SgRNA and CRISPR / Cas9 gene editing system targeting hoxB5-like gene of penaeus japonicus and application of SgRNA and CRISPR / Cas9 gene editing system

Abstract

The invention discloses an SgRNA and CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 gene editing system for targeting a hoxB5-like gene of penaeus japonicus and application of the SgRNA and CRISPR / Cas9 gene editing system. The sequence of the SgRNA for targeting the hoxB5-like gene of the penaeus japonicus is shown as SEQ ID No. 1 to SEQ ID No. 4. SgRNA and Cas9 protein are jointly injected into fertilized eggs of penaeus japonicus, hoxB5-like gene knockout is achieved, a mutant with limb development defects is obtained, the mutant is obvious in character and effect, and a new breakthrough of a gene editing technology in the penaeus japonicus is marked. The technical scheme provided by the invention has important reference significance for the application of a gene editing technology in crustacean.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and specifically relates to a method for targeting Japanese shrimp hoxB5-like SgRNA and CRISPR / Cas9 gene editing systems and their applications. Background Art

[0002] Japanese shrimp ( Marsupenaeus japonicus ) Formerly known as Japanese penaeus, it belongs to the order Decapoda, family Penaeidae, genus Penaeus, and is one of the main shrimp farming varieties in China. Japanese shrimp grows quickly, tolerates drought and exposure, has bright colors, and has high economic value. It is very popular in the aquatic product market and farmers. It is farmed in coastal provinces and cities from southern to northern my country and has formed a certain scale. Therefore, the breeding of fine varieties is of great significance to the Japanese shrimp farming industry.

[0003] Traditional breeding methods rely on phenotypic selection, which has disadvantages such as long cycles and instability. At present, my country's shrimp breeding technology has developed from traditional selection breeding and hybrid breeding to precision breeding technologies such as sex control breeding, molecular marker-assisted selection breeding, whole genome selection breeding and molecular design breeding, and these technologies have promoted the formation and vigorous development of my country's aquatic seed industry. However, there are not many practical applications of cutting-edge breeding technologies, and the application of some technologies is still in the laboratory stage. CRISPR / Cas9 gene editing technology can delete or insert DNA sequences at the DNA level. At present, this technology has been applied in the genetic breeding of crops and some aquatic animals, while research on decapod animals such as shrimps and crabs is relatively lacking. The establishment and development of CRISPR / Cas9 gene editing technology in Japanese shrimp will not only help the study of the gene function of Japanese shrimp, but also provide important technical support for the precision breeding of shrimp, laying the foundation for the cultivation of Japanese shrimp varieties. Summary of the invention

[0004] The purpose of the present invention is to provide a method for targeting Penaeus japonicus hoxB5-like SgRNA and CRISPR / Cas9 gene editing system for targeting genes and their applications, wherein the SgRNA can target Japanese shrimp hoxB5-like Genes, thereby achieving hoxB5-like Gene knockout resulted in mutants with limb development defects.

[0005] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The present invention provides a method for targeting Japanese shrimp hoxB5-like The SgRNA of the gene, the sequence of the SgRNA is shown in SEQ ID No.1 to SEQ ID No.4.

[0006] The present invention provides an amplification primer for the sgRNA, and the sequence of the amplification primer is shown in SEQ ID No.5 to SEQ ID No.9.

[0007] The present invention provides a CRISPR / Cas9 gene editing system, which comprises a Cas9 protein and the SgRNA.

[0008] The present invention provides a vector, which comprises the SgRNA.

[0009] The present invention provides the application of the CRISPR / Cas9 gene editing system in editing the DNA of Japanese shrimp.

[0010] Furthermore, the application method is: injecting a mixture of Cas9 protein and the SgRNA into the fertilized eggs of Japanese shrimp, obtaining mutants after culturing, and determining the mutation type by PCR amplification, TA cloning and sequencing.

[0011] Furthermore, the mass ratio of the SgRNA to the Cas9 protein is 1:1~2.

[0012] Furthermore, the concentration of the SgRNA is 100 ng / μL~150 ng / μL; the concentration of the Cas9 protein is 200 ng / μL~250 ng / μL.

[0013] The present invention provides the use of the SgRNA or the CRISPR / Cas9 gene editing system in constructing Japanese shrimp mutants.

[0014] The present invention provides the application of the SgRNA or the CRISPR / Cas9 gene editing system in the breeding of improved varieties of Japanese shrimp.

[0015] Compared with the prior art, the advantages and technical effects of the present invention are: the present invention targets Japanese shrimp hoxB5- like Gene design knocked out the target site and obtained the ability to target Japanese shrimp hoxB5-like The present invention uses CRISPR / Cas9 technology to perform single gene multi-target mixed injection in Japanese shrimp to achieve hoxB5-like The gene was knocked out and a mutant with limb development defects was obtained. The mutant had obvious traits and significant effects, marking a new breakthrough in gene editing technology in Japanese shrimp. The technical solution of the present invention has important reference significance for the application of gene editing technology in crustaceans. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Japanese shrimp hoxB5-like Schematic diagram of gene target sites; Figure 2 yes hoxB5-like Summary of mutation types of each target site after gene mutation; Figure 3 It is targeted hoxB5-like The limbs of Japanese shrimp developed abnormally after gene mutation. DETAILED DESCRIPTION

[0017] The technical solution of the present invention is further described in detail with reference to the following specific examples.

[0018] In the following examples, unless otherwise specified, the experimental methods used are all conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0019] Example 1 1. Experimental Materials The Japanese shrimp broodstock used in the present invention are from Rizhao Ocean and Fishery Research Institute, 280 days old, weighing about 220g. Rearing conditions: natural seawater, 18°C, temporarily raised for 10 days, continuously aerated, regularly fed with sterilized sandworms every day, and changed water to clean.

[0020] 2. Targeting hoxB5-like Design and synthesis of sgRNA targeting genes The present invention selects genes related to controlling the limb development of Japanese shrimp hoxB5-like Perform multi-target editing for target genes, hoxB5-like The gene has 3 exons. The present invention designs 4 target sites on exon 1 (3 on the antisense strand and 1 on the sense strand). Figure 1 The specific steps are as follows: Design using SgRNA target prediction (http: / / www.crisprscan.org / ?page=sequence) hoxB5-like The 4 SgRNAs: SgRNA 1: GTAGTCTGTGTTCACACCACTGG (SEQ ID No. 1); SgRNA 2: GTGACTTCGGCGTCGGCGGGAGG (SEQ ID No. 2); SgRNA 3: GAGGCGGAGGAGGAGGCCTGCGG (SEQ ID No. 3); SgRNA 4: GGGGCGGCAGCAGCAACTCCGG (SEQ ID No. 4).

[0021] Amplification primers were designed according to the pT7-gRNA plasmid sequence and target site. The primer sequences are as follows: F1: TGtaatacgactcactataGGAGTCTGTGTTCACACCACgttttagagctagaa (SEQ IDNo.5); F2: TGtaatacgactcactataGGGACTTCGGCGTCGGCGGGgttttagagctagaa (SEQ IDNo. ​​6); F3:TGtaatacgactcactataGGGGCGGAGGAGGAGGCCTGgttttagagctagaa (SEQ IDNo.7); F4: TGtaatacgactcactataGGGGCCGGCAGCAGCAACTCgttttagagctagaa (SEQ IDNo.8); R1: AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID No. 9).

[0022] Using the pT7-gRNA plasmid as a template, amplification was performed according to the following system (Table 1): Table 1 PCR amplification system using pT7-gRNA plasmid as template

[0023] Amplification conditions were: 98°C for 3 min; (94°C, 30 s; 55°C, 30 s; 68°C, 20 s) × 30 cycles; 68°C for 7 min. The resulting PCR product was purified, recovered, and stored at -20°C.

[0024] The PCR product obtained in the previous step was used as a template and in vitro transcription was performed using a T7 in vitro transcription kit. The specific transcription system is as follows (Table 2): Table 2 Transcription system

[0025] Incubate at 37°C for 4 h and purify SgRNA using RNeasy Mini kit.

[0026] 3. Microinjection Sample Preparation The purified SgRNA was measured for concentration and quality identification using a Nanodrop micro-spectrophotometer and 1.5% agarose electrophoresis. The four SgRNAs were diluted to 100 ng / μL and mixed in equal volumes for later use; the commercially available Cas9 protein (Invitrogen) was diluted to 200 ng / μL with enzyme-free water for later use. The mixed SgRNA and the diluted Cas9 protein were then prepared into an injection sample in a volume ratio of 1:1.

[0027] 4. Treatment of Japanese shrimp broodstock Select female shrimps with well-developed ovaries, remove the unilateral eyestalk, and disinfect them. Then raise them at 18℃ with continuous aeration and feed them with disinfected sandworms at 4 pm every day.

[0028] 5. Microinjection of one-cell embryos of Penaeus japonicus The day before injection, grooves were made using a mold and 1.5% agarose and cooled for later use. Seawater with a salinity of 30‰ was prepared and sterilized by filtration using a 0.22μm filter membrane.

[0029] Obtaining the first-cell fertilized eggs of Japanese shrimp: The Japanese shrimp broodstock are monitored in real time from 19:00 to 2:00 in the morning by taking turns on duty and real-time observation, so as to obtain the newly discharged Japanese shrimp fertilized eggs. When the Japanese shrimp begins to lay eggs, the fertilized eggs are filtered with a 200-mesh silk sieve as soon as possible. Under a stereo microscope, the fertilized eggs are gently arranged in the agarose grooves with sterile seawater. The fertilized eggs are injected one by one using a pneumatic picoliter pump. After the injected embryos are left to stand for 2 hours, they are aerated and cultured in seawater with a salinity of 30‰. The culture temperature is 22˚C, and dead embryos are picked out at any time.

[0030] 6. Detect the mutation of the sample after injection 48 hours after injection, 60 embryos were taken and genomic DNA was extracted according to the "Animal Tissue Genome Extraction Kit" of Kangwei Century Company. Primers located on both sides of the target site were designed, and the sequences are shown in Table 3: Table 3 Detection primers corresponding to each target

[0031] PCR was performed using genomic DNA as a template. The PCR reaction system is as follows (Table 4): Table 4 PCR reaction system using genomic DNA as template

[0032] Amplification conditions were: 95°C for 3 min; (95°C, 30 s; 55°C, 30 s; 72°C, 20 s) × 30 cycles; 72°C for 7 min. The obtained PCR products were purified and recovered using a gel recovery kit (QIAGEN) after 1.5% agarose electrophoresis. The DNA fragments were connected to the pmd-18T vector for TA cloning. The connected PCR products were transformed with DH5a competent medium. After 12 hours, single clones were picked and cultured at 37°C and 180 rpm for 2 hours. After PCR identification of single clones, a certain number of positive clones were picked for each target for sequencing (Shanghai Sangon Biotech Co., Ltd.).

[0033] The mutation type of each target site was identified using BLAST software. The identification results are as follows: Figure 2 As shown. The total mutation efficiency is 24.32%, total mutation efficiency = 1-(1-E1) × (1-E2) × (1-E3) × (1-E4). Where E represents the mutation efficiency of a single target = number of mutant clones detected / total number of clones successfully sequenced, E1 = 8%, E2 = 6.4%, E3 = 6%, E4 = 6.52%.

[0034] 7. Phenotypic observation of injected embryos Every morning, the survival and development of the injected embryos were observed under a stereoscope and photographed. Figure 3 As shown, Figure 3 WT in the middle represents wild-type individuals; hoxB5-like represent hoxB5-like Gene knockout individuals prove that hoxB5-like The gene was knocked out and a mutant with limb development defects was obtained, and the mutant had obvious characteristics.

[0035] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A method targeting Japanese shrimp hoxB5-like The SgRNA of a gene is characterized by: The sequence of the SgRNA is shown in SEQ ID No.1 to SEQ ID No.

4.

2. The sgRNA amplification primer according to claim 1, characterized in that The sequences of the amplification primers are shown in SEQ ID No.5 to SEQ ID No.

9.

3. A carrier, characterized in that The vector comprises the SgRNA of claim 1.

4. A CRISPR / Cas9 gene editing system, characterized in that: It comprises Cas9 protein and the SgRNA according to claim 1.

5. Use of the CRISPR / Cas9 gene editing system described in claim 4 in editing the DNA of Japanese shrimp.

6. The use of the CRISPR / Cas9 gene editing system according to claim 5 in editing the DNA of Japanese shrimp, characterized in that: The application method is: injecting a mixture of Cas9 protein and the SgRNA described in claim 1 into the fertilized eggs of Japanese shrimp, culturing to obtain mutants, and determining the mutation type through PCR amplification, TA cloning and sequencing.

7. The use according to claim 6, characterized in that: The mass ratio of the SgRNA to the Cas9 protein is 1:1~2.

8. The use according to claim 6, characterized in that: The concentration of the SgRNA is 100 ng / μL~150 ng / μL; the concentration of the Cas9 protein is 200 ng / μL~250 ng / μL.

9. Use of the sgRNA described in claim 1 or the CRISPR / Cas9 gene editing system described in claim 4 in constructing Japanese shrimp mutants.

10. Use of the SgRNA described in claim 1 or the CRISPR / Cas9 gene editing system described in claim 4 in the breeding of Japanese shrimp varieties.

Images