops, the two loops being connected by a pseudoknot, the specific cleavage site of the Pistol ribozyme being between the sequences GU, the two sides of GU being the P2 stem and the P3 stem, and the P2 stem and the P3 stem of the Pistol ribozyme being designed to be reversely complementary to the sequences on both sides of GU in the 5'UTR of the RNA to be tested.

2. A self-cleaving ribozyme according to claim 1, characterized in that: The Pistol ribozyme is designed according to the env27 Pistol ribozyme sequence, the P2 stem is four reverse complementary to the four bases on the right side of the sequence GU in the 5'UTR of the RNA to be tested, and the P3 stem is reverse complementary to the N bases on the left side of the sequence.

3. A self-cleaving ribozyme according to claim 2, characterized in that: The Pistol ribozyme comprises three different lengths of P3 stem sequences which are reverse complementary to the left base of the sequence GU in the 5'UTR of the RNA to be tested, which are 6nt, 11nt and 14nt respectively.

4. A self-cleaving ribozyme according to claim 3, characterized in that: The 6nt Pistol ribozyme sequence is ACUCGUUUGAGCGAGUAUUUCAGGGGUUAGGCUCAAAGCGCAGAAG.

5. A self-cleaving ribozyme according to claim 3, characterized in that: The 11nt Pistol ribozyme sequence is ACUCGUUUGAGCGAGUAUUUCAGGGGUUAGGCUCAAAGCGCAGAAGAAUAC.

6. A self-cleaving ribozyme according to claim 3, characterized in that: The 14nt Pistol ribozyme sequence is ACUCGUUUGAGCGAGUAUUUCAGGGGUUAGGCUCAAAGCGCAGAAGAAUACUAG.

7. A method for determining mRNA capping rate, characterized in that: The method uses the self-cleaving ribozyme according to any one of claims 1 to 6, and the method comprises the following steps: S1, treating the RNA to be tested with Pistol ribozyme to generate capped 5' cleavage fragments and uncapped 5' cleavage fragments; S2. After purifying the generated 5' cleavage fragments, the capping rate was calculated by LC-MS analysis.

8. The method for determining mRNA capping rate according to claim 7, characterized in that: The calculation of the capping rate by LC-MS analysis in step S2 is specifically to determine whether the RNA is capped by obtaining the nucleus-cytoplasm ratio by LC-MS, and calculate the capping rate by the intensity values ​​of the 5' capped fragment and the 5' uncapped fragment, capping rate = (sum of the intensity values ​​of the 5' capped fragments) / (sum of the intensity values ​​of the 5' capped fragments + sum of the intensity values ​​of the 5' uncapped fragments) * 100%.

9. The method for determining mRNA capping rate according to claim 7, characterized in that: The RNA to be tested in step S1 is BNT_162b2 mRNA, and the RNA to be tested includes capped RNA and uncapped RNA, and the capped RNA is obtained by co-transcriptional capping, and the cap structure is Cap1; the concentration ratio of the RNA to be tested to the Pistol ribozyme is 1:1-1:

10.

10. The method for determining mRNA capping rate according to claim 7, characterized in that: The purification in step S2 specifically involves purifying the 5' cleavage product from the reaction system to prepare an aqueous solution of RNA, wherein the aqueous solution of the 5' cleavage fragment is purified by using an RNeasy mini kit.

11. The method for determining mRNA capping rate according to claim 7, characterized in that: In step S1, the RNA to be tested and the Pistol ribozyme are denatured at 75-95° C. for 3 minutes, and then annealed when the temperature drops to 20-30° C. The temperature decrease rate is 0.1 degrees Celsius per second. The Pistol ribozyme is reversely complementary to the 5'UTR of the RNA to be tested.

12. The method for determining mRNA capping rate according to claim 7, characterized in that: The concentration of the inducer MgCl2 added in step S1 is 5-30 mM, and the enzyme cleavage reaction time is 0.5-3 h.

Images