Application of opr-7s protein and its coding gene in regulating resistance to lodging of wheat

Abstract

The application discloses application of OPR-7S protein and an encoding gene thereof in regulation of lodging resistance of wheat. The application firstly constructs OPR-7S super-expression trans-OPR-7S wheat, and then analyzes the lodging resistance and yield-related traits of the trans-OPR-7S wheat and wild-type tetraploid wheat Kronos, finds that OPR-7S can regulate the lodging resistance of the wheat and does not affect the yield-related traits. Further detection of the content of coumaric acid and ferulic acid in the trans-OPR-7S wheat and the wild-type tetraploid wheat Kronos finds that OPR-7S can improve the lodging resistance of the wheat by regulating the content of the coumaric acid and the ferulic acid in the cell wall of the wheat. The OPR-7S protein and related biological materials will play an important role in cultivation of lodging-resistant wheat varieties.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to application of OPR-7S protein and its coding gene in regulating lodging resistance of wheat. BACKGROUND

[0002] Wheat yield is limited by various biological and non-biological factors, biological factors mainly include various diseases, pests and hazards of other species, and non-biological factors mainly include drought, flood, high temperature, low temperature, high salt, strong wind and the like. Various biological and non-biological stresses can cause wheat yield reduction or even absolute yield reduction.

[0003] Compared with other factors, diseases, pests, drought, flood, high and low temperature are usually sporadic stresses, and lodging caused by strong wind in a short time has a higher probability. Lodging of crops usually has three modes, the first mode is stem bending, which is common in rice and is usually caused by excessive weight of ears, which cannot be borne by stems; the second mode is lodging caused by stem breaking, which is usually caused by heavy rain or strong wind and the like; and the third mode is lodging caused by shallow root system. Among them, the second and third modes are common in wheat. After wheat lodging, the spatial distribution of leaves is disturbed, so that the leaves cannot obtain sufficient light, which causes a large decrease in photosynthetic rate; secondly, stem breaking seriously affects water absorption of root system and also affects transportation of photosynthetic products to grains, which has an influence on grain filling, thereby causing yield reduction; meanwhile, lodging easily causes ear germination, and metabolic activities of germinated grains consume nutrients stored in seeds, which causes poor practicality and storage quality of the grains; in addition, lodging plants have a high water content, which promotes growth of fungi, and has a serious influence on appearance and quality of grains.

[0004] The current semi-dwarf trait has certain limitations as a lodging resistance strategy. The semi-dwarf variety causes a decrease in leaf photosynthetic efficiency due to a decrease in plant height, thereby causing a decrease in biomass and yield. Therefore, improving lodging resistance of crops without decreasing plant height is an important basis for further improving yield in the future. SUMMARY

[0005] The technical problem to be solved by the application is how to regulate lodging resistance of wheat.

[0006] In order to solve the above technical problem, the application first provides a new use of OPR-7S protein or related biological materials thereof.

[0007] The application provides application of OPR-7S protein or related biological materials thereof in any one of the following 1) to 4):

[0008] 1) regulating lodging resistance of wheat;

[0009] 2) regulating content of bound phenolic acid compounds in cell walls of wheat;

[0010] 3) breeding transgenic wheat with improved resistance to lodging;

[0011] 4) wheat breeding;

[0012] The OPR-7S protein is a protein as described in any one of (a1)-(a4) below:

[0013] (a1) the protein as shown in SEQ ID NO: 2 in the sequence listing;

[0014] (a2) a fusion protein obtained by linking a tag to the N terminus or / and C terminus of the protein as described in (a1);

[0015] (a3) a protein related to the resistance to lodging and / or yield of wheat obtained by substitution and / or deletion and / or addition of one or several amino acid residues of (a1);

[0016] (a4) a protein having 98% or more identity with (a1) and being related to the resistance to lodging and / or yield of wheat.

[0017] In the protein as described in (a2) above, the tag refers to a polypeptide or protein fused and expressed with the protein of interest by using DNA in vitro recombination technology, so as to facilitate the expression, detection, tracing and / or purification of the protein of interest. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0018] In the protein as described in (a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues or no more than 9 amino acid residues or no more than 8 amino acid residues or no more than 7 amino acid residues or no more than 6 amino acid residues or no more than 5 amino acid residues or no more than 4 amino acid residues or no more than 3 amino acid residues or no more than 2 amino acid residues or no more than 1 amino acid residue.

[0019] The identity in the protein of (a4) above refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page of the NCBI homepage. For example, the identity (%) of a pair of amino acid sequences can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, and performing a search in the Advanced BLAST 2.1.

[0020] The related biological material is a nucleic acid molecule encoding the OPR-7S protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

[0021] Further, the nucleic acid molecule encoding the OPR-7S protein is any one of the following (Al) or (A2):

[0022] (A1) a DNA molecule represented by SEQ ID NO: 1 in the Sequence Listing;

[0023] (A2) a DNA molecule having 75% or more identity to (Al) and encoding the OPR-7S protein.

[0024] Those artificially modified nucleotides having 75% or more identity to the OPR-7S nucleotide sequence isolated from the present application, as long as they encode the OPR-7S protein and have the same function, are derived from the nucleotide sequence of the present application and are equivalent to the sequence of the present application.

[0025] The term "identity" used herein refers to the sequence similarity to the natural nucleic acid sequence. The "identity" includes a nucleotide sequence having 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the protein consisting of the amino acid sequence represented by SEQ ID NO: 2 of the present application. The identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%) which can be used to evaluate the identity between related sequences.

[0026] The expression cassette refers to DNA capable of expressing OPR-7S protein in a host cell, which can include not only a promoter to initiate OPR-7S transcription, but also a terminator to terminate OPR-7S transcription. Further, the expression cassette can also include an enhancer sequence.

[0027] The vector can be a plasmid, cosmid, bacteriophage or viral vector. The recombinant vector can be a vector containing the above-mentioned nucleic acid molecule or the above-mentioned expression cassette constructed using an existing plant expression vector. The plant expression vector includes Agrobacterium binary vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb, etc. The plant expression vector can also contain the 3' untranslated region of the foreign gene, that is, it contains a polyadenyl signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenyl signal can guide the addition of polyadenyl to the 3' end of the mRNA precursor, such as the 3' untranslated region of the Agrobacterium crown gall tumor-inducing (Ti) plasmid gene (such as the nos gene) or the 3' end of the plant gene (such as the soybean storage protein gene). When using the gene of the present application to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers, which can be ATG start codon or adjacent regions start codon, but must be in the same reading frame as the coding sequence to ensure correct translation of the entire sequence. The source of the translation control signal and the start codon is wide, which can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants to produce color-changing enzymes or luminescent compounds (GUS gene, luciferase gene, etc.), marker genes of antibiotics (such as nptII gene conferring resistance to kanamycin and related antibiotics, bar gene conferring resistance to herbicide phosphine, hph gene conferring resistance to antibiotic hygromycin, and dhfr gene conferring resistance to methotrexate, EPSPS gene conferring resistance to glyphosate), or chemical reagent resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase genes that provide the ability to metabolize mannose. For the safety of transgenic plants, no selective marker gene can be added, and the transformed plants can be directly screened under stress conditions.

[0028] The microorganism can be yeast, bacteria, algae or fungi; the bacteria can be Agrobacterium (such as Agrobacterium EHA105). The recombinant microorganism is a microorganism containing the above-mentioned expression cassette or the above-mentioned recombinant vector.

[0029] In the application, the regulating the lodging resistance of the wheat is improving the lodging resistance of the wheat.

[0030] The regulating the content of the bound phenolic acid compound in the cell wall of the wheat is improving the content of the bound phenolic acid compound in the cell wall of the wheat.

[0031] The lodging resistance is the stem breaking force of the second node of the above-ground part.

[0032] The bound phenolic acid compound is p-coumaric acid and / or ferulic acid.

[0033] The improving the lodging resistance of the wheat and the improving the content of the bound phenolic acid compound in the cell wall of the wheat are specifically embodied as: when the content of the OPR-7S protein or the expression amount of the OPR-7S gene in the wheat is improved, the lodging resistance of the wheat is improved, and the content of the bound phenolic acid compound in the cell wall is improved. It is further embodied as: when the content of the OPR-7S protein or the expression amount of the OPR-7S gene in the wheat is improved, the stem breaking force of the second node of the above-ground part of the wheat is improved, and the content of the p-coumaric acid and / or ferulic acid in the cell wall is improved.

[0034] In the application, the purpose of the wheat breeding is to cultivate a lodging-resistant wheat variety.

[0035] In order to solve the above technical problems, the application further provides a breeding method of a transgenic wheat with improved lodging resistance.

[0036] The breeding method of the transgenic wheat with improved lodging resistance provided by the application comprises the steps of improving the activity and / or content of the OPR-7S protein in a receptor wheat to obtain a transgenic wheat; and the lodging resistance of the transgenic wheat is higher than that of the receptor wheat.

[0037] Further, the lodging resistance of the transgenic wheat is higher than that of the receptor wheat, which is embodied as that the stem breaking force of the second node of the above-ground part of the transgenic wheat is higher than that of the receptor wheat.

[0038] Still further, the method for improving the activity and / or content of the OPR-7S protein in the receptor wheat is overexpressing the OPR-7S protein in the receptor wheat.

[0039] The method for overexpressing is introducing the coding gene of the OPR-7S protein into the receptor wheat.

[0040] The nucleotide sequence of the coding gene of the OPR-7S protein is shown in SEQ ID NO. 1.

[0041] In one embodiment of the present application, the gene encoding the OPR-7S protein is introduced into the recipient wheat by the recombinant vector pGWB18-Ubi::OPR-7S. The recombinant vector pGWB18-Ubi::OPR-7S is a vector obtained by recombining the OPR-7S gene shown in SEQ ID NO: 1 between attR1 (AAACAAGTTTGTACAAAAAA) and attR2 (TTTCTTGTACAAAGTGG) of the pGWB18 vector.

[0042] In any of the above-mentioned uses or methods, the transgenic plant includes not only the first generation transgenic plant obtained by transforming the OPR-7S gene into the target plant, but also its offspring. For the transgenic plant, the gene can be propagated in the species, or transferred into other varieties of the same species using conventional breeding techniques, particularly including commercial varieties. The transgenic plant includes seeds, calli, whole plants, and cells.

[0043] In any of the above-mentioned uses or methods, the wheat can be specifically wild-type tetraploid wheat (Kronos).

[0044] The present application first constructs OPR-7S overexpression transgenic OPR-7S wheat, and then analyzes the resistance to lodging, thousand kernel weight, plant height, ear length, and stem diameter of the transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos, and finds that OPR-7S can regulate the resistance to lodging of wheat without affecting yield-related traits such as yield, plant height, ear length, and stem diameter. Further detection of the contents of bound phenolic acid compounds p-coumaric acid and ferulic acid in the transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos finds that OPR-7S can improve the resistance to lodging of wheat by regulating the contents of bound phenolic acid compounds p-coumaric acid and ferulic acid in the cell wall of wheat. The OPR-7S protein and related biological materials will play an important role in cultivating lodging-resistant wheat varieties. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 For the detection of the resistance to lodging and yield-related traits of the transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. A is the stem fracture force detection result of the transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. B is the PCR identification of the transgenic material. C is the plant height statistical result of the transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. D is the ear length statistical result of the transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. E is the thousand kernel weight statistical result of the transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos. F is the stem diameter statistical result of the transgenic OPR-7S wheat and wild-type tetraploid wheat Kronos.

[0046] Figure 2 The relative content of the bound phenolic acid compounds coumaric acid and ferulic acid in the cell walls of the trans OPR-7S wheat and wild-type tetraploid wheat Kronos was detected. A is the relative content of the bound phenolic acid compounds coumaric acid in the cell walls of the trans OPR-7S wheat and wild-type tetraploid wheat Kronos. B is the relative content of the bound phenolic acid compounds ferulic acid in the cell walls of the trans OPR-7S wheat and wild-type tetraploid wheat Kronos. The p value in the figure represents the significant level. DETAILED DESCRIPTION

[0047] The application will be further described in conjunction with the specific embodiments. The examples given are only to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not in any way constitute a limitation on the application.

[0048] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0049] The wild-type tetraploid wheat (Kronos) in the following examples is described in the literature “Krasileva, K. V., et al. (2017). Uncovering hidden variation in polyploid wheat. Proceedings of the National Academy of Sciences 114 (6): E913-E921.”

[0050] The amino acid sequence of the OPR-7S protein in Example 1 below is shown as SEQ ID NO: 2 in the sequence listing, and the coding gene sequence is shown as SEQ ID NO: 1 in the sequence listing.

[0051] Example 1, obtaining of trans OPR-7S wheat and analysis of its stem breaking force, yield-related traits, and bound phenolic acid compound content in cell walls

[0052] I. Obtaining of trans OPR-7S wheat

[0053] 1. Construction of recombinant vector pGWB18-Ubi::OPR-7S

[0054] The OPR-7S gene shown in SEQ ID NO: 1 was connected into the pDONR207 vector (invitrogen, CAT#: 12535035) by using the Gateway method to obtain the recombinant vector pDONR207-OPR-7S, and sequencing verification was performed. Sequencing showed that the OPR-7S gene did not have any point mutations.

[0055] The recombinant vector pDONR207-HSP90.2-7B, the pGWB18 vector (NCBI: txid419562), and the recombinase (ThermoFisher Scientific, Cat. No. 11789100) were mixed and reacted at 22°C overnight to recombine the OPR-7S gene shown in SEQ ID NO: 1 between attR1 (AAACAAGTTTGTACAAAAAA) and attR2 (TTTCTTGTACAAAGTGG) of the pGWB18 vector to obtain the recombinant vector pGWB18-Ubi::OPR-7S. The recombinant vector pGWB18-Ubi::OPR-7S expresses the OPR-7S protein.

[0056] 2. Obtaining of the recombinant bacteria

[0057] The recombinant vector pGWB18-Ubi::OPR-7S was transformed into Agrobacterium EHA105 (Weidi Biology, CAT#: AC1010) to obtain the recombinant bacteria pGWB18-Ubi::OPR-7S / EHA105.

[0058] 3. Obtaining of the OPR-7S wheat

[0059] Wild-type tetraploid wheat Kronos in good growth state was selected as the receptor, genetic transformation was performed by the method of embryo stripping, and the Agrobacterium pGWB18-Ubi::OPR-7S / EHA105 was used for infection and differentiation, and then screening was performed to obtain the OPR-7S wheat strain.

[0060] 4. PCR identification

[0061] The wild-type tetraploid wheat Kronos and the OPR-7S wheat strain were identified, and the identification results are shown in Table 1. Figure 1B, the OPR-7S wheat lines OPR-7S O.E.3 and (OPR-7S O.E.5 were selected for subsequent study experiments. The specific identification steps are as follows: fresh wheat leaves are cut into 2 mL thick-walled centrifuge tubes, 800 μL of DNA extraction solution (0.2 M Tris-HCl (pH 7.5), 0.25 M NaCl, 0.5% SDS, 25 mM EDTA) and steel balls are added, a high-throughput tissue grinder is used for grinding, 60 Hz for 5 min, the sample is placed in a 65 °C oven for 60 min, and the sample is inverted several times during the period, until the bubbles are completely eliminated; after taking out, cool to room temperature, after taking out, cool to room temperature, centrifuge at 12000 rpm at room temperature for 15 min; 600 μL of supernatant is aspirated, an equal volume of isopropanol is added, mixed, and then placed at -20 °C; centrifuge at 12000 rpm, 4 °C for 10 min, discard the supernatant, resuspend the precipitate with 1 mL of 75% ethanol, centrifuge at 8000 rpm, 4 °C for 5 min, discard the supernatant, blow dry in a clean bench, add 100 μL of ddH2O, and store at -20 °C. Then use primers OPR-CDS-F and OPR-CDS-R for PCR amplification detection. The primer sequences are as follows:

[0062] OPR-CDS-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTCTACTCCAAGCCT;

[0063] OPR-CDS-R: GGGGACCACTTTGTACAAGAAAGCTGGGTTCTCGGCATTCGAGCCACC.

[0064] II. Stem breaking force detection of OPR-7S wheat

[0065] Test materials: wild-type tetraploid wheat Kronos, T2 generation OPR-7S wheat lines OPR-7S O.E.3 and OPR-7S O.E.5.

[0066] In November 2020, the test materials were sown in the greenhouse of Fudan University, with a plant spacing of 4-5 cm and a row spacing of 20 cm. After harvesting the seeds, the second stem was taken for stem breaking force measurement. The measurement site was the middle position of the second node of the aboveground part of the plant, the anti-lodging detector determined the site in the air and aligned with the stem measurement site, and the plant was pushed and pulled by 60°, and the instrument reading was the stem tensile force, i.e. the stem breaking force.

[0067] The results are as follows: Figure 1As shown in A, the results show that the average stem breaking force of wild type tetraploid wheat Kronos is 6.98, the average stem breaking force of T2 generation OPR-7S wheat line OPR-7S O.E.3 is 8.50, and the average stem breaking force of T2 generation OPR-7S wheat line OPR-7S O.E.5 is 7.50. Compared with wild type tetraploid wheat Kronos, the stem breaking force of T2 generation OPR-7S wheat line OPR-7S O.E.3 and T2 generation OPR-7S wheat line OPR-7S O.E.5 is significantly improved.

[0068] III. Detection of yield traits of OPR-7S wheat

[0069] Test materials: wild type tetraploid wheat Kronos, T2 generation OPR-7S wheat line OPR-7S O.E.3 and OPR-7S O.E.5.

[0070] In November 2020, the test materials were sown in the greenhouse of Fudan University with a plant spacing of 4-5 cm and a row spacing of 20 cm. When sampling for phenotype statistics, random sampling was performed in each row of the three Latin squares of OPR-7S wheat and wild type tetraploid wheat Kronos. Plant and grain phenotypes were observed, and plant height, ear length, grain weight (thousand-grain weight) and stem diameter were measured and counted.

[0071] The plant height detection results are shown in Figure 1 As shown in C, the results show that the average plant height of wild type tetraploid wheat Kronos is 47.80, the average plant height of T2 generation OPR-7S wheat line OPR-7S O.E.3 is 44.35, and the average plant height of T2 generation OPR-7S wheat line OPR-7S O.E.5 is 46.33.

[0072] The ear length detection results are shown in Figure 1 As shown in D, the results show that the average ear length of wild type tetraploid wheat Kronos is 5.20, the average ear length of T2 generation OPR-7S wheat line OPR-7S O.E.3 is 5.35, and the average ear length of T2 generation OPR-7S wheat line OPR-7S O.E.5 is 5.23.

[0073] The thousand-grain weight detection results are shown in Figure 1 As shown in E, the results show that the average thousand-grain weight of wild type tetraploid wheat Kronos is 40.85, the average thousand-grain weight of T2 generation OPR-7S wheat line OPR-7S O.E.3 is 40.54, and the average thousand-grain weight of T2 generation OPR-7S wheat line OPR-7S O.E.5 is 34.82.

[0074] The stem diameter detection results are shown inFigure 1 As shown in FIG. 6, the results show that the average stem diameter of wild-type tetraploid wheat Kronos is 2.69, the average stem diameter of T2 generation OPR-7S wheat line OPR-7S O.E.3 is 2.82, and the average stem diameter of T2 generation OPR-7S wheat line OPR-7S O.E.5 is 2.78.

[0075] IV. Detection of the relative content of cell wall-bound phenolic acids in OPR-7S wheat

[0076] Test materials: wild-type tetraploid wheat Kronos, T2 generation OPR-7S wheat line OPR-7S O.E.3 and OPR-7S O.E.5.

[0077] The relative content of cell wall-bound phenolic acids in the test materials was detected. The specific steps are as follows: 100 seeds were taken, crushed with a tissue grinder, passed through a 60-mesh sieve, and the unpassed material was further ground until all was passed through the sieve to obtain flour; 0.1 ± 0.0005 g of the dried flour was accurately weighed in a 2-mL centrifuge tube; washed with 80% methanol three times; resuspended the precipitate with 1 mL of 80% methanol and transferred to a 10-mL centrifuge tube, centrifuged at 5000 rpm for 5 min; discard the supernatant, add 3 mL of 4M NaOH (containing 10 mM p-tolyl benzoic acid internal standard) and vortex to resuspend the precipitate; treat at 37°C for 16 h; add 2 mL of 6N HCl, mix well, and adjust the pH to 4; add 600 μL of water-saturated ethyl acetate, mix well and centrifuge to collect the upper organic phase, repeat twice, and mix the three organic phases; pass the organic phase through a column of anhydrous sodium sulfate, collect the remaining liquid; take 800 μL of the liquid after column passage in a 1.5-mL centrifuge tube, evaporate the organic solvent; add 200 μL of pure methanol, vortex, and centrifuge at 12000 rpm for 10 min; collect the supernatant for HPLC injection analysis. Subsequently, the wheat cell wall-bound phenolic acids were eluted and detected, separated by gradient elution, with an injection volume of 5 μL, a column temperature of 30°C, and a detection wavelength of 320 nm. The internal standard p-tolyl benzoic acid was detected at 240 nm. The mobile phase used was all added with 0.1% acetic acid.

[0078] The results are shown in FIG. 7. Figure 2As shown in the results, compared with wild-type tetraploid wheat Kronos, the relative content of p-coumaric acid and ferulic acid in the bound phenolic acids in the cell wall of the transgenic OPR-7S wheat was significantly increased. Among them, the relative content of p-coumaric acid in the bound phenolic acids in the cell wall of the wild-type tetraploid wheat Kronos was taken as control 1, the average relative content of p-coumaric acid in the bound phenolic acids in the cell wall of the T2 generation transgenic OPR-7S wheat strain OPR-7S O.E.3 was 1.40, and the average relative content of p-coumaric acid in the bound phenolic acids in the cell wall of the T2 generation transgenic OPR-7S wheat strain OPR-7S O.E.5 was 1.42; the relative content of ferulic acid in the bound phenolic acids in the cell wall of the wild-type tetraploid wheat Kronos was taken as control 1, the average relative content of ferulic acid in the bound phenolic acids in the cell wall of the T2 generation transgenic OPR-7S wheat strain OPR-7S O.E.3 was 1.38, and the average relative content of ferulic acid in the bound phenolic acids in the cell wall of the T2 generation transgenic OPR-7S wheat strain OPR-7S O.E.5 was 1.40. The experimental results further verified that the OPR-7S gene can improve the lodging resistance of wheat by regulating the content of p-coumaric acid and ferulic acid in the bound phenolic acids in the cell wall.

[0079] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, the present application is intended to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. Use of OPR-7S protein or related biomaterials in any of the following 1)-4): 1) Improve wheat's resistance to lodging; 2) Increase the content of bound phenolic acid compounds in wheat cell walls; 3) Cultivate transgenic wheat with improved lodging resistance; 4) Wheat breeding; The OPR-7S protein is any one of the following proteins (a1)-(a2): (a1) the protein shown in Sequence 2 in the Sequence Listing; (a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1); The relevant biological material is a nucleic acid molecule encoding the OPR-7S protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

2. The use according to claim 1, characterized in that: The nucleic acid molecule encoding the OPR-7S protein is the DNA molecule shown in Sequence 1 in the sequence table.

3. The use according to claim 1, characterized in that: The lodging resistance is the breaking force of the stem at the second node of the aboveground part.

4. The use according to claim 1, characterized in that: The combined phenolic acid compound is p-coumaric acid and / or ferulic acid.

5. A method for cultivating transgenic wheat with improved lodging resistance, comprising the steps of increasing the activity and / or content of OPR-7S protein in a recipient wheat to obtain transgenic wheat; the transgenic wheat having higher lodging resistance than the recipient wheat; The OPR-7S protein is any one of the following proteins (a1)-(a2): (a1) the protein shown in Sequence 2 in the Sequence Listing; (a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1).

6. The method according to claim 5, characterized in that: The transgenic wheat has a higher lodging resistance than the recipient wheat, which is reflected in that the stem breaking force of the second node of the aboveground part of the transgenic wheat is higher than that of the recipient wheat.

7. The method according to claim 5, characterized in that: The method for increasing the activity and / or content of the OPR-7S protein in the recipient wheat is to overexpress the OPR-7S protein in the recipient wheat.

8. The method according to claim 7, wherein: The overexpression method is to introduce the coding gene of the OPR-7S protein into the recipient wheat.

9. The method according to any one of claims 5 to 8, characterized in that: The nucleotide sequence of the gene encoding the OPR-7S protein is shown in Sequence 1.

Images