Modified FLC gene of Cyperus rotundus and its mutant and application

By gene editing the FLC gene of the saccharide, the problem of the saccharide needs to be vernalized in low temperature in artificial environments to extend the growth cycle, achieving the effect of early flowering, shortening the growth period and improving seed yield.

CN119913166BActive Publication Date: 2025-08-12LITUO BIOTECHNOLOGY (BEIJING) CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510080588.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-17
Publication Date
2025-08-12
Estimated Expiration
2045-01-17

AI Technical Summary

Technical Problem

In an artificially controlled environment, cypresses need to undergo low-temperature vernalization treatment before they can bloom and bear fruit, extending the growth cycle and limiting their application as model plants and crops.

Method used

Gene editing technology to transform the FLC gene of the elixir, especially the insertion, deletion, substitution, addition and inversion of the target sequence, reduce or inactivate the activity of the FLC gene, and enable the elixir to enter the reproductive growth stage in advance.

Benefits of technology

The growth cycle of cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervical cervic

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119913166B_ABST
    Figure CN119913166B_ABST
Patent Text Reader

Abstract

The present invention discloses a modified FLC gene of the Chinese thorn thorn, mutants thereof, and applications thereof. The modified FLC gene of the Chinese thorn thorn comprises a modified target sequence, wherein the modified target sequence is a nucleotide sequence obtained by inserting, deleting, replacing, adding, inverting, and / or modifying at least one nucleotide within the target sequence shown in SEQ ID NO. 2 and / or within 30 bp upstream and downstream of the target sequence. The modified FLC gene of the Chinese thorn thorn and its mutants of the present invention have application prospects in promoting early flowering and fruiting of the Chinese thorn thorn, shortening the growth period, resisting lodging, facilitating dense planting, and increasing seed yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the modified FLC gene of *Ipomoea aquatica*, its mutants, and their applications. Background Technology

[0002] *Thlaspi arvense* L., a cruciferous plant native to Eurasia, is a self-pollinating diploid (2n = 2x = 14). *Thlaspi arvense* exhibits exceptional cold tolerance, able to withstand temperatures as low as -45°C. It can be planted as a winter cover crop during the traditional fallow period after summer annuals such as wheat, corn, or soybeans, preventing soil erosion and nutrient loss, protecting surface and groundwater, suppressing weed growth in early spring, and providing a food source for pollinators. In temperate regions, *Thlaspi arvense* has a short growth cycle, allowing for autumn sowing and early summer harvest. Reported seed yields range from 1500 to 2400 kg / ha. After harvest, a short-season annual such as soybean can be planted to improve overall land use efficiency and the agro-economy. *Thlaspi arvense* seeds have an average oil content of approximately 35%, and their fatty acid composition can be used as biofuel. Seed oil also has the potential to be converted into edible oil and edible protein sources.

[0003] Currently, the whole genome of *Iris tectorum* has been sequenced, making it a novel dicotyledonous model plant for molecular genetics research. These advantages suggest that the artificial domestication and breeding of *Iris tectorum* is relatively easy. As a diploid, *Iris tectorum* corresponds one-to-one with many genes in *Arabidopsis thaliana*, providing important references for trait improvement and field phenotypic verification. Currently, gene editing and chemical mutagenesis methods have been used abroad to improve some important agronomic and physiological-biochemical traits, such as transparent seed coat phenotype, reduced pod bursting at maturity, and seed oil composition. However, in artificially controlled environments (such as artificial climate chambers), *Ilex cornuta* requires 21 days of low-temperature vernalization during the seedling stage to transition from vegetative growth to reproductive growth and in order to flower and bear fruit. This necessitates the presence of low-temperature vernalization conditions in artificially controlled environments (such as artificial climate chambers), and the entire growth period must be around 140 days, significantly extending the plant's growth cycle. This poses a considerable challenge to the application of *Ilex cornuta* as a model plant or model crop. Summary of the Invention

[0004] To overcome the problems existing in the prior art, the technical solution provided by the present invention is as follows:

[0005] In a first aspect, the present invention provides a modified FLC gene of *Ipomoea aquatica* containing a modified target sequence, wherein the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or substituting and / or adding and / or inverting and / or modifying at least one nucleotide within 30 bp upstream and downstream of the target sequence shown in SEQ ID NO.2.

[0006] In this invention, the unmodified *Ilex chinensis* FLC gene was obtained from NCBI, with the gene accession number OU46686, and the CDS sequence of the *Ilex chinensis* FLC gene is shown in SEQ ID NO.1.

[0007] In this invention, the target sequence shown in SEQ ID NO.2 is modified using gene editing technology to obtain the modified iris FLC gene.

[0008] In some implementations, gene editing includes at least one of gene knockout, gene knockdown, gene insertion, base substitution, gene mutation, and gene recombination.

[0009] In some preferred embodiments, the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 30 bp upstream and downstream of the target sequence.

[0010] In some preferred embodiments, the modified target sequence is a nucleotide sequence obtained by deleting at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 30 bp upstream and downstream of the target sequence.

[0011] Secondly, the present invention provides a *Xanthan* flc mutant containing a modified target sequence, wherein the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or substituting and / or adding and / or inverting and / or modifying at least one nucleotide within 30 bp upstream and downstream of the target sequence shown in SEQ ID NO.2.

[0012] In some preferred embodiments, the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 20 bp upstream and downstream of the target sequence.

[0013] In some preferred embodiments, the modified target sequence is a nucleotide sequence obtained by deleting at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 20 bp upstream and downstream of the target sequence.

[0014] Thirdly, the present invention provides a method for constructing a *Illicium verum* flc mutant, characterized by comprising the following steps:

[0015] (1) Construct a CRISPR / Cas9 vector for the modified iris FLC gene;

[0016] (2) Transform the vector obtained in step (1) into Agrobacterium;

[0017] (3) The Agrobacterium obtained in step (1) was used to transform the target iris plantlets using the flower-dipping method;

[0018] (4) Screening and / or identification of positive *Ipomoea quamoclit* plants.

[0019] Fourthly, the present invention provides a method for improving a variety of *Ipomoea aquatica*, comprising:

[0020] Gene-edited *Xanthoceras sorbifolium* varieties are obtained by incorporating a modified *Xanthoceras sorbifolium* FLC gene with reduced or inactivated activity. The modified *Xanthoceras sorbifolium* FLC gene contains a modified target sequence. The modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or substituting and / or adding and / or inverting and / or modifying at least one nucleotide within 30 bp upstream and downstream of the target sequence shown in SEQ ID NO.2.

[0021] The gene-edited iris varieties include at least one of the following modifications: earlier flowering and fruiting, shorter growth period, easier dense planting, and increased seed yield.

[0022] Furthermore, this includes using gene editing technology to modify the target sequence shown in SEQ ID NO.2 to obtain a modified iris FLC gene, thereby reducing or inactivating the activity of the iris FLC gene.

[0023] In some implementations, gene editing includes at least one of gene knockout, gene knockdown, gene insertion, base substitution, gene mutation, and gene recombination.

[0024] In some preferred embodiments, gene editing includes insertion or deletion.

[0025] Fifthly, the present invention provides an expression vector, host cell, or recombinant bacteria comprising the modified FLC gene of *Ipomoea aquatica* as described above.

[0026] Sixthly, the present invention provides the above-described modified *Ilex cornuta* FLC gene, the above-described *Ilex cornuta* flc mutant, the above-described method for constructing the above-described *Ilex cornuta* flc mutant, and the above-described method for improving *Ilex cornuta* varieties, including the application of the above-described modified *Ilex cornuta* FLC gene expression vector, host cell, or recombinant bacteria in at least one of the following alterations: earlier flowering and fruiting of *Ilex cornuta*, shortened growth period, dwarfing of plants, resistance to lodging, facilitating dense planting, and increased seed yield.

[0027] The beneficial effects of the present invention include at least the following:

[0028] This invention is the first to utilize gene editing technology to modify the FLC gene controlling vernalization in *Ipomoea aquatica*. The modified *Ipomoea aquatica* FLC gene and its mutants, the method for constructing the *Ipomoea aquatica* FLC mutant, and the method for improving *Ipomoea aquatica* varieties all demonstrate promising applications in at least one of the following aspects: earlier flowering and fruiting, shortened growth period, dwarfing of plants, lodging resistance, suitability for dense planting, and increased seed yield in *Ipomoea aquatica*. Specifically:

[0029] 1) Only gene editing (such as gene knockout, gene reduction, gene insertion, base substitution) is needed to modify the target sequence in the FLC gene and / or its upstream and downstream regions within 30 bp.

[0030] 2) The *Xylaria flc* mutant containing the modified *Xylaria flc* gene does not need to be exposed to low temperatures to enter reproductive growth and can flower and bear fruit at least one month earlier.

[0031] 3) The entire growth period of the flc mutant of *Xanthoceras sorbifolium* is shortened to about 80 days, which will provide the necessary conditions for *Xanthoceras sorbifolium* to become a new model plant. Compared with the current growth period of about 140 days, the growth period of the plant is greatly shortened.

[0032] 4) The plants of the flc mutant of *Xanthoceras sorbifolium* are dwarfed and suitable for dense planting. The previous planting density of *Xanthoceras sorbifolium* was 30,000 plants / acre, while the planting density of the flc mutant of *Xanthoceras sorbifolium* in this invention can reach 150,000-200,000 plants / acre.

[0033] 5) Moreover, due to its suitability for dense planting, the seed yield per acre of the *Illicium verum* flc mutant of this invention can be increased by at least about 2 times. Attached Figure Description

[0034] Figure 1 This diagram shows the structure of the AtU6-26-sgRNA-SK plasmid in Example 1 of the present invention.

[0035] Figure 2 The positive seedlings selected in Example 1 of this invention can grow normally on hygromycin culture medium, while the non-positive seedlings stop growing after germination, and the cotyledons and hypocotyls gradually turn black.

[0036] Figure 3 This image shows a comparison of the phenotypes of the flc mutant plants and the wild-type plants in Example 1 of this invention.

[0037] Figure 4 This shows the relationship between the present invention embodiment 1 and Figure 3 Phenotypic of the flc mutant plant corresponding to (a) and sequence comparison with wild type.

[0038] Figure 5 This shows the relationship between Embodiment 1 of the present invention and Figure 3 Phenotypic of the flc mutant plant corresponding to (b) and sequence comparison with wild type.

[0039] Figure 6 This shows the relationship between the present invention embodiment 1 and Figure 3 Phenotypic of the flc mutant plant corresponding to (c) and sequence comparison with wild type.

[0040] Figure 7 This shows the relationship between the present invention embodiment 1 and Figure 3 Phenotypic of the flc mutant plant corresponding to (e) and sequence comparison with wild type.

[0041] Figure 8 This shows the relationship between the present invention embodiment 1 and Figure 3 Phenotypic of the flc mutant plant corresponding to (f) and sequence comparison with wild type.

[0042] Figure 9 This is a schematic diagram comparing the height of the flc mutant plant (right) and the wild-type plant (left) in Example 1 of the present invention. Detailed Implementation

[0043] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings. It should be understood that the specific embodiments described in the following embodiments of the invention are merely illustrative examples of specific implementations of the invention and are intended to explain the invention, but do not constitute a limitation thereof.

[0044] The endpoints and any values ​​of the ranges disclosed in this invention are not limited to the precise ranges or values, and these ranges or values ​​or approximate values ​​should be understood to include values ​​close to these ranges or values ​​(e.g., within ±5%). For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein. In the description of this application, unless otherwise stated, terms such as "multiple / a plurality" mean two / a kind or more.

[0045] The present invention will be further described in detail below with reference to the embodiments. It should be understood that, unless otherwise specified, the experimental methods in the following embodiments are generally carried out under conventional conditions or under the conditions adopted by the collaborator.

[0046] The vector reference document used in the following examples is: Yan L., Wei S., Wu Y., Hu R., Li H., Yang W., and Xie Q. (2015). High efficiency genome editing in Arabidopsis using Yao promoter-driven CRISPR / Cas9 system. Mol. Plant. This document is available to the public from the applicant for replication of this experiment, but may not be used for any other purpose.

[0047] Example 1

[0048] In this embodiment, the CDS sequence of the FLC gene (unmodified) of *Thlaspi arvense* L. was obtained from NCBI data, gene accession number: OU466862, and verified by amplification and sequencing of experimental materials. The final nucleotide sequence SEQ ID NO.1 is shown below:

[0049] ATGGGGAGAAAAAAACTAGAAATCAAGCGAATTGAGAACAAAAGTAGCCGACAAGTCACCTTCTCCAAACGACGCAACGGTCTCATCGAGAAAGCTCGTCAGCTTTCTGTTCTCTGCGATGCATCCGTCGCTCTTCTCGTTGTCTCT GCCTCTGGCAAGCTATACAGCTTCTCCTCCGGCGATAACTTGGTCAAGATCCTTGATCGATATGGAAAACAACATGCTGATGATCTTAAAGCCTTGGATCTTCAGTCAAAAGCTCTGAACTATGGTTCGCACCATGAGCTACTAGAAC TTGTGGAAAGCAAGCTTGTGGAATCAGATGTCGACAATGTAAGTGTGGATTCCCTCGTTCAGCTGGAGGATCACCTTGAGACTGCCTTTCAATAACTAGAGCTAGGAAGACTGAATTAATGTTGAAGCTTGTTGATAGCCTCAAAGA AAAGGAGAAATTGCTGAAAGAAGAGAATCAGGTTTTGGCTAGCCAGATGGAGAAGAATCATATGGAAGCAGATGCTGATAATATGGAGATGTCACCTGGACAAATCTCCGACATGAATCTTCCGGTAACTCTCCCGCTGCTTAATTAG

[0050] Among them, the sequence CCTCTGGCAAGCTATACAGCTTC, bases 149-171 of the above CDS sequence, is the target sequence shown in SEQ ID NO.2. Target primers were designed according to the vector construction requirements and sent to the company for synthesis. The primer sequences are as follows:

[0051] SEQ ID NO.3(FLC-Cas9-1F):

[0052] 5'-ATTGAAGCTGTATAGCTTGCCAG-3'

[0053] SEQ ID NO.4(FLC-Cas9-1R):

[0054] 5'-AAACCTGGCAAGCTATACAGCTT-3'

[0055] I. Carrier construction methods include:

[0056] 1. Target primer treatment;

[0057] 1) Before starting the experiment, the target primers need to be dissolved in water to prepare a 10 μM stock solution;

[0058] 2) Take 10 μL of each of the upstream and downstream primers and add them to a 250 μL EP tube;

[0059] 3) Pipette 80 μL of 1×TB (pH 8.0) solution into a 250 μL EP tube;

[0060] 4) Place the EP tube into the PCR instrument and set the program to heat at 98℃ for 5 minutes;

[0061] 5) After the heating process is complete, remove the PCR tubes and allow them to cool at room temperature.

[0062] 2. Construction of the sgRNA intermediate vector

[0063] Using the AtU6-26-sgRNA-SK plasmid, the target fragment obtained above was ligated to a specific location on the SK plasmid (e.g., Figure 1 (as shown),

[0064] Obtain the AtU6-26-sgRNA-SK backbone:

[0065] The first step involves digesting the AtU6-26-sgRNA-SK plasmid with BsaⅠ-HFv2 enzyme to obtain the AtU6-26-sgRNA-SK backbone. The components and amounts of the enzyme digestion system are shown in Table 1.

[0066] Table 1. Components and amounts of the enzyme digestion system used to obtain the AtU6-26-sgRNA-SK backbone.

[0067] Enzyme digestion system components Added amount SK plasmid 12ul BsaⅠ-HFv2 1.5ul rCutSmartBuffer 6ul <![CDATA[ddH2O]]> 40.5ul

[0068] Each component of the above enzyme digestion system was added sequentially to a 1.5 ml centrifuge tube, mixed thoroughly, and digested at 37°C for 4 h. After digestion, the digestion effect was detected by gel electrophoresis, and the digested plasmid fragments were recovered using a gel extraction kit. The components and amounts added to the ligation system for constructing the SK-vector carrying a single target are shown in Table 2.

[0069] Table 2. Components and amounts added to the linker system for constructing SK-vectors carrying single targets.

[0070] Components of the connecting system Added amount SK plasmid after enzyme digestion 2ul Target fragment after annealing 1ul 10XT4 DNA ligase buffer 1ul T4 DNA ligase 0.5ul <![CDATA[ddH2O]]> 5.5ul

[0071] Each component of the above connection system was added sequentially to a 1.5 ml centrifuge tube, mixed thoroughly, and reacted at a constant temperature of 16°C for 1 hour.

[0072] Transformed DH5α competent cells

[0073] Remove DH5α competent cells from the -80°C freezer and thaw them slowly on ice. Once the competent cells are completely thawed, use a pipette to add 100 μL of competent cells to a centrifuge tube containing the ligation product. Gently pipette and mix well. Place the centrifuge tube on ice for 5 min, then heat shock at 42°C for 80 seconds. After the heat shock treatment, return the tube to the ice box and let it stand for another 5 min. After the standing period, add 500 ml of LB medium to the centrifuge tube and incubate at 37°C and 200 rpm for 30 min. Then, pipette 100 μL of the mixture and spread it evenly onto LB+Amp solid medium. Incubate at 37°C for 12 hours.

[0074] Monoclonal identification

[0075] Monoclonal identification was performed using single-colony PCR, with the single-colony colony as the template and the primers being SEQ ID.

[0076] NO.5(SK-gRNA-F):5'-CGACTCACTATAGGGCGAATTGG-3', SEQ ID

[0077] NO.6 (SK-gRNA-R): 5'-CCTCACTAAAGGGAACAAAAGCTGG-3', use a white (10ul) pipette tip to gently pick up a single clone of bacteria. First, dip the tip into the "colony PCR premix" three to four times, then insert the pipette tip into a shaker tube containing LB+Amp liquid medium.

[0078] Table 3. Components and amounts of premixed PCR solution for single clonal identification.

[0079] Colony PCR premix components Added amount 2XPCRMix 12.5ul SK-gRNA-F 1ul SK-gRNA-R 1ul <![CDATA[ddH2O]]> 10.5ul

[0080] Table 4. PCR reaction procedure for monoclonal identification

[0081]

[0082] The amplified target fragment was approximately 500 bp in length. It was detected by 1% agarose gel electrophoresis at 220V for 20 min. The corresponding shake tubes of correctly identified single clones were selected, and 5 ml of LB+Amp liquid medium was added. The cells were incubated at 37℃ and 200 rpm for 12 hours. The plasmid was extracted using the "Plasmid Mini-Prep Kit" and sent for sequencing to further confirm the correct ligation.

[0083] 3. Constructing CRISPR / Cas9 vectors for FLC target sequences

[0084] The SK-gRNA plasmid vector carrying the FLC target was obtained by digestion with SpeⅠ and Nhe enzymes. The enzyme digestion system is shown in Table 5 below:

[0085] Table 5. Enzyme digestion system of CRISPR / Cas9 vector for FLC target sequences.

[0086] Enzyme digestion system components Added amount SK-gRNA plasmid 15ul SpeⅠ 1.5ul NheⅠ 1.5ul CutSmartBuffer 6ul <![CDATA[ddH2O]]> 36ul

[0087] Each component of the above enzyme digestion system was added sequentially to a 1.5 ml centrifuge tube, mixed thoroughly, and digested at 37°C for 4 h. After digestion, the enzyme digestion effect was detected by gel electrophoresis, and the 650 bp fragment after digestion was recovered using a gel recovery kit.

[0088] Table 6 CRISPR / Cas9 vector linearization system

[0089] Enzyme digestion system components Added amount CRISPR / Cas9 plasmid 15ul SpeⅠ 1.5ul CutSmartBuffer 6ul <![CDATA[ddH2O]]> 37.5ul

[0090] Each component of the above enzyme digestion system was added sequentially to a 1.5 ml centrifuge tube, mixed thoroughly, and digested at 37°C for 4 h. After digestion, the enzyme digestion effect was detected by gel electrophoresis, and the linearized fragment of the plasmid was recovered using a gel recovery kit. Then, it was dephosphorylated by CIP treatment.

[0091] Table 7. Construction of CRISPR / Cas9 vectors carrying gRNA

[0092] Components of the connecting system Added amount Linearized CRISPR / Cas9 fragments 2ul sgRNAcassette 1ul 10XT4 DNA ligase buffer 1ul T4 DNA ligase 0.5ul <![CDATA[ddH2O]]> 5.5ul

[0093] Each component of the above connection system was added sequentially to a 1.5 ml centrifuge tube, mixed thoroughly, and reacted at a constant temperature of 16°C for 1 hour.

[0094] Transformed DH5α competent cells

[0095] Remove DH5α competent cells from the -80°C freezer and thaw them slowly on ice. Once the competent cells are completely thawed, use a pipette to add 100 μL of competent cells to a centrifuge tube containing the ligation product. Gently pipette and mix well. Place the centrifuge tube on ice for 5 min, then heat shock at 42°C for 80 seconds. After the heat shock treatment, return the tube to the ice box and let it stand for another 5 min. After the standing period, add 500 ml of LB medium to the centrifuge tube and incubate at 37°C and 200 rpm for 30 min. Then, pipette 100 μL of the mixture and spread it evenly onto LB+Kan solid medium. Incubate at 37°C for 12 hours.

[0096] Monoclonal identification

[0097] Monoclonal identification was performed using single-colony PCR, with single-colony colonies as templates and primers as follows.

[0098] SEQ ID NO.7(1300-gRNA-F):CCAGTCACGACGTTGTAAAAC

[0099] SEQ ID NO.8(1300-gRNA-R):CAATGAATTTCCCATCGTCGAG. Use a white (10ul) pipette tip to gently pick up a single clone of bacteria. First, dip the tip into the "colony PCR premix" three to four times, and then put the pipette tip into a shaker tube containing LB+Kan liquid medium.

[0100] Table 8. Components and amounts of colony PCR premix for single clonal identification.

[0101] Colony PCR premix components Added amount 2XPCRMix 12.5ul 1300-gRNA-F 1ul 1300-gRNA-R 1ul <![CDATA[ddH2O]]> 10.5ul

[0102] Table 9. PCR reaction procedure for monoclonal identification

[0103]

[0104] The amplified target fragment was approximately 750 bp in length. It was detected by 1% agarose gel electrophoresis at 220V for 20 min. The corresponding shake tubes of correctly identified single clones were selected, and 5 ml of LB+Kan liquid medium was added. The cells were incubated at 37℃ and 200 rpm for 12 hours. The plasmid was extracted using a plasmid mini-preparation kit and sent for sequencing to further confirm the correct ligation.

[0105] II. Agrobacterium-mediated transformation of CRISPR / Cas9-FLC plasmids

[0106] GV3101 Agrobacterium competent cells were removed from the -80°C freezer and slowly thawed on ice. After the competent cells were completely thawed, 100 μL of competent cells were pipetted into a centrifuge tube containing the ligation product. The mixture was slowly aspirated and mixed. The centrifuge tube was placed in liquid nitrogen for 5 min, then heat-shocked at 37°C for 80 seconds. After the heat-shock treatment, the tube was placed back in the ice box and allowed to stand for 5 min. After the standing period, 500 ml of LB medium was added to the centrifuge tube and the tube was incubated at 30°C and 200 rpm for 90 min. 100 μL of the culture was then evenly spread onto LB+Kan+Rif solid medium and incubated at 37°C for 48 hours. Single-colony PCR was used to identify Agrobacterium monoclonal strains. Using monoclonal colonies as templates, primers were SEQ ID No. 5 (1300-gRNA-F): CCAGTCACGACGTTGTAAAAC and SEQ ID No. 6 (1300-gRNA-R): CAATGAATTTCCCATCGTCGAG. A single colony was picked up with a white (10 μL) pipette tip and gently dipped three to four times into the "colony PCR premix". The amplified target fragment was approximately 750 bp in length. Detection was performed by 1% agarose gel electrophoresis at 220 V for 20 min. The corresponding shake tubes of correctly identified monoclonal strains were selected, and 5 ml of LB+Kan+Rif liquid medium were added. The tubes were incubated at 30°C and 200 rpm for 18 hours.

[0107] III. Agrobacterium-mediated genetic transformation of *Ipomoea aquatica*

[0108] 1. Inoculate the glycerol stock solution of Agrobacterium (GV3101) containing the CRISPR-Cas9_Hyg plasmid into 3 mL of LB (50 mg / L kanamycin, 25 mg / L rifampicin) medium and incubate overnight at 28°C. Then, inoculate the cultured bacterial solution into 250 mL of LB (50 mg / L kanamycin, 25 mg / L rifampicin) medium and incubate overnight at 28°C.

[0109] 2. Centrifuge the overnight cultured Agrobacterium tumefaciens suspension at 3500g for 10 minutes, discard the supernatant, and resuspend the bacterial cells in 5% (w / v) sucrose + 0.02% (v / v) Silwet L-77 solution, and adjust the OD of the suspension to 0.8.

[0110] 3. Prepare the *Ipomoea aquatica* plants. Soak the inflorescences of the plants, which have been open for about 5 days, in a suspension of *Agrobacterium* and vacuum treat for 5-10 minutes.

[0111] 4. Wrap the infected inflorescence with plastic wrap and seal the stem with rubber bands. Place the plant back in the growing room and remove the plastic wrap the next day.

[0112] 5. Harvest the seeds after the plants have grown to maturity.

[0113] 6. Screening of positive seedlings

[0114] ① Transfer the rinsed seeds into the laminar flow hood and light the alcohol lamp;

[0115] ② Rinse twice with sterile water in the laminar flow hood (rinse by injecting distilled water using a pipette);

[0116] ③ Use a pipette to add about 4.5 mL of 75% alcohol to a 5 ml centrifuge tube to soak the seeds, and shake continuously while inverting for 2 minutes. Then rinse 3 times with sterile water.

[0117] ④ Use a pipette to add about 4.5 mL of 10% sodium hypochlorite solution to the centrifuge tube, soak it, shake and invert for 10 minutes, and then rinse it 3 times with sterile water.

[0118] ⑤ Use a pipette to add about 4.5 mL of 0.1% agar solution to the centrifuge tube to suspend the seeds and shake well;

[0119] ⑥ Use a 1.25 mL pipette with the tip cut off to pick up the seeds and inoculate them into the positive selection medium (MS + 50 mg / L cephalosporin antibiotic + 60 mg / L hygromycin), inoculating about 100 seeds into each dish;

[0120] ⑦ Seal the inoculated culture dishes with 3M breathable sealing film and label them accordingly;

[0121] ⑧ Transfer to the incubator. The incubator program is divided into two stages, with the temperature set at 22℃ and the humidity at 50%. The first stage has an illumination of 9000 LUX for 16 hours, and the second stage has an illumination of 0 LUX for 8 hours.

[0122] ⑨ After inoculation, the seeds are continuously observed, and positive seedlings with normal growth are selected. After the seeds have grown on the selection medium for about 3 weeks, their growth is observed. If any plant shows similar growth to the control, is significantly better than other plants, and has well-developed roots, it can be considered a positive seedling and transplanted for later identification. The phenotype of positive seedlings is as follows: Figure 2 As shown.

[0123] 7. Identification of positive seedlings

[0124] 1) DNA extraction from seedling leaves

[0125] Instrument and reagent preparation

[0126] ● Grinding machine, centrifuge, water bath, ice maker, Adley's new plant genomic DNA rapid extraction kit, etc.

[0127] ●Young plant tissues (150mg from leaves).

[0128] ●When using it for the first time, you need to add a certain amount of anhydrous ethanol to WB and buffer AP3 in advance as required, mix thoroughly, and mark the bottle in time (check the box) to avoid adding it multiple times.

[0129] The operating steps include:

[0130] (1) Prepare a 2mL centrifuge tube for each sample, add 600μL of buffer AP1 and 150mg of fresh leaves, add 1 5mm steel ball and 2 3mm steel balls, and grind with a grinder at 45Hz for 180s.

[0131] (2) Add 6 μL of RNase A (10 mg / mL) to the grinding solution and mix thoroughly and accelerate lysis by vortexing.

[0132] (3) Heat the centrifuge tube in a 65℃ water bath for 10 minutes. During the water bath, the centrifuge tube needs to be inverted 2-3 times to mix the sample.

[0133] (4) After briefly centrifuging the above mixture, transfer it to a new 1.5 mL centrifuge tube, discard the steel ball, add 195 μL of buffer AP2, vortex for 1 minute to mix, and place on ice for 5 minutes. After centrifuging at 13,000 rpm for 10 minutes, transfer the supernatant to a new 1.5 mL centrifuge tube, being careful not to aspirate any interfacial material.

[0134] (5) Calculate the volume of supernatant, add 1.5 times the volume (about 900 μL) of AP3 / E, and immediately shake to mix.

[0135] Note: After adding AP3 to the clear liquid, it is necessary to immediately mix it by blowing or shaking.

[0136] (6) Add the mixture obtained in the previous step (including any possible precipitate) to an adsorption column AC (place the adsorption column in the collection tube), centrifuge at 13,000 rpm for 60 seconds, and discard the waste liquid in the collection tube (first add 750 μL, centrifuge, discard the waste liquid, then add the remaining solution, and centrifuge again).

[0137] (7) Add 600 μL of rinsing solution WB, centrifuge at 13000 rpm for 30 seconds, and discard the waste liquid.

[0138] (8) Repeat the operation steps (7) once.

[0139] Note: If the adsorption column membrane still shows a lot of green pigment, this rinsing step can be added. Add 500 μL of anhydrous ethanol to the adsorption column AC, centrifuge at 13,000 rpm for 30 seconds, and discard the waste liquid.

[0140] (9) Place the adsorption column AC back into the empty collection tube and centrifuge at 13,000 rpm for 2 minutes to remove as much of the washing liquid as possible to avoid ethanol residue inhibiting the downstream reaction.

[0141] (10) Remove the adsorption column AC and place it in a clean centrifuge tube. Add 50 μL of elution buffer EB to the middle of the adsorption membrane, incubate at room temperature for 3-5 minutes, and centrifuge at 13,000 rpm for 1 minute. Add the resulting solution back into the adsorption column, incubate at room temperature for 2 minutes, and centrifuge at 13,000 rpm for 1 minute.

[0142] (11) DNA can be temporarily stored at 2-8℃, but for long-term storage, it needs to be placed at -20℃.

[0143] 2) PCR amplification and gel electrophoresis

[0144] (1) Preparation of instruments and reagents

[0145] ● Ice maker, PCR instrument, PCR tubes and yellow plate, pipette and pipette tip, electrophoresis apparatus, gel imaging system, UV spectrometer, 2mL centrifuge tubes.

[0146] ●The above DNA sample, 2×HiFi Master Mix, corresponding primers, and sterile water.

[0147] FLC-NGS-F1 (SEQ ID No. 9):

[0148] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCATCTCGTCAGCTTTCTGTTCTC

[0149] FLC-NGS-R1 (SEQ ID No. 10):

[0150] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTACGcccagaagaggagaagtcg

[0151] The operating steps include:

[0152] (a) Prepare the PCR sample in the following proportions, mix well, and collect the residue on the tube wall after a short time.

[0153] Table 10 PCR Amplification System

[0154]

[0155] (b) The PCR reaction procedure is shown in the table below:

[0156] Table 11 PCR reaction procedure for identifying positive seedlings

[0157]

[0158] ×33 cycles;

[0159] (c) Prepare a 1% agarose gel, such as 1g agarose + 100mL 1×TBE + 7μL nucleic acid dye, pour it into the gel tank and cool for more than 30min;

[0160] (d) Spotting (Note: 6×Loading Buffer needs to be added in advance according to the ratio);

[0161] (e) Run the gel for about 20 minutes, adjusting the time as needed based on the size of the strip;

[0162] (f) Take photos and cut the gel: Take photos in the UV mode of the gel imaging system to record the day's experiment; prepare a clean 2mL centrifuge tube, put the gel block into the UV instrument, cut the target band with a tissue culture knife, put it into a 2mL centrifuge tube, and label it.

[0163] (g) Recover the gel.

[0164] 3) Sequencing of recovered products

[0165] The gel recovery product was aliquoted into 20 μL portions, and the following primers were prepared and sent to the sequencing company. The sequencing results were then analyzed and compared with the wild type to confirm whether base insertion or deletion had occurred.

[0166] Regarding plant height, the final mature plant height (i.e., the plant height at the end of the entire growth period) of wild-type plants and the *Ilex chinensis* flc mutant plants in Example 1 was statistically analyzed.

[0167] Ten wild-type control plants and 20 flc mutant plants from this invention were randomly selected for height statistics, as shown in Tables 12 and 13, respectively. A schematic diagram comparing the heights of the flc mutant plants (right) and wild-type plants (left) is shown below. Figure 9 As shown.

[0168] Table 12 Plant height of wild-type plants

[0169]

[0170] Table 13 Plant height of flc mutant plants

[0171] Plant number Plant height (cm) 1200000004-152 55.1 1200000004-158 57.7 1200000004-161 53.6 1200000004-167 58.4 1200000004-172 54.8 1200000004-179 57.5 1200000004-181 56.1 1200000004-186 54.8 1200000004-195 58.3 1200000004-198 55.7 1200000005-156 54.6 1200000005-159 57.5 1200000005-164 56.1 1200000005-167 58.2 1200000005-174 54.4 1200000005-178 57.6 1200000005-182 55.3 1200000005-186 57.8 1200000005-192 56.4 1200000005-199 54.2 average value 56.2

[0172] In addition, regarding seed yield, 10 wild-type control plants and 10 flc mutant plants from this embodiment of the invention were randomly selected to count the seed yield per plant. It is worth noting that the seed yield per plant at final maturity (i.e., the seed yield per plant at the end of the entire growth period) is counted in this embodiment, as shown in Tables 14 and 15, respectively.

[0173] Table 14 Seed yield per wild-type plant

[0174]

[0175] Table 15 Seed yield per plant of the flc mutant.

[0176]

[0177] Results Analysis: 1. The sequencing results were compared with the wild-type sequence. The red boxes represent the bases or sequences that were inserted or deleted compared with the wild-type (e.g., ...). Figure 3 and Figure 4 (As shown). The phenotype of the *Illicium verum* flc mutant plant of the present invention (e.g.) Figure 3 (a), (b), (c), (e), (f) shown in the figures) and wild-type plants (such as... Figure 3 Compared to (d) shown in the figure, flowering occurs one month earlier and the entire growth period of the *Xanthus spp.* flc mutant is shortened to about 80 days. This provides the necessary conditions for *Xanthus spp.* to become a new model plant, greatly shortening the plant growth cycle compared to the current total growth period of about 140 days.

[0178] 2. Statistical results on plant height and seed yield show that the average plant height of the flc mutant plants in this embodiment is approximately 56 cm, while the average plant height of the control wild-type plants is approximately 77 cm. Compared to the wild-type plants, the plant height is significantly reduced. The reduced plant height and smaller size improve lodging resistance. The flc mutant plants of this invention are suitable for dense planting. Currently, the planting density of wild-type flc is 30,000 plants / acre, while the planting density of the flc mutant plants of this invention can reach 150,000-200,000 plants / acre. Therefore, although the seed yield per plant is reduced, the flc mutant plants of this invention, due to their suitability for dense planting, can increase the seed yield per acre by at least two times.

[0179] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and do not constitute a limitation on the content of the present invention. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including combining various technical features in any other suitable manner. These simple modifications and combinations should also be regarded as the content disclosed in the present invention and all fall within the protection scope of the present invention.

Claims

1. A method for improving a variety of Imbricata arborvitae, comprising: The invention provides a gene-edited antler cristatus variety by making the antler cristatus contain a modified antler cristatus FLC gene with reduced or inactivated activity, wherein the modified antler cristatus FLC gene contains a modified target sequence, and the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or replacing and / or adding and / or inverting and / or modifying at least one nucleotide within the target sequence shown in SEQ ID NO. 2 and / or within 30 bp upstream and downstream of the target sequence; The gene-edited iris variety includes the following changes: early flowering and fruiting, shortened growth period, dwarfed plants, lodging resistance, facilitation of dense planting and increased seed yield.

2. The method for improving the variety of Cyperus rotundus according to claim 1, characterized in that: The method comprises using gene editing technology to modify the target sequence shown in SEQ ID NO. 2 to obtain a modified Cyperus rotundus FLC gene, so that the activity of the Cyperus rotundus FLC gene is reduced or inactivated.

3. The method for improving and cultivating anthriscus arvense variety according to claim 2, wherein: The gene editing includes at least one of gene knockout, gene knockdown, gene insertion, base substitution, gene mutation, and gene recombination.

4. Use of the method for improving anthracene arborvitae varieties according to any one of claims 1 to 3 in the following changes: early flowering and fruiting of anthracene arborvitae, shortening of the growth period, dwarfing of the plant, resistance to lodging, facilitation of dense planting, and improvement of seed yield.

Citation Information

Patent Citations

  • Nucleotide sequence and corresponding polypeptide for endowing plant with adjusted growth velocity and biomass

    CN101370938A

  • Cloning and application of flowering period BnFLC.A2 and Bnflc.a2 genes of brassica napus

    CN106834303A