Genetic engineering strain based on tRNA (transfer ribonucleic acid) modification as well as preparation method and application thereof

Abstract

The invention provides a gene engineering strain based on tRNA (transfer ribonucleic acid) modification as well as a preparation method and application of the gene engineering strain. An inhibitory tRNA coding sequence is directly recombined into a yeast cell genome, so that the problem that the gene cannot be normally expressed due to the fact that the inhibitory tRNA gene is directly inserted into the yeast cell genome is solved, and the purpose of preparing the non-natural amino acid protein is achieved.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to a gene engineering strain and a preparation method and application thereof. Background Art

[0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology is a revolutionary gene editing tool that is widely used in the fields of biology and medical research. It is based on the natural immune system of bacteria and archaea and can accurately edit, add or delete gene sequences. The core components of CRISPR technology include CRISPR sequences and Cas proteins. The CRISPR sequence is a DNA sequence that contains a series of repeated and spaced sequences that come from foreign viruses or plasmids that bacteria or archaea have encountered. The Cas protein is the core protein in the CRISPR system, which can recognize and cut these foreign DNA sequences. Compared with traditional gene editing methods, CRISPR technology is faster and more accurate, and can achieve large-scale gene editing in a short period of time.

[0003] Amber codon tRNA is a special tRNA that corresponds to the amber codon in the genetic code. The amber codon is a stop codon, and when it is encountered, the protein synthesis process will stop. However, by introducing amber codon tRNA into yeast cells, the insertion of unnatural amino acids can be achieved. The specific implementation method is to pair a specific unnatural amino acid with an amber codon so that it can be inserted into the protein sequence. In order to achieve this process, it is first necessary to design and synthesize an unnatural amino acid that can pair with an amber codon so that it can be recognized by the amber codon tRNA and inserted into the protein. The introduction of amber codon tRNA makes the amber codon no longer a termination signal for protein synthesis, but a signal for inserting unnatural amino acids. When amber codon tRNA and the corresponding unnatural amino acid are present in yeast cells, the process of synthesizing proteins will not stop at the amber codon, but will insert unnatural amino acids, thereby achieving protein modification.

[0004] The introduction of non-natural amino acids can change the structure and properties of some drug molecules, thereby changing the activity, stability, and pharmacokinetics of the drugs. By synthesizing non-natural amino acids, more active and selective drug molecules can be designed and synthesized, improving the efficacy of drugs and reducing side effects. Secondly, the introduction of non-natural amino acids can change the solubility, lipid solubility, drug binding and other characteristics of drugs, thereby improving the absorption and distribution characteristics of drugs, and increasing the bioavailability and efficacy of drugs in the body. In addition, the introduction of non-natural amino acids can increase the stability of drug molecules, reduce drug degradation and failure, and extend the shelf life of drugs.

[0005] However, the inserted amber codon tRNA gene may have sequence instability or structural problems, which may prevent it from being correctly recognized and transcribed by yeast cells. Secondly, the amber codon tRNA gene may be incompatible with the transcription and translation mechanisms of yeast cells, resulting in failure to express normally. In addition, other metabolic pathways and regulatory mechanisms within yeast cells may also affect the expression of amber codon tRNA genes. For example, yeast cells may have certain negative regulatory mechanisms that inhibit the expression of amber codon tRNA genes. Alternatively, the expression of amber codon tRNA genes may be affected by intracellular environmental factors, such as nutritional conditions or temperature.

[0006] Therefore, a technology for expressing amber codon tRNA in yeast is provided, which can achieve the purpose of synthesizing proteins containing unnatural amino acids in yeast cells. Summary of the invention

[0007] The present invention utilizes CRISPR technology to integrate inhibitory tRNA into cells, so that the modified strain can efficiently and stably express inhibitory tRNA, thereby realizing the ability to express proteins containing non-natural amino acids (ncaa) outside the cell.

[0008] The first aspect of the present invention provides a nucleic acid construct, wherein the structure of the nucleic acid construct is formula (I): Z1-Z2-Z3,

[0009] In the formula, Z1-Z3 are elements used to constitute the structure respectively;

[0010] Each "-" is independently a bond or a nucleotide linking sequence;

[0011] Z1 is the promoter sequence;

[0012] Z2 is none or a connection sequence;

[0013] Z3 is the gene sequence of inhibitory tRNA.

[0014] Furthermore, the promoter is selected from tDNA, SNR52, SNR6, Pol III, U6, U3, SCR1, RPR1 or H1.

[0015] Furthermore, the promoter is preferably tDNA or SNR52.

[0016] Further, the inhibitory tRNA is selected from amber codon tRNA, ochre codon tRNA or opal codon tRNA; preferably amber codon tRNA; further preferably tRNA TAG Pyl .

[0017] Further, the structure of formula (I) is selected from Z1-Z2-tDNA TAG Pyl , the tDNA TAG Pyl Select from wild type or mutant.

[0018] Further, the structure of formula (I) is selected from tDNA-Z2-tDNA TAG Pyl , the tDNA TAG Pyl Select from wild type or mutant.

[0019] Furthermore, the tDNA is selected from tDNA Arg , tDNA Ala , tDNA Asp , tDNA Cys , tDNA Gln , tDNA Leu , tDNA Pro , tDNA Tyr , tDNA Val , tDNA Ser , tDNA Gly , tDNA His , tDNA Ile , tDNA Lys , tDNA Met , tDNA Phe , tDNA Thr tDNA Glu .

[0020] Further preferably, the promoter is selected from tDNA UCU Arg .

[0021] Further preferably, the structure of formula (I) is selected from tDNA Arg -Z2-tDNA TAG Pyl; Further preferably, the structure of formula (I) is selected from tDNA UCU Arg -Z2-tDNA TAG Pyl .

[0022] Further preferably, the Z2 is selected from a connecting sequence, and the connecting sequence is selected from CTTTGTTTCT, i.e. SEQ ID NO: 30.

[0023] Furthermore, the Z3 is a single copy or multiple copy gene sequence of an inhibitory tRNA, and further preferably, the number of the multiple copies is less than or equal to 6.

[0024] Furthermore, the sequence number of the structure of formula (I) is SEQ ID NO: 25-29.

[0025] The second aspect of the present invention provides a genetically engineered strain, wherein the genome of the strain is integrated with a nucleic acid construct comprising at least one inhibitory tRNA gene sequence.

[0026] Furthermore, the nucleic acid construct is the nucleic acid construct described in the first aspect of the present invention.

[0027] Furthermore, the strain is derived from bacteria, mammalian cells, human cells, plant cells, yeast cells, insect cells or any combination thereof.

[0028] Furthermore, the cell extract is more preferably selected from any one of the following sources: Escherichia coli, Kluyveromyces lactis, wheat germ cells, Spodoptera frugiperda insect cells, rabbit reticulocytes, CHO cells, COS cells, VERO cells, BHK cells, human fibrosarcoma HT1080 cells, or a combination thereof.

[0029] Further preferably, the cell extract is derived from yeast cells.

[0030] Further, the yeast cell is selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta, Ogataeaminuta, Pichia lindneri, Pichia cactus, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae. cerevisiae), brewer's yeast, sugar cane molasses yeast, Saccharomyces cerevisiae, Hansenula polymorpha, Candida utilis, Kluyveromyces cerevisiae, or a combination thereof.

[0031] More preferably, the Kluyveromyces further includes: Kluyveromyces lactis (Kluyveromyces, K.lactis), Kluyveromyces marxianus, Kluyveromyces dobzhanskii, Kluyveromyces aestuarii, Kluyveromyces nonfermentans, Kluyveromyces wickerhamii, Kluyveromyces thermotolerans, Kluyveromyces fragilis, Kluyveromyces hubeiensis, Kluyveromyces polysporus, Kluyveromyces siamensis, Kluyveromyces yaro yarrowii) or a combination thereof; preferably, the yeast cell is a Kluyveromyces cell, more preferably a Kluyveromyces lactis cell.

[0032] Further preferably, the nucleic acid construct is integrated into the genome of the strain via an insertion site, and the insertion site is UPF1 or endogenous tDNA.

[0033] The third aspect of the present invention provides a method for preparing a genetically engineered strain according to the second aspect of the present invention, wherein the nucleic acid construct is inserted into the genome of the strain via the UPF1 site.

[0034] Furthermore, the nucleic acid construct is inserted into the genome of the strain via any position in the UPF1 site.

[0035] The fourth aspect of the present invention provides a method for preparing a genetically engineered strain provided in the second aspect of the present invention, wherein the nucleic acid construct is inserted into the genome of the strain via 1 to 1000 bp at the 5' end and / or 3' end of the endogenous tDNA sequence; preferably 100 to 800 bp; further preferably 200 to 500 bp; most preferably 300 bp.

[0036] Furthermore, the nucleic acid construct is inserted into the 3' segment of the endogenous tDNA sequence.

[0037] The fifth aspect of the present invention provides a method for synthesizing proteins incorporating non-natural amino acids, using the genetically engineered strain described in the fifth aspect of the present invention to provide inhibitory tRNA.

[0038] The sixth aspect of the present invention provides a cell-free synthesis system for synthesizing proteins incorporated with non-natural amino acids, wherein the system at least comprises a cell extract derived from the genetically engineered strain provided by the second aspect of the present invention.

[0039] Furthermore, the system also includes aminoacyl-tRNA synthetase and unnatural amino acids.

[0040] Furthermore, the aminoacyl tRNA synthetase is selected from natural or mutant Pyl-tRNA synthetase (PylRS), Leu-tRNA synthetase (LeuRS), Tyr-tRNA synthetase (TyrRS), Phe-tRNA synthetase (PheRS) or TrP-tRNA synthetase (TrpRS), and is more preferably PylRS.

[0041] Furthermore, the aminoacyl tRNA synthetase is selected from natural or mutant MaPylRS, MmPylRS, MbPylRS, EcTyrRS, MjTyrRS, EcLeuRS, ScPheRS, ScTrpRS, BsTrpRS

[0042] Furthermore, the non-natural amino acids refer to amino acids other than the 20 natural amino acids.

[0043] Furthermore, the structural formula of the non-natural amino acid is a compound of formula (2) or a salt thereof.

[0044] Wherein n is selected from a natural number of 1-20, R1 is selected from a substituted or unsubstituted C5-C60 aryl or heteroaryl, a substituted or unsubstituted C1-C20 alkyl, a substituted or unsubstituted C2-C20 alkenyl or a substituted or unsubstituted C2-C20 alkynyl, and A is selected from O or -CH2-.

[0045] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20.

[0046] In another preferred embodiment, n is a natural number selected from 1-10.

[0047] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.

[0048] In another preferred embodiment, n is a natural number selected from 1-6.

[0049] In another preferred embodiment, n is selected from 1, 2, 3, 4, 5 or 6.

[0050] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C5-C30 aryl or heteroaryl.

[0051] In another preferred embodiment, the R1 is selected from substituted or unsubstituted phenyl.

[0052] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C20 alkenyl.

[0053] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C10 alkenyl.

[0054] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C6 alkenyl.

[0055] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C20 alkynyl.

[0056] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C10 alkynyl.

[0057] In another preferred embodiment, the R1 is selected from substituted or unsubstituted C2-C6 alkynyl.

[0058] In another preferred embodiment, the A is selected from O.

[0059] In another preferred embodiment, the A is selected from -CH2-.

[0060] In another preferred embodiment, the substituents are common substituents in the art, such as aryl, heteroaryl, alkyl, cycloalkyl, aryloxy, heteroaryloxy, alkyloxy, cycloalkyloxy, hydroxyl, thiol, ester, carboxyl, cyano, halogen, nitro, sulfonic acid, azido, alkenyl, alkynyl, phosphate, etc.

[0061] In another preferred embodiment, the structural formula of the non-natural amino acid is selected from one or a combination of the following, or a salt form thereof:

[0062]

[0063]

[0064] The seventh aspect of the present invention provides an application of the genetically engineered strain provided in the second aspect of the present invention or the cell-free synthesis system provided in the sixth aspect of the present invention in the cell-free synthesis of proteins incorporated with non-natural amino acids.

[0065] The eighth aspect of the present invention provides a kit, which includes the cell-free synthesis system provided by the sixth aspect of the present invention.

[0066] The ninth aspect of the present invention provides a method for cell-free synthesis of proteins incorporated with non-natural amino acids, comprising the following steps: step (1), providing the cell-free synthesis system provided in the sixth aspect of the present invention or the kit provided in the eighth aspect of the present invention; step (2), adding a DNA molecule encoding an exogenous protein to the synthesis system or the kit described in step (1), and obtaining the protein by reaction in the presence of aminoacyl-tRNA synthetase and non-natural amino acids.

[0067] Furthermore, the exogenous protein is selected from: luciferin, luciferase (such as firefly luciferase), fluorescent protein (such as green fluorescent protein, yellow fluorescent protein, red fluorescent protein), aminoacyl-tRNA synthetase, glyceraldehyde-3-phosphate dehydrogenase, catalase, actin, variable region of antibody, luciferase mutation, α-amylase, enterobactin A, hepatitis C virus E2 glycoprotein, insulin precursor, interferon αA, cytokine, interferon α2b, interleukin-1β, lysozyme, serum albumin, single-chain antibody fragment (scFV), thyroxine transporter, tyrosinase, xylanase or a combination thereof.

[0068] Furthermore, the exogenous protein includes a wild-type protein, a mutant protein or a recombinant protein.

[0069] The advantages of the present invention are:

[0070] (1) The inhibitory tRNA gene is directly recombined into the yeast cell genome, which solves the problem that the inhibitory tRNA gene cannot be expressed normally when it is directly inserted into the yeast cell genome.

[0071] (2) The designed inhibitory tRNA structure can normally transcribe inhibitory tRNA and can normally transport non-natural amino acids to specific stop codons (such as TAG), thereby achieving the purpose of preparing non-natural amino acid proteins.

[0072] (3) By inserting non-natural amino acids at specific positions, special functional proteins can be produced, which has great development potential in the fields of chemical industry and pharmaceutical industry.

[0073] (4) The recombinant strain has a stable structure and can be produced on an industrial scale, thereby further realizing the industrial production of non-natural amino acid proteins.

[0074] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 The structure of the insert sequence 3002 of the present invention is shown.

[0076] Figure 2 The sequencing results of Example 1 are shown.

[0077] Figure 3 The sequencing results of Example 4 are shown.

[0078] Figures 4 to 7 It shows the activity verification of the efficiency of non-natural amino acid insertion of strains transformed 1 to 10, where Figure 4 and Figure 6 It represents the activity verification of the efficiency of non-natural amino acid insertion in strains transformed by insertion into sites near endogenous tDNA; Figure 5 and Figure 7 The figure shows the activity verification of the efficiency of non-natural amino acid insertion in strains transformed by UPF1 site insertion. Figures 4 to 7 In the sequence, the insertion sequences corresponding to wt and upf1-wt are the same, and the insertion sequences corresponding to mut1~4 and upf1-mut1~upf1-4 are the same, respectively. DETAILED DESCRIPTION

[0079] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application may be combined with each other.

[0080] The present invention is further described below in conjunction with specific embodiments and examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are preferably followed or referred to the conditions indicated in the specific embodiments described above, and then can be followed according to conventional conditions or according to the conditions recommended by the manufacturer.

[0081] Unless otherwise specified, the percentages and parts mentioned in the present invention are percentages and parts by weight.

[0082] Unless otherwise specified, the materials and reagents used in the examples of the present invention are all commercially available products.

[0083] Unless otherwise specified, the temperature units in this application are all degrees Celsius (°C).

[0084] Nouns and terms

[0085] The following is an explanation or description of the meaning of some relevant "nouns" and "terms" used in the present invention, so as to better understand the present invention. The corresponding explanation or description applies to the full text of the present invention, both below and above. When the present invention involves references, the definitions of relevant terms, nouns, and phrases in the references are also quoted, but when they conflict with the definitions in the present invention, the definitions in the present invention shall prevail. When the definitions in the references conflict with the definitions in the present invention, it does not affect the cited components, substances, compositions, materials, systems, formulations, types, methods, equipment, etc., which shall be subject to the contents determined in the references.

[0086] In the present invention, preferred embodiments such as “preferred”, “better”, “more preferred”, “better”, “most preferred” and “further preferred” do not constitute any limitation on the scope of coverage and protection scope of the invention, and are not used to limit the scope and embodiments of the present invention, but are only used to provide some embodiments as examples.

[0087] In the description of the present invention, preferred modes such as "one of the preferred embodiments", "one of the preferred modes", "one of the preferred embodiments", "one of the preferred examples", "preferred examples", "in a preferred embodiment", "some preferred examples", "some preferred modes", "preferably", "preferably", "preferably", "more preferably", "more preferably", "further preferably", "most preferably", and illustrative enumeration modes such as "one of the embodiments", "one of the modes", "example", "specific example", "for example", "as an example", "for example", "such as", "such as", etc., do not constitute any limitation on the scope of coverage and protection scope of the invention, and the specific features described in each mode are included in at least one specific embodiment of the present invention. In the present invention, the specific features described in each mode may be combined in a suitable manner in any one or more specific embodiments. In the present invention, the technical features or technical solutions corresponding to each preferred mode may also be combined in any suitable manner.

[0088] In the present invention, "any combination thereof" means "greater than 1" in terms of quantity, and means a group consisting of the following situations in terms of coverage: "select any one of them, or select a group consisting of at least two of them".

[0089] In the present invention, the descriptions of "one or more", "one or more" and "one or more" have the same meaning as "at least one", "at least one", "a combination thereof", "or a combination thereof", "and combinations thereof", "or any combination thereof", "and any combination thereof", etc. and can be used interchangeably to indicate that the quantity is equal to "1" or "greater than 1".

[0090] In the present invention, "or / and" and "and / or" are used to represent "optionally one of them or optionally a combination of them", and also represent at least one of them.

[0091] The term "about" can refer to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0092] Sequence identity (or homology) is determined by comparing two aligned sequences along a predetermined comparison window (which can be 50%, 60%, 70%, 80%, 90%, 95% or 100% of the length of the reference nucleotide sequence or protein) and determining the number of positions at which identical residues occur. Typically, this is expressed as a percentage. The measurement of sequence identity of nucleotide sequences is a method well known to those skilled in the art.

[0093] The prior art means described in the present invention in such ways as “usually”, “conventional”, “general”, “frequently” and “often” are also cited as references to the contents of the present invention. Unless otherwise specified, they can be regarded as one of the preferred ways of some technical features of the present invention. It should be noted that they do not constitute any limitation on the scope of coverage and protection scope of the invention.

[0094] All documents mentioned in the present invention and documents directly or indirectly cited by these documents are cited in this application as references, just as if each document was cited individually as a reference.

[0095] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (including but not limited to the embodiments) can be combined with each other to form a new or preferred technical solution, as long as it can be used to implement the present invention. Due to space limitations, they will not be described one by one.

[0096] In vitro protein synthesis reaction refers to the reaction of synthesizing protein in an in vitro cell-free synthesis system, including at least the translation process. Including but not limited to IVT reaction (in vitro translation reaction), IVTT reaction (in vitro transcription and translation reaction), IVDTT reaction (in vitro replication transcription and translation reaction). In the present invention, IVTT reaction is preferred. IVTT reaction, corresponding to IVTT system, is the process of transcribing and translating DNA into protein (Protein) in vitro. Therefore, we also refer to this type of in vitro protein synthesis system as D2P system, D-to-P system, D_to_P system, DNA-to-Protein system; the corresponding in vitro protein synthesis method is also called D2P method, D-to-P method, D_to_P method, DNA-to-Protein method.

[0097] "Cell-free system" refers to a method of in vitro protein synthesis that is not secretory expression through intact cells. It should be noted that in the in vitro cell-free protein synthesis system of the present invention, it is also allowed to add cell components to promote the reaction, but the added cells are not primarily intended to secrete and express exogenous target proteins. In addition, in the intact cell-free D2P system constructed under the guidance of the present invention, a small amount of intact cells are intentionally added (for example, the protein content provided by them is not more than 30wt% compared to the protein content provided by the cell extract). Such a "circumvention" method is also included in the scope of protection of the present invention.

[0098] Exogenous protein: The target expression product of the in vitro protein synthesis system of the present invention is not synthesized by host cell secretion, but is synthesized in vitro based on an exogenous nucleic acid template, and may also be referred to as target protein. The exogenous protein may be a protein, a fusion protein, a mixture of protein molecules or fusion protein molecules; it also broadly includes polypeptides. The product obtained after an in vitro protein synthesis reaction based on a nucleic acid template encoding the target protein may be a single substance or a combination of two or more substances. "Exogenous protein", "target protein", "target protein", "target translation product" have the same meaning and can be translated as "objective protein", "interested protein", "objective translated product", "interested protein product", etc., and may be used interchangeably in the present invention.

[0099] D2P, DNA-to-Protein, from DNA template to protein product. For example, D2P technology, D2P system, D2P method, D2P kit, etc.

[0100] "The expression system of the present invention", "the in vitro expression system of the present invention", "the in vitro cell-free expression system", and "the in vitro cell-free expression system" are used interchangeably, all referring to the in vitro protein expression system of the present invention, and other descriptions may also be used, such as: protein in vitro synthesis system, in vitro protein synthesis system, cell-free system, cell-free system, cell-free protein synthesis system, cell-free in vitro protein synthesis system, in vitro cell-free protein synthesis system, in vitro cell-free synthesis system, CFS system (cell-free system), CFPS system (cell-free protein synthesis system) and other descriptions. According to the reaction mechanism, it may include an in vitro translation system (which may be abbreviated as an IVT system, a mR2P system), an in vitro transcription translation system (which may be abbreviated as an IVTT system, a D2P system), an in vitro replication transcription translation system (which may be abbreviated as an IVDTT system, a D2P system), and the like. In the present invention, the IVTT system is preferred. We also refer to the in vitro protein synthesis system as a "protein synthesis factory" ("Protein Factory" or "proteinfactory" or "Proteinfactory"). The in vitro protein synthesis system provided by the present invention adopts an open description method for its components. The cell-free protein synthesis system of the present invention uses exogenous DNA, mRNA or a combination thereof as a nucleic acid template for protein synthesis, and achieves in vitro synthesis of the target protein by artificially controlling the addition of substrates and transcription, translation-related protein factors and other substances required for protein synthesis.

[0101] In the present invention, "protein" and "protein" have the same meaning, are both translated as protein, and can be used interchangeably.

[0102] In the present invention, "system" and "system" are both translated as system and can be used interchangeably.

[0103] In the present invention, "protein synthesis amount", "protein expression amount" and "protein expression yield" have the same meaning and can be used interchangeably.

[0104] In the present invention, cell extract, cell extract, cell lysate, cell disruption product and cell lysate have the same meaning and can be used interchangeably. In English, cell extract, cell lysate and the like can be used.

[0105] In the present invention, energy system, energy system, and energy supply system have the same meaning and can be used interchangeably. Energy regeneration system and energy regeneration system have the same meaning and can be used interchangeably. The energy regeneration system is a preferred embodiment or component of the energy system.

[0106] Furthermore, the present invention provides a cell-free protein synthesis system, which at least includes a cell extract or a cell lysate.

[0107] Further preferably, the cell-free protein synthesis system further comprises one or more components selected from the following group: a substrate for synthesizing RNA, a substrate for synthesizing protein, polyethylene glycol or its analogues, magnesium ions, potassium ions, a buffer, RNA polymerase, an energy regeneration system, dithiothreitol, and an optional aqueous solvent.

[0108] Further preferably, the substrate for synthesizing RNA includes: nucleoside monophosphate, nucleoside triphosphate or a combination thereof.

[0109] Further preferably, the substrate for synthesizing protein includes: 20 natural amino acids and unnatural amino acids.

[0110] Further preferably, the magnesium ions are derived from a magnesium ion source, and the magnesium ion source is selected from the following group: magnesium acetate, magnesium glutamate, or a combination thereof.

[0111] Further preferably, the potassium ions are derived from a potassium ion source, and the potassium ion source is selected from the following group: potassium acetate, potassium glutamate, or a combination thereof.

[0112] Further preferably, the energy regeneration system is selected from the following group: one or a combination of creatine phosphate / creatine phosphate enzyme system, glycolysis pathway and its intermediate energy system.

[0113] Further preferably, the energy regeneration system comprises a glucose / phosphate system, and the phosphate is selected from the following group: tripotassium phosphate, triammonium phosphate, trisodium phosphate, dipotassium hydrogen phosphate, diammonium hydrogen phosphate, disodium hydrogen phosphate, potassium dihydrogen phosphate, ammonium dihydrogen phosphate, sodium dihydrogen phosphate, or a combination thereof.

[0114] Further preferably, the buffer is selected from the following group: 4-hydroxyethylpiperazineethanesulfonic acid, tris(hydroxymethyl)aminomethane, or a combination thereof.

[0115] Further preferably, the in vitro protein synthesis system contains polyethylene glycol (PEG) or its analogs. The concentration of polyethylene glycol or its analogs is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogs is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the protein synthesis system. Representative PEG is selected from the following group: one of PEG3000, PEG3350, PEG6000, PEG8000 or a combination thereof.

[0116] Further preferably, the polyethylene glycol includes polyethylene glycol with a molecular weight (Da) of 200-10000, such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc., preferably, polyethylene glycol with a molecular weight of 3000-10000.

[0117] In the present invention, the RNA polymerase is not particularly limited and can be selected from one or more RNA polymerases, and a typical RNA polymerase is T7 RNA polymerase.

[0118] An optional scheme is that the in vitro protein synthesis system provided by the present invention includes: cell extract, 4-hydroxyethylpiperazineethanesulfonic acid, potassium acetate, magnesium acetate, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytosine triphosphate (CTP), thymidine triphosphate (TTP), amino acid mixture, creatine phosphate, dithiothreitol (DTT), creatine phosphate kinase, and RNA polymerase.

[0119] In the present invention, the cell extract does not contain intact cells, and a typical cell extract includes ribosomes, aminoacyl-tRNA synthetases, initiation factors and elongation factors required for protein synthesis, and termination release factors for protein translation. In addition, the cell extract also contains some other proteins derived from the cytoplasm of the cell, especially soluble proteins.

[0120] In the present invention, the proportion of the cell extract in the in vitro cell-free protein synthesis system is not particularly limited. Usually, the cell extract accounts for 20-70% of the in vitro cell-free protein synthesis system, preferably 30-60%, and more preferably 40-50%.

[0121] In the present invention, the protein content of the cell extract is 20-100 mg / mL, preferably 50-100 mg / mL. The method for determining the protein content is the Coomassie Brilliant Blue determination method.

[0122] The present invention also provides a vector or vector combination, wherein the vector contains the nucleic acid construct of the present invention. Preferably, the vector is selected from: bacterial plasmid, bacteriophage, yeast plasmid, animal cell vector, shuttle vector; the vector is a transposon vector. Methods for preparing recombinant vectors are well known to those of ordinary skill in the art. As long as they can replicate and be stable in the host, any plasmid and vector can be used.

[0123] Those skilled in the art can use well-known methods to construct expression vectors containing the promoter and / or target gene sequence of the present invention, including in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc.

[0124] Template DNA

[0125] The template DNA is a nucleotide sequence encoding any target protein to be synthesized, which may be an original sequence, an artificially synthesized sequence, or an artificially modified sequence. The template DNA may be used to synthesize the corresponding RNA and / or protein.

[0126] In the present invention, the preparation method of the cell extract is not limited. A preferred preparation method is

[0127] The following steps are involved:

[0128] (i) providing cells;

[0129] (ii) washing the cells to obtain washed cells;

[0130] (iii) disrupting the washed cells to obtain a crude cell extract;

[0131] (iv) subjecting the crude cell extract to solid-liquid separation to obtain a liquid portion, namely the cell extract.

[0132] In the present invention, the solid-liquid separation method is not particularly limited, and a preferred method is centrifugation.

[0133] In a preferred embodiment, the centrifugation is performed in a liquid state.

[0134] In the present invention, the centrifugation conditions are not particularly limited, and a preferred centrifugation condition is 5000-100000 g, preferably 8000-30000 g.

[0135] In the present invention, the centrifugation time is not particularly limited, and a preferred centrifugation time is 0.5 min-2 h, preferably 20 min-50 min.

[0136] In the present invention, the centrifugation temperature is not particularly limited. Preferably, the centrifugation is performed at 1-10°C, more preferably, at 2-6°C.

[0137] In the present invention, the washing treatment method is not particularly limited. A preferred washing treatment method is to use a washing liquid at a pH of 7-8 (preferably 7.4). The washing liquid is not particularly limited. Typically, the washing liquid is selected from the following group: potassium 4-hydroxyethylpiperazineethanesulfonate, potassium acetate, magnesium acetate, or a combination thereof.

[0138] In the present invention, the cell disruption treatment method is not particularly limited. A preferred cell disruption treatment includes high-pressure disruption and freeze-thaw (such as liquid nitrogen cryogenic) disruption.

[0139] The nucleoside triphosphate mixture in the in vitro cell-free protein synthesis system is adenosine triphosphate, guanosine triphosphate, cytosine triphosphate and uridine triphosphate. In the present invention, the concentration of various mononucleotides is not particularly limited, and usually the concentration of each mononucleotide is 0.5-5mM, preferably 1.0-2.0mM.

[0140] The amino acid mixture in the in vitro cell-free protein synthesis system may include natural or non-natural amino acids, and may include D-type or L-type amino acids. Representative amino acids include (but are not limited to) 20 natural amino acids: glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine. The concentration of each amino acid is generally 0.01-0.5 mM, preferably 0.02-0.2 mM, such as 0.05, 0.06, 0.07, 0.08 mM.

[0141] In a preferred embodiment, the in vitro cell-free protein synthesis system further contains polyethylene glycol or its analogs. The concentration of polyethylene glycol or its analogs is not particularly limited. Generally, the concentration (w / v) of polyethylene glycol or its analogs is 0.1-8%, preferably 0.5-4%, more preferably 1-2%, based on the total weight of the biosynthesis system. Representative examples of PEG include (but are not limited to): PEG3000, PEG8000, PEG6000 and PEG3350. It should be understood that the system of the present invention may also include polyethylene glycols of various other molecular weights (such as PEG200, 400, 1500, 2000, 4000, 6000, 8000, 10000, etc.).

[0142] In a preferred embodiment, the in vitro cell-free protein synthesis system further contains sucrose. The concentration of sucrose is not particularly limited, and generally, the concentration of sucrose is 0.03-40wt%, preferably 0.08-10wt%, and more preferably 0.1-5wt%, based on the total weight of the protein synthesis system.

[0143] A particularly preferred in vitro cell-free protein synthesis system contains the following components in addition to yeast cell extract: 22 mM 4-hydroxyethylpiperazineethanesulfonic acid at pH 7.4, 30-150 mM potassium acetate, 1.0-5.0 mM magnesium acetate, 1.5-4 mM nucleoside triphosphate mixture, 0.08-0.24 mM amino acid mixture, 25 mM creatine phosphate, 1.7 mM dithiothreitol, 0.27 mg / mL creatine phosphate kinase, 1%-4% polyethylene glycol, 0.5%-2% sucrose, and 0.027-0.054 mg / mL T7 RNA polymerase.

[0144] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention.

[0145] It is not intended to limit the scope of the present invention. The experimental methods of the following examples without specifying specific conditions are usually according to conventional conditions, such as Sam Brook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts. The present invention is an embodiment with Kluyveromyces lactis (Kluyveromyces lactis, abbreviated as K. lactis or kl), but the same design and analysis, experimental methods are also applicable to eukaryotic cells such as other yeasts, animal cells, and prokaryotic cells.

[0146] The present invention uses Kluyveromyces lactis (K. lactis) as an example, but the same design, analysis and experimental methods are also applicable to other yeasts and other lower eukaryotic cells and higher animal cells. The gene modification method in the present invention is CRISPR-Cas9 technology, but it is not limited thereto, and can be any known and existing gene modification method.

[0147] The in vitro protein synthesis reaction mixture system, also described as an in vitro protein synthesis reaction mixture, a reaction mixture system, or a reaction mixture, refers to a mixed system including an in vitro protein synthesis system and a nucleic acid template encoding a target protein; it may be homogeneous or heterogeneous, and may be a liquid system such as a solution, an emulsion, or a suspension.

[0148] Protein of the present invention The final concentrations of the components in Factory are: 80% (v / v) Kluyveromyces lactis extract, 15 mM glucose, 320 mM maltodextrin (measured in molar concentration of glucose monomers), 24 mM tripotassium phosphate, 1.8 mM nucleoside triphosphate mixture (a mixture of adenosine triphosphate, guanosine triphosphate, cytosine triphosphate and uridine triphosphate, with the final concentration of each nucleoside triphosphate being 1.8 mM), 0.7 mM amino acid mixture (glycine, alanine, valine, leucine, isoleucine, phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine and histidine, with the final concentration of each amino acid being 0.7 mM), magnesium L-aspartate, 80 mM potassium acetate, 2% (w / v) polyethylene glycol 8000, 9.78 mM pH 8.0 Tris·HCl buffer, 6% (w / v) trehalose. Wherein, the lactic acid Kluyveromyces extract includes endogenously expressed T7 RNA polymerase. The lactic acid Kluyveromyces extract is modified in the following manner: using a modified strain based on the lactic acid Kluyveromyces strain ATCC8585; using the method described in CN109423496A, the coding gene of T7 RNA polymerase is integrated into the genome of lactic acid Kluyveromyces to obtain a modified strain so that it can endogenously express T7 RNA polymerase; using the modified strain to culture cell raw materials, and then preparing cell extracts. The preparation process of lactic acid Kluyveromyces cell extract adopts conventional technical means, and is prepared with reference to the method described in CN109593656A. In summary, the preparation steps include: providing an appropriate amount of raw materials of lactic acid Kluyveromyces cells that have been fermented and cultured, quick-freezing the cells with liquid nitrogen, breaking the cells, and collecting the supernatant by centrifugation to obtain a cell extract. The protein concentration in the obtained lactic acid Kluyveromyces cell extract is 20 to 40 mg / mL. In the following examples, the (i.e., prock, N-E-propargyloxycarbonyl-L-lysine hydrochloride) is a representative of non-natural amino acids (abbreviated as NCAA), but the NCAA of the present invention is not limited to only prock.

[0149] Preferably, the present invention provides a tDNA Pyl The method for mutant screening is as follows:

[0150] (1) tDNA UCU Arg -tDNA TAG Pyl (3002) structure based (see Figure 1 ), designed 5 different tDNA TAG PylThe insert fragments of the sequences (1 wild type and 4 mutants) were respectively inserted into the following two sites in the genome of Kluyveromyces lactis (a total of 10 structures). It should be noted that in this example, only tDNA UCU Arg It is a representative of a promoter, but not a limitation of the promoter described in the present invention.

[0151] (2) Designing a CRISPR / Cas9-based sgRNA action site for the UPF1 gene, the nucleotide sequence of the sgRNA action site is:

[0152] UPF1:5'-CATTGCATAACTTGGTCAGC-3' (SEQ ID No: 1);

[0153] The insertion position was selected in the middle of the UPF1 gene. Primers 1 and 2 were designed near the insertion position for PCR amplification of the left homology arm; primers 3 and 4 were used for PCR amplification of the right homology arm. The primer sequences are as follows:

[0154] Primer 1:

[0155] 5'-CTGTTTCTTTGAGAGACGATGAC-3'(SEQ ID No: 2)

[0156] Primer 2:

[0157] 5'-CAACAGTTCGGCTTCTAGTGATGAGGAACGCCACATCTTCTCTA

[0158] CTTTTAGCAG-3' (SEQ ID No: 3)

[0159] Primer 3:

[0160] 5'-CCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGAGAGCTCAGTGTCC

[0161] GAGTTA-3' (SEQ ID No: 4)

[0162] Primer 4: 5'-CTTTGAGCCCACTCCATTG-3' (SEQ ID No: 5)

[0163] (3) Using the 3002 structure-positive strain as a template and primers 5 and 6 as primers, PCR amplified the insert fragment with partial homology arm sequences;

[0164] The primer sequences are as follows:

[0165] Primer 5:

[0166] 5'-AGTACGATTAACTGCTAAAAGTAGAGAAGATGTGGCGTTCCTC

[0167] ATCACTAGAAGC-3'(SEQ ID No: 6)

[0168] Primer 6:

[0169] 5'-TGACCAAGTTATGCAATGCTAACTCGGACACTGAGCTTCTTCGA

[0170] GCGTCCCAAAAC-3' (SEQ ID No: 7)

[0171] (4) Designing a CRISPR / Cas9-based sgRNA action site for the endogenous tRNA gene, the nucleotide sequence of the sgRNA action site is:

[0172] Endogenous tRNA gene: 5'-AGATGAGAAGAGACTGCGAG-3' (SEQ ID No: 8);

[0173] Primers 7 and 8 were designed at about 1000 bp to the left of the insertion position for PCR amplification of the left homology arm; primers 9 and 10 were designed at about 1000 bp to the right of the insertion position for PCR amplification of the right homology arm. The primer sequences are as follows:

[0174] Primer 7:

[0175] 5'-GTCAGTTTCATTAGCCTCA-3' (SEQ ID No: 9)

[0176] Primer 8:

[0177] 5'-CTCCGTCAAAGTTCCTGATTCAGTCTCTTCTCATCTCCACTAG-3'(SEQ ID No: 10)

[0178] Primer 9:

[0179] 5'-GTAGCAGGTACAGGAGAAAGAGTAAATAATGCGAGCGGAATTT

[0180] GAGC-3' (SEQ ID No: 11)

[0181] Primer 10:

[0182] 5'-GCCTGTCAAGTTATAACCAG-3'(SEQ ID No: 12)

[0183] (5) Using the 3002 structure-positive strain as a template and primers 11 and 12 as primers, PCR amplified the target fragment; the primer sequences are as follows:

[0184] Primer 11:

[0185] 5'-GAGATTACTAGTGGAGATGAGAAGAGACTGAATCAGGAACTTTGACGG

[0186] AG-3' (SEQ ID No: 13)

[0187] Primer 12:

[0188] 5'-CCAGCTCAAATTCCGCTCGCATTATTTACTCTTTCTCCTGTACCTGC-3' (SEQ ID No: 14)

[0189] (5) The left and right homology arm PCR products obtained in step (2) and the insert fragment PCR product obtained in step (3) were connected by overlap PCR. TAG Pyl A total of 5 gene editing vectors were obtained by sequencing.

[0190] (6) The left and right homology arm PCR products obtained in step (4) and the insert fragment PCR product obtained in step (5) were connected by overlap PCR. TAG Pyl A total of 5 gene editing vectors were obtained by sequencing.

[0191] (7) A total of 10 gene editing vectors obtained in step (6) and step (7) are transformed into lactic acid Kluyveromyces strains respectively.

[0192] (8) The IVTT technology was used to translate the GFP-TAG-RFP structure in large quantities. The expression level of RFP was used to reflect the read-through rate of the termination codon TAG, and the control group without the addition of non-natural amino acids was used to reflect the fidelity of the amber codon tRNA in transporting amino acids.

[0193] Example 1: Construction of gene editing vector (transformation 4)

[0194] We commissioned Qingke Biotechnology Co., Ltd. to synthesize Escherichia coli containing a tRNA sequence plasmid (order number: SH0052101), the sequence number is: SEQ ID No: 15.

[0195] (2) Design primers to amplify the left and right homology arms after the endogenous tRNA gene is inserted into the target gene. When designing the primers, ensure that there are about 40bp of repeated sequences between different fragments. Finally, use the connection primers for overlap PCR connection. The connection primers are:

[0196] Primer 13: CATTACATCCAGACTCAGAGCTAGGAGATACTACTTTGGAATGC (SEQ ID No: 16)

[0197] Primer 14: AGTCTCTCTGACCAGCATATTGTGTATAACTACTGTTGTTGG (SEQ ID No: 17)

[0198] (3) The PCR products of the left and right homology arms and the insert fragment were used as templates for overlap PCR amplification. The PCR amplification reaction system was: 3 μL of PCR product mixture; 0.5 μL of primer 13; 0.5 μL of primer 14; 10 μL of 2xMix; 6 μL of ddH2O. The PCR amplification reaction program was: 95°C for 3 min; 95°C for 30 s, 60°C for 1 min, 72°C for 3 min, 35 cycles; 72°C for 5 min; 20°C for 1 min.

[0199] After the Overlap PCR is completed, the size of the connected fragments is observed by electrophoresis, and the PCR products with the correct size are selected and sequenced by Qingke Biotechnology Co., Ltd. (sequencing results are shown in Figure 2 ), after sequencing comparison, if the sequence is correct, it can be used as a gene editing vector.

[0200] Example 2: Preparation of Kluyveromyces lactis competent cells

[0201] (1) Take out the glycerol culture of Kluyveromyces lactis strain stored in a -80°C refrigerator and place it on ice. After thawing, streak it on a YPD plate and then culture it at 30°C until obvious colonies grow.

[0202] (2) Pick a single colony from the plate and inoculate it into 100 ml of liquid YPD in a 250 ml conical flask. Culture at 30°C and 200 rpm for 18 h.

[0203] (3) Transfer the culture medium to a 50 ml centrifuge tube, with a maximum of 40 ml per tube. Centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant, add 1 M sorbitol in an amount equal to the supernatant volume, gently pipette to mix, centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant, repeat 2-3 times, add 3-5 ml 1 M sorbitol, gently pipette to mix, and dispense 100 ul / tube into small centrifuge tubes. Quickly transfer to a -80°C refrigerator for storage.

[0204] Example 3: Gene editing vectors transferred into competent Kluyveromyces lactis strains

[0205] (1) Prepare experimental materials such as sgRNA, gene editing vectors, and competent cells in advance, and dissolve them on ice for later use.

[0206] (2) Add about 2 ng of gene editing vector and about 0.2 ng of sgRNA to the competent cells, mix gently by pipetting, and transfer to the electroporation cup.

[0207] (3) Adjust the parameters of the electroporator to a voltage of 2KV, place the cells in the electroporation cup prepared in step (2) and perform an electric shock treatment. Then, add about 700ul of YPD culture medium to the electroporation cup, gently pipette and mix, then transfer to a centrifuge tube and culture at 200rpm and 30℃ for about 30min.

[0208] (4) After the shaking culture is completed, evenly spread the liquid in the centrifuge tube on the YPD agarose plate and culture it overnight at 30°C.

[0209] Example 4: Identification of gene-edited Kluyveromyces lactis strains

[0210] The tRNA gene contained in the gene editing vector can transcribe a special tRNA for recognizing the termination codon TAG, which does not exist in the wild-type lactic acid Kluyveromyces strain. Therefore, two specific primers were designed on the gene sequence, and two primers were designed on the nearby lactic acid Kluyveromyces genome. The four primers formed two pairs. The primer sequences are as follows:

[0211] Primer15: GACAAATAGTAGCTCGCGTG (SEQ ID No: 18)

[0212] Primer16: TTCTGATTAGAAGTCAGACGCG (SEQ ID No: 19)

[0213] Primer17: TCCAATGATCTCCCACAGG (SEQ ID No: 20)

[0214] Primer18: TGATGATCAAGAACCACTCG (SEQ ID No: 21)

[0215] The reaction system is: 1 μL of nucleic acid of monoclonal strain, 0.5 μL of Primer 15, 0.5 μL of Primer 17, 10 μL of 2xMix, and 8 μL of ddH2O. And 1 μL of nucleic acid of monoclonal strain, 0.5 μL of Primer 16, 0.5 μL of Primer 18, 10 μL of 2xMix, and 8 μL of ddH2O.

[0216] The response program was: 95°C for 3 min; 95°C for 30 s, 57°C for 1 min, 72°C for 3 min, 35 cycles; 72°C for 5 min; 20°C for 1 min.

[0217] Pick the monoclonal strain on the transformation plate, extract the nucleic acid and use the above two pairs of primers to perform PCR amplification. The PCR product is electrophoresed on 1.5% agarose gel. The positive strain can obtain bands using both pairs of primers, while the negative strain has no bands.

[0218] The monoclonal strains initially identified as positive after identification were stored, and their nucleic acids were amplified by PCR using primers designed on two genomes. The resulting PCR products were entrusted to Qingke Biotech Co., Ltd. for sequencing. The primers are as follows:

[0219] Primer19:GTCCGCTTCTTACAATGGATACAGTTTCTCGC (SEQ ID No: 22)

[0220] Primer20:CTTTGTTGAACATCATCCCGGTGAGAATGCC (SEQ ID No: 23)

[0221] Sequencing primer: TGACTCTGACTCATTTCTTGCG (SEQ ID No: 24)

[0222] The reaction system was: 1 μL of monoclonal strain nucleic acid; 0.5 μL of primer 5; 0.5 μL of primer 6; 10 μL of 2xMix; and 8 μL of ddH2O.

[0223] The response program was: 95°C for 3 min; 95°C for 30 s, 65°C for 1 min, 72°C for 3 min, 35 cycles; 72°C for 5 min; 20°C for 1 min.

[0224] The sequencing result, that is, the inserted sequence (SEQ ID No: 25), was compared with the theoretical sequence (see Figure 3 ), and if the inserted sequences of the two are consistent after comparison, the tested strain is determined to be a positive strain that has successfully undergone gene editing.

[0225] Example 5: According to a similar operation method, the strains of transformation 1 to transformation 3 and transformation 5 to transformation 10 were obtained respectively (the insertion sequences of transformation 1 to transformation 3 and transformation 5 are SEQ ID Nos: 26 to 29 respectively, and the insertion sequences corresponding to transformation 6 to transformation 10 are the same as those of transformation 1 to transformation 5, and the only difference is that the insertion sites of transformation 1 to transformation 5 and transformation 6 to transformation 10 are different)

[0226] Example 6: Lysate Preparation

[0227] The strain to be tested, which was frozen in a -80°C refrigerator, was streaked on a YPD plate, and a single colony was picked and inoculated into a 250mL Erlenmeyer flask containing 100mL of seed culture medium, and cultured in a 30°C shaker at 200rpm for 24h; the seed liquid was transferred to a 1000mL Erlenmeyer flask containing 400mL of fermentation culture medium, and cultured in a 30°C shaker at 200rpm until the harvest period, the cells were collected by high-speed centrifugation, and the cell lysate was prepared under liquid nitrogen protection.

[0228] Example 7: Verification of the expression efficiency of in vitro synthesis of target proteins with introduction of unnatural amino acids

[0229] (1) Configure Protein Factory

[0230] (2) The following cell-free in vitro translation conditions were used:

[0231] Protein Factory 100μl

[0232] Prock (unnatural amino acid) 500mM 1μl

[0233] GFP-TAG-RFP dual fluorescence reporter gene PCR product 3 μl

[0234] Mapylrs final concentration 5 μM

[0235] Ex485nm / Em535 was used to detect the fluorescence intensity of EGFP, and Ex535nm / Em595nm was used to detect the fluorescence intensity of RFP. The efficiency of the introduction of unnatural amino acids was determined based on the ratio of RFP / GFP and the fluorescence intensity of RFP (see Figure 4-7 ).

[0236] Depend on Figure 4-5 It can be seen that all the modified strains can express normally and show strong RFP fluorescence values, indicating that the modified strains have successfully achieved the purpose of introducing non-natural amino acids into proteins and have high activity, especially the modified strain 1 ( Figure 4 wt) has a high read-through rate. Figure 6-7It can be seen that the modified strains have good fidelity in the process of introducing non-natural amino acids. In particular, the strain 1 ( Figure 6 It can be seen that the strain obtained by genetic modification of the present invention has a high read-through rate and fidelity for in vitro expression of non-natural amino acids, has good activity, and has a high reference value for the expanded application of the field of in vitro introduction of non-natural amino acids.

[0237] The sequences used in the present invention are shown in Table 1 below

[0238] Table 1

[0239]

[0240]

[0241] Based on the above ideal embodiments of this application, the relevant staff can make various changes and modifications without departing from the technical concept of this application through the above description. The technical scope of this application is not limited to the content in the specification, and its technical scope must be determined according to the scope of the claims.

Claims

1. A nucleic acid construct, characterized in that: The structural formula of the nucleic acid construct is (I): Z1-Z2-Z3, In the formula, Z1-Z3 are elements used to constitute the structure respectively; Each "-" is independently a bond or a nucleotide linking sequence; Z1 is the promoter sequence; Z2 is none or a connection sequence; Z3 is the gene sequence of inhibitory tRNA.

2. The nucleic acid construct according to claim 1, characterized in that: in, The promoter is selected from tDNA, SNR52, SNR6, Pol III, U6, U3, SCR1, RPR1 or H1.

3. The nucleic acid construct according to any one of claims 1 to 3, characterized in that: The inhibitory tRNA is selected from amber codon tRNA, ochre codon tRNA or opal codon tRNA; preferably amber codon tRNA; further preferably tRNA TAG Pyl .

4. The nucleic acid construct according to any one of claims 2 to 4, wherein the structure of formula (I) is selected from Z1-Z2-tDNA TAG Pyl , the tDNA TAG Pyl Select from wild type or mutant.

5. The nucleic acid construct according to any one of claims 2 to 5, wherein the structure of formula (I) is selected from tDNA-Z2-tDNA TAG Pyl .

6. The nucleic acid construct according to any one of claims 2 to 6, wherein Z2 is selected from a linker sequence, and the linker sequence is selected from CTTTGTTTCT.

7. The nucleic acid construct according to any one of claims 1 to 6, characterized in that The Z3 is a single copy or multiple copy gene sequence of an inhibitory tRNA, and preferably, the number of the multiple copies is less than or equal to 6.

8. A genetically engineered strain, characterized in that: A nucleic acid construct containing at least one inhibitory tRNA gene sequence is integrated into the genome of the strain.

9. The genetically engineered strain according to claim 8, characterized in that: The nucleic acid construct is the nucleic acid construct according to any one of claims 1 to 7.

10. A genetically engineered strain according to claim 8 or 9, characterized in that: The strain is derived from bacteria, mammalian cells, human cells, plant cells, yeast cells, insect cells or any combination thereof.

11. A genetically engineered strain according to any one of claims 8 to 10, characterized in that: The yeast cell is selected from Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia minuta, Ogataeaminuta, Pichia lindneri, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia guercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp.), Saccharomyces cerevisiae, Saccharomyces cerevisiae, Saccharomyces cerevisiae, Saccharomyces molasses, Saccharomyces sp., Hansenula polymorpha, Candida utilis, Kluyveromyces, or a combination thereof.

12. The genetically engineered strain according to any one of claims 8 to 11, characterized in that: The nucleic acid construct is integrated into the genome of the strain via an insertion site, wherein the insertion site is UPF1 or endogenous tDNA.

13. A method for preparing a genetically engineered strain according to any one of claims 8 to 12, characterized in that: The nucleic acid construct is inserted into the genome of the strain via the UPF1 site.

14. A method for preparing a genetically engineered strain according to any one of claims 8 to 12, characterized in that: The nucleic acid construct is inserted into the genome of the strain via 1 to 1000 bp from the 5' end and / or 3' end of the endogenous tDNA sequence; preferably 100 to 800 bp; more preferably 200 to 500 bp.

15. A method for synthesizing a protein incorporating an unnatural amino acid, characterized in that: The inhibitory tRNA is provided by using the genetically engineered strain described in any one of claims 8 to 12.

16. A cell-free synthesis system for synthesizing proteins incorporating unnatural amino acids, characterized in that: The system at least comprises a cell extract, and the cell extract is derived from the genetically engineered strain according to any one of claims 8 to 12.

17. The cell-free synthesis system according to claim 16, characterized in that: The system also includes an aminoacyl tRNA synthetase and an unnatural amino acid.

18. Use of the genetically engineered strain according to claims 8 to 12 or the cell-free synthesis system according to claim 16 or 17 in the cell-free synthesis of proteins incorporating unnatural amino acids.

19. A kit, characterized in that: The kit comprises the components of the cell-free protein synthesis system according to claim 16 or 17.

20. A method for cell-free synthesis of proteins incorporating unnatural amino acids, characterized in that: The method comprises the following steps: step (1), providing the cell-free protein synthesis system according to claim 16 or 17 or the kit according to claim 19; step (2), adding a DNA molecule encoding an exogenous protein to the synthesis system or the kit according to step (1), and obtaining the protein by reaction in the presence of aminoacyl tRNA synthetase and non-natural amino acids.

Images