Method for constructing Ago2 gene knockout BV2 cell line based on CRISPR / Cas9 and application

Abstract

The invention discloses a method for constructing an Ago2 gene knockout BV2 cell line based on CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (CRISPR / Cas9) and application of the method, an on-line tool CRISPOR is used for designing and synthesizing one sgRNA (single guide ribonucleic acid) at each of the upstream and downstream of mouse Ago2 gene exon4 and exon11, then the sgRNA is electrically transferred into the BV2 cell line, the Ago2 gene knockout BV2 cell line is obtained through monoclonal cell screening, PCR (polymerase chain reaction) identification and Sanger sequencing identification, and the BV2 cell line is used for constructing the Ago2 gene knockout BV2 cell line. And finally, detecting Ago2 protein expression by using Western blot to verify the knockout effect of the Ago2 gene in the BV2 cell line. The successfully constructed Ago2 gene knockout BV2 cell line provided by the invention provides a favorable tool for research on Ago2 gene functions, drug research and development, Lessel-Kreienkamp syndrome disease mechanism and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of construction and application of Ago2 gene knockout BV2 cell line, and specifically relates to a method and application of constructing Ago2 gene knockout BV2 cell line based on CRISPR / Cas9. Background Art

[0002] There are four Argonaute (Ago) molecules in the mammalian genome: Ago1, Ago2, Ago3 and Ago4, but not all Ago molecules have cleavage activity. Only Ago2 can cleave microRNA (miRNA). As the core element of the RNA-induced silencing complex (RISC), Ago2 can bind to miRNA through RISC, mediate miRNA to recognize target gene mRNA and bind to it to form base pairing, thereby inhibiting or degrading target gene mRNA. Studies have shown that more than 60% of the genes in the human genome are regulated by miRNA. Therefore, as a key factor in the gene silencing process, Ago2 plays a vital role in human health and disease, and participates in many important physiological and pathological processes in the body, such as neural development, angiogenesis, tumorigenesis and body metabolism, which makes it a hot spot in biomedical research.

[0003] During the process of neuronal injury and degeneration, glial cells undergo reactive proliferation, which, on the one hand, participate in the removal of degenerated substances and fill the damaged area, and on the other hand, produce and secrete substances that affect neuronal repair and regeneration. Microglia, as resident immune effector cells of the central nervous system (CNS), originate from red pulp progenitor cells in the yolk sac and migrate to the CNS during early development. They play an important role in maintaining brain homeostasis, brain immune regulation and protecting neurons. Microglia are activated to form reactive or phagocytic microglia when neurons are injured and degenerated, which engulf degenerated cells and myelin fragments, etc., to facilitate the repair and regeneration of processes. At the same time, it can also produce a variety of cytokines, which directly or indirectly affect the proliferation, development, migration and differentiation of neurons and glial cells through paracrine or autocrine secretion. Therefore, it is particularly important to deeply study microglia and their regulation of neurons and the repair of neuronal injury and degeneration.

[0004] Lessel-Kreienkamp syndrome (OMIM: 619149) is a neurodevelopmental disorder caused by heterozygous mutations in the Ago2 gene located on chromosome 8q24, characterized by global developmental delay, intellectual disability, and speech delay that appear from infancy or early childhood. Our previous studies have shown that conditional knockout of the Ago2 gene in microglia affects Ago2 flox / flox , the growth and development of Cx3cr1-Cre mice leads to the activation and reduction of microglia in the brain, and abnormal morphology, which in turn promotes the activation of astrocytes. The above results show that the Ago2 gene plays an important role in maintaining the homeostasis of microglia. Therefore, the Ago2 gene knockout BV2 cell line constructed by the present invention can provide a useful tool for in-depth research on the function and mechanism of action of the Ago2 gene in microglia, as well as for the treatment of Lessel-Kreienkamp syndrome. There are currently no relevant reports in this regard. Summary of the invention

[0005] The purpose of the present invention is to provide a method and application of constructing an Ago2 gene knockout BV2 cell line based on CRISPR / Cas9. The Ago2 gene knockout BV2 cell line constructed by this method can be used as a tool for studying the function and mechanism of the Ago2 gene in microglia, as well as a research tool for targeting Ago2 to treat Lessel-Kreienkamp syndrome.

[0006] In order to achieve the above-mentioned purpose, the present invention adopts the following technical scheme, a method for constructing an Ago2 gene knockout BV2 cell line based on CRISPR / Cas9, the specific process of which is: using the online tool CRISPOR to design a knockout site targeting the Ago2 gene, then synthesizing sgRNA and Cas9 protein and incubating them to combine into an RNP complex, and using the Neon electrofection system to transfect BV2 cells and then screen positive monoclones of the Ago2 gene knockout, and finally obtaining a BV2 cell line with successful Ago2 gene knockout through PCR, sequencing and Western blot identification, the sgRNA sequence targeting the Ago2 gene includes sgRNA1 and sgRNA2:

[0007] sgRNA1:GATCTGGGTAGATTGAACAAGGG;

[0008] sgRNA2:AAAGGCGTGTGCCCTATCCCTGG.

[0009] Furthermore, the specific steps for constructing the Ago2 gene knockout BV2 cell line based on CRISPR / Cas9 are as follows:

[0010] Step S1, search the mouse Ago2 gene on the Ensembl website, select the transcript Ago2-201, and then use the online tool CRISPOR to design one target site each upstream and downstream of exon4 and exon11, which are sgRNA1 and sgRNA2 respectively;

[0011] Step S2, synthesizing sgRNA1 and sgRNA2 targeting the Ago2 gene and Cas9 protein according to the design scheme;

[0012] Step S3, select BV2 cells in logarithmic growth phase, count the cells and convert 1×10 6 The cells were transferred into a centrifuge tube and centrifuged to obtain a cell pellet. The sgRNA and Cas9 protein were incubated and combined into an RNP complex using the Neon transfection system kit, and the BV2 cells were transfected using the Neon electrofection system. At the same time, the EGFP control group was transfected under the same parameters.

[0013] Step S4, counting the transfected BV2 cells and inoculating a single clone, screening the Ago2 gene knockout BV2 cell line with monoclonal growth, and continuing to culture until the single clone grows to a sufficient number before expanding the culture;

[0014] Step S5, extracting genomic DNA of the Ago2 gene knockout BV2 cell line for PCR detection, analyzing the target site and knockout band, and then performing Sanger sequencing on the PCR product of the initial successful knockout cell line to analyze the knockout sequence, and finally extracting the total protein of the successful knockout cell line for Western blot detection to analyze the expression changes of Ago2 protein at the protein level.

[0015] Furthermore, the PCR detection primers for the Ago2 gene in step S5 are: Ago2-1F, GGCTGTTTCCTGTGGGTAGT; Ago2-1R, AGGTCTACGGTAGGTGCCTC; Ago2-2F, GGTGACTGCCATTTATGAGATGTG; Ago2-2R, CACTGACCCCAGACAGGTAAA; Ago2-3F, GGCTGTTTCCTGTGGGTAGT; Ago2-3R, CACTGACCCCAGACAGGTAAA.

[0016] Furthermore, the Sanger sequencing result of the Ago2 gene in step S5 is: ATCCACCCTGCCGCACACACAAACAAATACATGCC-del 8442bp-ACCCAGATCTTACAGTTCACAGTTGAATCATCACT.

[0017] The Ago2 gene knockout BV2 cell line provided by the present invention is used in studying the influence of Ago2 gene deletion on microglial function and action mechanism, the pathological mechanism of Lessel-Kreienkamp syndrome and drug development.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: by utilizing CRISPR / Cas9 gene editing technology, a specific sgRNA sequence is designed to target the Ago2 gene for efficient knockout of large fragments, providing an efficient, simple and economical method for constructing an Ago2 gene knockout BV2 cell line; PCR, Sanger sequencing and Western blot results show that Ago2 protein is almost not expressed, resulting in loss of Ago2 gene function, which can provide an ideal microglial cell model for research on Ago2 gene function, drug development and Lessel-Kreienkamp syndrome disease mechanism. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Strategy for constructing Ago2 gene knockout BV2 cell line based on CRISPR / Cas9. Figure 1 A in the figure is the sgRNA sequence designed for targeting the Ago2 gene and the Sanger sequencing result.

[0020] Figure 2 These are the results of identification of the Ago2 gene knockout BV2 cell line. Figure 2 A in the middle is the knockout band detected by PCR for Ago2 gene knockout cell line. Figure 2 B in the middle is Western blot identification to detect the expression changes of Ago2 protein at the protein level. Figure 2 C is Figure 2 Quantitative analysis results of B. WT, wild-type identification primer; KO, knockout identification primer; Marker, DNA molecular weight standard; sgNT, wild-type BV2 cell group; sgAgo2, Ago2 gene knockout cell group; ***, P<0.001.

[0021] Figure 3 To investigate the effect of Ago2 gene knockout on the downstream signaling pathways of microglia. Figure 3 A in the middle is the expression changes of brain-derived neurotrophic factor (BDNF) and apoptosis protein (BAX) detected by Western blot. Figure 3 B is Figure 3 The quantitative analysis results of A in Figure 3Middle C is Western blot detection of the expression changes of triggering receptor 2 on myeloid cells (TREM2), carrier protein E (ApoE), ribosomal protein S6 kinase 1 (S6K1) of mTOR signaling substrate, and eukaryotic translation initiation factor 4E binding protein 1 (4EBP1). Figure 3 D is Figure 3 Quantitative analysis results of C. sgNT, wild-type BV2 cell group; sgAgo2, Ago2 gene knockout cell group; *, P<0.05; **, P<0.01. DETAILED DESCRIPTION

[0022] The above contents of the present invention are further described in detail below through examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples, and all technologies implemented based on the above contents of the present invention belong to the scope of the present invention.

[0023] 1. Knockout target design

[0024] The mouse Ago2 gene (ENSMUSG00000036698) was searched on the Ensembl website, the structure of the gene was analyzed, and the site to be knocked out was determined; Ago2-201 (ENSMUST00000044113.12) was selected as the transcript, and one target site was designed upstream and downstream of its exon4 and exon11 using the online tool CRISPOR (http: / / crispor.tefor.net / ). The sgRNA sequences were: sgRNA1, GATCTGGGTAGATTGAACAAGGG; sgRNA2: AAAGGCGTGTGCCCTATCCCTGG.

[0025] 2. Knockout vector construction

[0026] According to the design plan, sgRNA1 and sgRNA2 targeting the Ago2 gene and Cas9 protein were synthesized.

[0027] 3. Cell Transfection

[0028] (1) Select BV2 cells in good condition and collect the cells when the cell confluence reaches 70%-80%. Count them using a cell counter and count 1×10 6 The cells were transferred into a centrifuge tube and the cell pellet was obtained after centrifugation.

[0029] (2) Cell transfection was performed using the Neon electrofection system (MPK5000, ThermoFisher Scientific). The specific steps were as follows: 1) Place the electroporation base in the clean bench, add 3 mL of electrolysis buffer E (MPK1096, ThermoFisher Scientific) to the sterilized electroporation cup, and clip it onto the Neon pipette holder on the base; 2) Prepare the electroporation gun and Neon pipette tip, and use 3 × 10 5 Sampling principle of each tip: Add enough suspension into the centrifuge tube, centrifuge at 2200rpm for 4min, and discard the supernatant; 3) Incubate sgRNA1, sgRNA2 and Cas9 protein to form RNP complex, then add 10μL resuspension buffer R (MPK1096, ThermoFisher Scientific) to the centrifuge tube, and then add RNP complex and mix thoroughly to resuspend; 4) Insert the electroporation gun into the tip and suck up the resuspended suspension, making sure there are no bubbles and air columns in the tip, and then place the tip and the electroporation gun into the electroporation cup; 5) Set the electroporation parameters as follows: pulse voltage 1680V, ​​pulse width 20ms, pulse number 1. Electroporate the above mixture, and after the electroporation, gently put the cells in the tip into the preheated culture medium; 6) Use the same parameters to electroporate the EGFP control group, and judge the electroporation efficiency according to the situation of the EGFP control group.

[0030] 4. Monoclonal cell preparation and screening

[0031] Re-digest the transfected cells, count them using a cell counter, adjust the cell concentration to 5 cells / mL, and plate them in a 96-well plate with a volume of 100 μL per well. Observe the clone growth status under a microscope, select the well with only one monoclonal cell group and continue to culture it. When the monoclonal cell grows to a sufficient number, expand the culture after digestion.

[0032] 5. Knockout Cell Line Identification

[0033] (1) PCR identification

[0034] Genomic DNA was quickly extracted from the Ago2 knockout BV2 cell line using a column-based genomic DNA extraction kit (DC112-01, Vazyme), and quantitatively analyzed using a NanoDrop spectrophotometer (NanoDrop One, ThermoFisherScientific). Then, PCR amplification was performed using a high-fidelity PCR premix (P520-03, Vazyme). The primer list and reaction system are shown in Tables 1 and 2. The PCR reaction conditions for Region 1 and Region 2 were: 95°C, 3min; 95°C, 30s; 62°C, 30s; 72°C, 30s; 35 cycles; 72°C, 10min. The PCR reaction conditions for Region 3 were: 95°C, 3min; 95°C, 30s; 62°C, 30s; 72°C, 2min; 35 cycles; 72°C, 10min. The results of agarose gel electrophoresis showed that the specific bands were: Region 1 (sgNT, 589 bp; sgAgo2, 0 bp), Region 2 (sgNT, 748 bp; sgAgo2, 0 bp), Region 3 (sgNT, 9276 bp; sgAgo2, ~863 bp) ( Figure 2 Middle A), it was preliminarily judged that the BV2 cell line with Ago2 gene knockout was successfully constructed.

[0035] Table 1 PCR primer sequences for identification of Ago2 gene knockout BV2 cell line

[0036]

[0037] Table 2 PCR reaction system

[0038]

[0039] (2) Sanger sequencing identification

[0040] The PCR product was sent to Shanghai Biotech Co., Ltd. for Sanger sequencing. The sequencing results were compared with SnapGene software to confirm that the Ago2 gene was knocked out by 8442 bp ( Figure 2 Middle A), specifically ATCCACCCTGCCGCACACACAAACAAATACATGCC-del 8442bp-ACCCAGATCTTACAGTTCACAGTTGAATCATCACT, further confirming that the Ago2 gene produced a large fragment knockout at the genomic level, resulting in loss of gene function.

[0041] (3) Western blot identification

[0042] The BV2 cell line with successful Ago2 gene knockout was expanded in a 6 cm culture dish, and total protein was extracted using RIPA lysis buffer (CW2333S, CWBIO) to which protease inhibitors (CW2200S, CWBIO) and phosphatase inhibitors (CW2383S, CWBIO) were added, and protein quantitative analysis was performed using a BCA protein quantification kit (CW0014S, CWBIO). Protein electrophoresis was then performed using a protein electrophoresis gel preparation kit type II (PE008-2, Shaanxi Zhonghui Hecai Biopharmaceutical Technology Co., Ltd.). Western blot results showed that compared with wild-type BV2 cells (sgNT), Ago2 protein was almost not expressed in the BV2 cell line with Ago2 gene knockout (sgAgo2) ( Figure 2 Medium B and Figure 2 Middle C), finally confirmed that the Ago2 gene knockout BV2 cell line was successfully constructed.

[0043] 6. Effects of Ago2 gene knockout on downstream signaling pathways in microglia

[0044] sgNT and sgAgo2 cell lines were cultured in 6 cm culture dishes, and cells were collected when the cell confluence reached 70%-80%. Total protein was extracted and then subjected to protein electrophoresis. Western blot results showed that compared with sgNT cells, sgAgo2 cells had significantly increased BDNF and BAX protein expression, and TREM2, ApoE, p-S6K1, and p-4EBP1 protein expression, indicating that microglial apoptosis increased and lipid metabolism was abnormal after Ago2 gene knockout.

[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. A person skilled in the art should understand that any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

[0046] SEQUENCE LISTING

[0047] <110> Xinxiang Medical College

[0048] <120> Method and application of constructing Ago2 gene knockout BV2 cell line based on CRISPR / Cas9

[0049] <130> 2025

[0050] <160> 8

[0051] <170> patent version 3.3

[0052] <210> 1

[0053] <211> twenty three

[0054] <212> DNA

[0055] <213> Artificial sequence

[0056] <400> 1

[0057] GATCTGGGTAGATTGAACAAGGG 23

[0058] <210> 2

[0059] <211> twenty three

[0060] <212> DNA

[0061] <213> Artificial sequence

[0062] <400> 2

[0063] AAAGGCGTGTGCCCTATCCCTGG 23 <210> 3

[0064] <211> 20

[0065] <212> DNA

[0066] <213> Artificial sequence

[0067] <400> 3

[0068] GGCTGTTTCCTGTGGGTAGT 20

[0069] <210> 4

[0070] <211> 20

[0071] <212> DNA

[0072] <213> Artificial sequence

[0073] <400> 4

[0074] AGGTCTACGGTAGGTGCCTC 20

[0075] <210> 5

[0076] <211> twenty four

[0077] <212> DNA

[0078] <213> Artificial sequence

[0079] <400> 5

[0080] GGTGACTGCCATTTATGAGATGTG 24 <210> 6

[0081] <211> twenty one

[0082] <212> DNA

[0083] <213> Artificial sequence

[0084] <400> 6

[0085] CACTGACCCCAGACAGGTAAA 21

[0086] <210> 7

[0087] <211> 20

[0088] <212> DNA

[0089] <213> Artificial sequence

[0090] <400> 7

[0091] GGCTGTTTCCTGTGGGTAGT 20

[0092] <210> 8

[0093] <211> twenty one

[0094] <212> DNA

[0095] <213> Artificial sequence

[0096] <400> 8

[0097] CACTGACCCCAGACAGGTAAA 21

Claims

1. Construction based on CRISPR / Cas9 Ago2 A method for knocking out a BV2 cell line, characterized in that The specific process is as follows: Use the online tool CRISPOR to design targeted Ago2 The knockout site of the gene was located, and sgRNA and Cas9 protein were synthesized and incubated to form an RNP complex. The BV2 cells were transfected with the Neon electroporation system and then screened. Ago2 The positive monoclonal clones of gene knockout were finally obtained through PCR, sequencing and Western blot identification. Ago2 The BV2 cell line with successful gene knockout, the target Ago2 The sgRNA sequences of the gene include sgRNA1 and sgRNA2: sgRNA1:GATCTGGGTAGATTGAACAAGGG; sgRNA2:AAAGGCGTGTGCCCTATCCCTGG.

2. The CRISPR / Cas9-based construct according to claim 1 Ago2 A method for knocking out a BV2 cell line, characterized in that The specific steps are: Step S1, search for mouse on the Ensembl website Ago2 Gene, selected transcript Ago2 -201, and then use the online tool CRISPOR to design one target site each upstream and downstream of exon4 and exon11, which are sgRNA1 and sgRNA2 respectively; Step S2, synthesizing the targeted Ago2 sgRNA1 and sgRNA2 of the gene, and Cas9 protein; Step S3, select BV2 cells in logarithmic growth phase, count the cells and convert 1×10 6 The cells were transferred into a centrifuge tube and centrifuged to obtain a cell pellet. The sgRNA and Cas9 protein were incubated and combined into an RNP complex using the Neon transfection system kit, and the BV2 cells were transfected using the Neon electrofection system. At the same time, the EGFP control group was transfected under the same parameters. Step S4, counting the transfected BV2 cells and inoculating the monoclonal cells to screen the monoclonal growth Ago2 For the knockout BV2 cell line, continue culturing until the single clone grows to a sufficient number before expanding the culture; Step S5, extract Ago2 The genomic DNA of the gene knockout BV2 cell line was tested by PCR to analyze the target site and knockout bands. The PCR products of the initial successful knockout cell line were then sequenced by Sanger sequencing to analyze the knockout sequence. Finally, the total protein of the successful knockout cell line was extracted for Western blot detection to analyze the expression changes of Ago2 protein at the protein level.

3. The CRISPR / Cas9-based construct according to claim 2 Ago2 A method for knocking out a BV2 cell line, characterized in that In step S5 Ago2 The PCR primers for gene detection are: Ago2 -1F, GGCTGTTTCCTGTGGGTAGT; Ago2 -1R,AGGTCTACGGTAGGTGCCTC; Ago2 -2F, GGTGACTGCCATTTATGAGATGTG; Ago2 -2R, CACTGACCCCAGACAGGTAAA; Ago2 -3F, GGCTGTTTCCTGTGGGTAGT; Ago2 -3R, CACTGACCCCAGACAGGTAAA.

4. The CRISPR / Cas9-based construct according to claim 2 Ago2 A method for knocking out a BV2 cell line, characterized in that In step S5 Ago2 The Sanger sequencing result of the gene was: ATCCACCCTGCCGCACACACAAACAAATACATGCC-del 8442bp-ACCCAGATCTTACAGTTCACAGTTGAATCATCACT.

5. A method constructed according to any one of claims 1 to 4 Ago2 Gene knockout BV2 cell line in research Ago2 The effects of gene deletion on microglial function and mechanism of action, the pathological mechanism of Lessel-Kreienkamp syndrome, and its application in drug development.

Images