Artificial synthesis method of vesicular virus shuttle vector and application of vesicular virus shuttle vector

Abstract

The invention discloses an artificial synthesis method and application of a vesicle virus shuttle vector. The shuttle vector of the vesicular virus takes a whole genome of the vesicular virus of the budworm as a basis, and 13 gene segments from AC1 to AC13 are obtained through segmented PCR (Polymerase Chain Reaction) amplification. The method comprises the following steps: dividing gene segments into four groups, transforming the four groups into yeast protoplast spheres, and obtaining four large gene segments from AC-1-pGF-TAR to AC-4-pGF-TAR by virtue of a transformation-associated recombination cloning (TAR) technology, wherein the four large gene segments are obtained from the AC-1-pGF-TAR to the AC-4-pGF-TAR; according to the invention, the vesicular virus shuttle vector is artificially synthesized on the basis of the whole genome of the insect vesicular virus, can be used as a molecular operation platform of the insect vesicular virus, obtains a rapid and efficient insect vesicular virus editing system, and plays an important role in theoretical research and production application.

Description

Technical Field

[0001] The invention belongs to the field of insect virus genetic engineering, and specifically relates to the artificial synthesis of a vesicular virus shuttle and its application, and in particular to a vesicular virus shuttle vector and its construction method. Background Art

[0002] Vesicular viruses are a class of large double-stranded circular DNA insect viruses that mainly infect the larvae of the Lepidoptera Noctuidae family. They have a relatively wide host range and mainly infect agricultural pests such as the beet armyworm, the cutworm and the beet armyworm. After infection with vesicular viruses, host larvae will show pathological characteristics such as slow development, reduced feeding, sluggish movement, and difficulty in molting. The tobacco budworm vesicular virus 3h strain has a strong pathogenicity and can quickly infect host larvae and rapidly proliferate in them, significantly inhibiting the feeding amount and growth and development rate of host larvae. In the field, HvAV-3h mainly relies on the egg-laying behavior of the braconid wasp to spread between hosts. How to better utilize the efficient biological control resource tobacco budworm vesicular virus is an important research topic.

[0003] Insect virus expression vectors have great prospects in both theoretical research and production applications. In thesis research, the expression of target proteins is used to analyze the function of genes and the recombination sites and mechanisms between or within molecules of the viral genome. In production and application methods, insect virus expression vectors have better antigenicity, immunogenicity and safety, and can effectively solve the production scale and cost issues of proteins.

[0004] The Chinese application with application number 202010064413.1 discloses an absolute quantitative PCR method for rapid determination of vesicular virus titer. The sample containing the vesicular virus to be tested is ultrasonically disrupted, then diluted and filtered, and used to infect cells in the logarithmic growth phase for 1 hour, the cell suspension is collected, the number of cells is calculated, and the total DNA is extracted: the above DNA is subjected to qPCR detection, and the pGEM-T vector containing the fragment is used as the standard to draw a standard curve for absolute quantitative PCR detection. The number of viral genome copies contained in each sample is calculated based on the Ct value of the sample. According to the infection multiplicity formula, the average number of virus particles infected per cell is calculated, that is, the ratio of the number of viruses to the number of cells during infection is used to calculate the virus titer. This method determines the vesicular virus titer. When the sample concentration is 1x10 2 -1x10 11 When the viral gene copies / ml is detected, the detection time only takes 4-6 h, which is time-saving. Compared with the traditional virus titer detection method, the operation is simple, fast and accurate, thereby determining the titer of the vesicle virus.

[0005] At present, there is no vesicular virus shuttle vector that can effectively edit insect virus genes, so it is particularly important to find an editing system that can operate vesicular viruses.

[0006] In view of this, the present invention is proposed. Summary of the invention

[0007] The technical problem to be solved by the present invention is to overcome the deficiencies of the prior art and provide a method for artificially synthesizing a vesicular virus shuttle vector and its application. The present invention is based on the tobacco budworm vesicular virus, artificially synthesizes gene fragments, and converts them into Escherichia coli to obtain a recombinant shuttle vector. The obtained recombinant vector can quickly and efficiently edit the vesicular virus code, and obtain a fast and efficient vesicular virus editing system, which plays an important role in both theoretical research and production application.

[0008] In order to solve the above technical problems, the basic concept of the technical solution adopted by the present invention is: The first object of the present invention is to provide a vesicular virus shuttle vector. Based on the tobacco budworm vesicular virus genome (NCBI accession number is KU170628.1), AC1 (from the 1st to the 12th position of KU170628.1), AC2 (from the 13th to the 25th position of KU170628.1), AC3 (from the 26th to the 40th position of KU170628.1), AC4 (from the 41st to the 56th position of KU170628.1), AC5 (from the 57th to the 66th position of KU170628.1), AC6 (from the 67th to the 66th position of KU170628.1) are first artificially synthesized. 86), AC7 (87 to 101 of KU170628.1), AC8 (102 to 122 of KU170628.1), AC9 (123 to 137 of KU170628.1), AC10 (138 to 151 of KU170628.1), AC11 (152 to 164 of KU170628.1), AC12 (165 to 176 of KU170628.1), AC13 (177 to 185 of KU170628.1), a total of 13 gene segments (~15 kb), and were connected to the pGF-TAR vector respectively. The 13 gene fragments were divided into four groups, namely, four large gene fragments, namely, AC1, AC2, AC3, and AC4 constituted one group (AC1), AC5, AC6, and AC7 constituted one group (AC2), AC8, AC9, and AC10 constituted one group (AC3), and AC11, AC12, and AC13 constituted one group (AC4). The AC-1-pGF-TAR (57137 bp), AC-2-pGF-TAR (44751 bp), AC-3-pGF-TAR (44674 bp), and AC-4-pGF-TAR (44793 bp) large-fragment gene vectors were obtained by TAR technology.

[0009] Based on the tobacco budworm vesicular virus, 13 gene fragments, AC1, AC2, AC3, AC4, AC5, AC6, AC7, AC8, AC9, AC10, AC11, AC12, and AC13, were artificially synthesized and connected to the pGF-TAR vector. Four groups were divided into four groups to obtain AC-n-TAR in yeast spheroplasts using TAR technology.

[0010] In a further scheme, AC1-pGF-TAR, AC2-pGF-TAR, AC3-pGF-TAR, and AC4-pGF-TAR gene fragment vectors are obtained in yeast spheroplasts to obtain the AC-1-pGF-TAR large gene fragment vector.

[0011] In a further scheme, AC5-pGF-TAR, AC6-pGF-TAR, AC7-pGF-TAR gene fragment vectors are obtained in yeast spheroplasts to obtain AC-2-pGF-TAR large gene fragment vector.

[0012] In a further scheme, AC8-pGF-TAR, AC9-pGF-TAR, and AC10-pGF-TAR gene fragment vectors were used to obtain AC-3-pGF-TAR large gene fragment vectors in yeast spheroplasts.

[0013] In a further scheme, AC11-pGF-TAR, AC12-pGF-TAR, and AC13-pGF-TAR gene fragment vectors were used to obtain AC-4-pGF-TAR large gene fragment vectors in yeast spheroplasts.

[0014] For further solutions, the nucleic acid sequence of the pGF-TAR expression vector can be found in (Hou Z, Zhou Z, Wang Z, XiaoG. Assembly of long DNA sequences using a new synthetic Escherichia coli-yeast shuttle vector. Virol Sin. 2016 Apr;31(2):160-7. doi: 10.1007 / s12250-016-3730-8.).

[0015] In a further embodiment, the preparation method comprises: The second object of the present invention is to provide a method for preparing the above-mentioned tobacco budworm virus expression vector, comprising: (1) Based on tobacco budworm virus, AC1, AC2, AC3, AC4, AC5, AC6, AC7, AC8, AC9, AC10, AC11, AC12, and AC13 gene fragments were artificially synthesized and connected to pGF-TAR vector to obtain ACn-pGF-TAR gene fragment vector; (2) The gene fragment vectors obtained in step (1) are grouped and the AC-1-pGF-TAR, AC-2-pGF-TAR, AC-3-pGF-TAR, and AC-4-pGF-TAR large gene fragment vectors are obtained using TAR technology.

[0016] (3) The AC-1-pGF-TAR, AC-2-pGF-TAR, AC-3-pGF-TAR, and AC-4-pGF-TAR large gene fragment vectors obtained in step (2) are electroporated into Escherichia coli to screen for vesicle virus shuttle vectors.

[0017] In a further embodiment, the preparation method comprises: (1) Using the genome of tobacco budworm vesicular virus as a template, the AC1, AC2, AC3, AC4, AC5, AC6, AC7, AC8, AC9, AC10, AC11, AC12, and AC13 gene fragments were artificially synthesized and ligated to the pGF-TAR vector.

[0018] (2) The ACn-pGF gene fragment vectors obtained in step (1) are divided into four groups and transferred into yeast spheroplasts using TAR technology to obtain large gene fragment vectors of basically the same length, namely AC-1-pGF-TAR, AC-2-pGF-TAR, AC-3-pGF-TAR, and AC-4-pGF-TAR.

[0019] (3) The AC-1-pGF-TAR, AC-2-pGF-TAR, AC-3-pGF-TAR, and AC-4-pGF-TAR large gene fragment vectors obtained in step (2) were transformed into Escherichia coli by electroporation to obtain a vesicle viral shuttle vector named AC-pGF-TAR.

[0020] The third object of the present invention is to provide a recombinant bacterium, wherein the recombinant bacterium contains the vesicle virus shuttle vector as described in the above scheme; Preferably, the recombinant bacteria include recombinant Escherichia coli EPI300, into which the vesicle virus shuttle vector described in the above scheme is transferred.

[0021] The fourth object of the present invention is to provide an application of the vesicle virus shuttle vector as described above in the rapid editing of insect viruses.

[0022] Preferably, the use of vesicle virus shuttle vectors in efficient editing of insect virus genes; More preferably, the vesicle virus shuttle vector is used to efficiently edit insect virus genes in the fat body cell line of Spodoptera exigua.

[0023] After adopting the above technical solution, the present invention has the following beneficial effects compared with the prior art: The recombinant vector of the present invention can edit insect vesicle viruses quickly and efficiently, and can be used to study the functions and mechanisms of action of genes and proteins, etc. It provides an insect virus editing system for theoretical research and lays a good foundation.

[0024] The recombinant vector of the present invention can efficiently edit viral genes in lepidopteran insect cell lines such as the fat body cell line of Spodoptera exigua and the ovarian cell line of Spodoptera frugiperda, and can be used to study the protein functions of insect viruses or lepidopteran hosts.

[0025] The specific implementation modes of the present invention are further described in detail below in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings are part of the present invention and are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention, but do not constitute an improper limitation of the present invention. Obviously, the drawings described below are only some embodiments. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work. In the accompanying drawings: Figure 1 It is a schematic diagram of the construction strategy of the tobacco budworm vesicular virus of the present invention; Figure 2 The following are the restriction enzyme digestion maps of the TAR vectors of the 13 recombinant large fragment genes. Columns 1-13 represent the 13 TAR vectors recombined with different HvAV-3h large fragment gene sizes (~11-15 Kb). The recombinant fragments were separated from the TAR vector using the unique restriction endonuclease site (SrfI) added to the TAR vector amplification primers. M* represents lambda DNA (size range 100-~23Kb, ThermoFisher Scientific) digested with HindIII marker; Figure 3 It is a gel electrophoresis diagram of all homology arm sequences of the tobacco budworm vesicular virus AC-pGF-TAR of the present invention; Figure 4 The PCR products were subjected to agarose gel electrophoresis. A represents the gel electrophoresis of EGFP. M* represents the use of Marker (size range 100-~2000bp, Novizan); Figure 5The vector is a fluorescent bacteria in the fat body cells of Spodoptera exigua. A is a fluorescence image of the wild-type pGF-EGFP-TAR vector in the fat body cells of Spodoptera exigua; B is a fluorescence image of the AC-pGF-EGFP-TAR shuttle vector in the fat body cells of Spodoptera exigua.

[0027] Figure 6 The viral copy number of the vesicle viral shuttle vector AC-pGF-EGFP-TAR was observed by measuring the viral copy number. DETAILED DESCRIPTION

[0028] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the following will be combined with the embodiments of the present invention. The accompanying drawings in the drawings clearly and completely describe the technical solutions in the embodiments. The following embodiments are used to illustrate the present invention but are not used to limit the scope of the present invention.

[0029] Experimental Materials: The pGF-TAR vector was obtained from the Wuhan Institute of Virology.

[0030] Example 1: Construction of vesicle virus shuttle vector (1) Obtaining the whole genome: extracting total DNA from the vesicular virus particles, amplifying and sequencing to obtain the whole genome of the tobacco budworm vesicular virus for artificial synthesis.

[0031] The following amplification and ligation methods are all carried out according to conventional experimental conditions, and the sequences of the primers used are shown in Table 1 below.

[0032] Table 1

[0033] (2) Construction of vesicle virus shuttle vector: Using the genome of tobacco budworm vesicular virus as a template, the primers in Table 1 were used to amplify the gene fragment sequences, and the large fragment ACn-pGF-TAR was obtained using TAR technology.

[0034] TAR test method (1) Preparation of yeast protoplasts a) Streak yeast on YEPD solid medium and culture at 30℃ for 2-3 days until single colonies appear; b) Pick a single yeast colony and place it in 50 mL YEPD liquid medium (depending on the amount to be used), and culture it at 30°C and 220 rpm overnight (14-16 hours); c) Pour the yeast solution into a new 50 mL centrifuge tube and centrifuge at 5000 rpm for 5 min to collect the yeast, then add 30 mL of sterile water and vortex to resuspend; d) Centrifuge at 5000 rpm for 5 min, add 20 mL of 1 M sorbitol solution, vortex and resuspend (can be placed at 4°C overnight); e) Centrifuge at 5000 rpm for 5 min, resuspend in 20 mL SPE solution, add 25 µL of Arthrobacter luteus enzyme and 50 µL of β-mercaptoethanol, and digest at 30°C and 120 rpm for 90 min; f) Centrifuge at 590 g for 5 min, discard the supernatant and add 25 mL of 1 M sorbitol solution. Gently shake the centrifuge tube to resuspend the precipitate. When the precipitate is completely dissolved, add 1 M sorbitol solution to 50 mL. Repeat once. g) Add 2 mL of STC solution to resuspend the protoplasts and dispense 200 µL per tube into sterile 2 mL centrifuge tubes.

[0035] (2) TAR vector transformation a) Add DNA fragment (500 ng-2 µg) and linearized vector (100-200 ng) to yeast protoplasts, mix by gently pipetting and let stand for 10 min; b) Add 800 µL of PEG8000 solution, mix by inverting, and incubate at 30°C for 10 min; c) Centrifuge at 590 g for 10 min at 4°C, add 800 µL of preheated (30°C) SOS liquid medium and mix well, and incubate at 30°C for 40 min; d) Add the protoplasts to 15 mL SORB-Top-His selection medium (preheated at 55°C), mix thoroughly by inverting, and then pour into SORB-Bottom-His selection medium; e) Incubate at 30°C for 3-7 days until all transformants are visible.

[0036] Subsequently, the obtained AC-1-pGF-TAR, AC-2-pGF-TAR, AC-3-pGF-TAR, and AC-4-pGF-TAR large gene fragment vectors were co-electroporated into Escherichia coli EPI300 competent cells, and the positive transformation containing the recombinant plasmid was picked out and cultured overnight at 37°C, 200 rpm in LB liquid culture medium containing K+ resistance. Subsequently, the plasmid was extracted from the bacterial liquid, and the primers in Table 2 were used to verify the different large fragment positions of the vesicle virus shuttle vector to obtain the vesicle virus shuttle vector, namely, the AC-pGF-TAR shuttle vector.

[0037] Table 2

[0038] The schematic diagram of the constructed vector structure is shown in Figure 1 shown.

[0039] Example 2: Application of AC-pGF-TAR shuttle vector AC-pGF-TAR shuttle vector was used to express EGFP in E. coli. A pair of primers for cloning EGFP was designed. The upstream primer is ATGGTGAGCAAGGGCGAGGA, and the downstream primer is TTACTTGTACAGCTCGTCCATGC. The plasmid pCMS-EGFP was used as a template. The above two primers were used to perform PCR amplification using Phanta Max Super-Fidelity DNA Polymerase (Novizan). The PCR amplification program was: 98°C for 30 seconds; 98°C for 10 seconds, 55°C for 20 seconds, and 72°C for 20 seconds, for 28 cycles; and finally, 72°C for 1 minute. The PCR product was detected by agarose gel electrophoresis. The results are shown in Figure 2. Figure 2 A. The electrophoresis results showed that a band of about 750 bp was amplified, which was consistent with the expected size. The band was recovered by agarose gel electrophoresis.

[0040] First, the AC-pGF-TAR shuttle vector was opened with BamHI restriction endonuclease (NEB #R3136), and about 10 ng of the digested vector DNA was transferred to a sterile microcentrifuge tube according to the instructions of Promega's T4 DNA Polymerase System product, and at least 4 times the molar amount of the target gene DNA fragment was added, and then 1 μL of 10×T4 DNA ligase buffer and 1 μL of T4 DNA ligase were added, and sterile ultrapure water was added to a volume of 10 μL. After thorough mixing, all the liquid was collected to the bottom of the tube using a microcentrifuge, and the AC-pGF-TAR vector was connected at 4°C overnight. The ligation product was transformed into Escherichia coli EPI300 competent cells, and a single colony positive clone was selected to LB liquid culture medium, and the plasmid was extracted and named AC-pGF-EGFP-TAR.

[0041] Spread a monolayer of SeFB cells in a 6-well plate. After confirming that the transfected cells are free of contamination and have normal cell morphology, dilute 1 μg of plasmid DNA into 40 uL of serum-free high-glucose DMEM medium (or OPTI-MEM Ⅰ medium) for each well of cells and mix well. Dilute 3 μL of EZ Trans transfection reagent into 40 μL of serum-free high-glucose DMEM medium (or OPTI-MEM Ⅰ medium) for each well of cells and mix gently. Add all the diluted EZ Trans transfection reagent to the diluted plasmid DNA as soon as possible and mix gently. Leave at room temperature for 10-15 min to form the EZ Trans-DNA complex.

[0042] Evenly drop 80 uL of the above EZ Trans-DNA transfection complex into the culture dish containing cells. Gently shake the culture dish or oscillate slightly to disperse the EZ Trans-DNA complex evenly.

[0043] At 37°C, 5% CO 2 Incubate for 6-18 hours, remove the culture medium containing EZ Trans-DNA complex, replace with new culture medium, and observe the fluorescence intensity after culturing for another 48 hours. Figure 5 As shown, it can be seen that the fluorescence intensity of AC-pGF-EGFP-TAR is significantly enhanced compared with that of wild-type pGF-EGFP-TAR.

[0044] Example 3: Recombinant virus inoculation The control vector pGF-EGFP-TAR and the vesicular virus shuttle vector AC-pGF-EGFP-TAR prepared in Example 1 were transformed into fat body cells of Spodoptera exigua.

[0045] Inoculation solution preparation, culture pGF-EGFP-TAR and AC-pGF-EGFP-TAR in liquid culture medium containing kanamycin at 30°C, 220 rpm overnight; take 1-4 ml (2-8 OD) of overnight cultured bacterial solution, centrifuge at 12000 rpm for 1 min to collect bacteria, and discard the supernatant as much as possible. Extract plasmids according to the product instructions of Novizan's 8 min FastPurePlasmid Mini Kit, and transfect the recombinant plasmid into the fat body cells of beet armyworm according to the cell transfection method in Example 2. The viral copy number of the vesicle virus shuttle vector AC-pGF-EGFP-TAR was observed by measuring the viral copy number, and the results are as follows Figure 6 As shown, it can be seen that in the fat body cells of Spodoptera exigua, the number of vesicular virus copies was detected at 12 h under AC-pGF-EGFP-TAR transfection, and there was no virus copy number in the control group, indicating that the editing of vesicular virus can be completed by gene editing of AC-pGF-EGFP-TAR.

[0046] The above is only a preferred embodiment of the present invention, and does not limit the present invention in any form. Although the present invention has been disclosed as a preferred embodiment as above, it is not used to limit the present invention. Any technician familiar with the present invention can make some changes or modify the technical contents suggested above into equivalent embodiments without departing from the scope of the technical solution of the present invention. However, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the solution of the present invention.

Claims

1. A vesicle virus shuttle vector, characterized in that: The vesicular virus shuttle vector uses pGF-TAR as a vector framework, which contains 13 gene fragments, including AC1, AC2, AC3, AC4, AC5, AC6, AC7, AC8, AC9, AC10, AC11, AC12, and AC13, of the tobacco budworm vesicular virus.

2. The vesicle virus shuttle vector according to claim 1, characterized in that On the vesicle virus shuttle vector, the 13 gene fragments are divided into four groups to form large gene fragments, namely, AC1, AC2, AC3, and AC4 constitute a group, AC5, AC6, and AC7 constitute a group, AC8, AC9, and AC10 constitute a group, and AC11, AC12, and AC13 constitute a group.

3. The vesicle virus shuttle vector according to claim 1 or 2, characterized in that The 13 gene fragments are derived from the whole genome of the 3 h strain of tobacco budworm vesicular virus.

4. A method for constructing a vesicle virus shuttle vector according to any one of claims 1 to 3, characterized in that: The steps include: (1) Using the whole genome of tobacco budworm vesicular virus as a template, 13 gene fragments, AC1, AC2, AC3, AC4, AC5, AC6, AC7, AC8, AC9, AC10, AC11, AC12, and AC13, were synthesized and connected to the pGF-TAR cloning expression vector in groups 1 to 13; (2) The cloned expression vector is transformed into Escherichia coli by electroporation, and the vesicle virus shuttle vector is obtained by screening.

5. The construction method according to claim 4, characterized in that: The steps include: (1) Using the whole genome of tobacco budworm vesicular virus as a template, 13 gene fragments, AC1, AC2, AC3, AC4, AC5, AC6, AC7, AC8, AC9, AC10, AC11, AC12, and AC13, were amplified to obtain the target gene; (2) The 13 gene fragments are divided into four groups to form large gene fragments, namely, AC1, AC2, AC3, and AC4 constitute one group, AC5, AC6, and AC7 constitute one group, AC8, AC9, and AC10 constitute one group, and AC11, AC12, and AC13 constitute one group. The AC-1-pGF-TAR, AC-2-pGF-TAR, AC-3-pGF-TAR, and AC-4-pGF-TAR large gene fragment vectors are obtained in yeast spheroplasts by using TAR technology; 3) The artificially synthesized AC-1-pGF-TAR, AC-2-pGF-TAR, AC-3-pGF-TAR, and AC-4-pGF-TAR large gene fragment vectors were transformed into Escherichia coli by electroporation, and the vesicle virus shuttle vectors were screened.

6. The construction method according to claim 5, characterized in that: The Escherichia coli is Escherichia coli E3000.

7. The construction method according to claim 5, characterized in that: The specific operation of screening to obtain the vesicle virus shuttle vector is as follows: (1) Using the whole genome of tobacco budworm vesicular virus as a template, artificially synthesized gene fragments were connected into the pGF-TAR cloning expression vector in four groups to obtain artificially synthesized large gene fragment vectors, which were named AC-1-pGF-TAR, AC-2-pGF-TAR, AC-3-pGF-TAR, and AC-4-pGF-TAR; (2) The AC-1-pGF-TAR, AC-2-pGF-TAR, AC-3-pGF-TAR, and AC-4-pGF-TAR large gene fragment vectors were transformed into Escherichia coli by electroporation to obtain vesicle virus shuttle vectors.

8. A recombinant bacterium, characterized in that: The recombinant bacterium contains the vesicle virus shuttle vector as described in any one of claims 1 to 3.

9. The recombinant bacterium according to claim 8, characterized in that The recombinant bacterium is Escherichia coli EPI300.

10. Use of the vesicular virus shuttle vector according to any one of claims 1 to 3 in improving the editing of target genes by vesicular viruses; Preferably, the vesicular virus shuttle vector is used for the efficient editing of vesicular viruses; more preferably, the vesicular virus shuttle vector is used for the efficient expression of exogenous target proteins; specifically, it is used to improve the editing of target genes in the control of lepidopteran pests using vesicular viruses as biological control resources.

Images