Multiple qPCR (quantitative polymerase chain reaction) detection reagent for detecting neonatal gastrointestinal infection pathogens

Abstract

The invention discloses a multiple qPCR (quantitative polymerase chain reaction) detection reagent for detecting neonatal gastrointestinal infection pathogens. The kit comprises specific primers and probes for detecting enterohemorrhagic escherichia coli, staphylococcus aureus, pseudomonas aeruginosa, streptococcus agalactiae, klebsiella pneumoniae, staphylococcus epidermidis, beta hemolytic streptococcus, salmonella, rotavirus and adenovirus. According to the invention, different fluorescently-labeled probes are utilized to add specific primers and probes of multiple pathogens into a reaction system to detect multiple targets at the same time, and the method has the advantages of good specificity, high sensitivity, short detection period, capability of simultaneously detecting multiple pathogens, rapidness, simplicity, convenience and economy; a convenient method is provided for rapid detection of pathogens causing neonatal gastrointestinal infection, and the kit has important significance in epidemiological research, clinical early molecular diagnosis and the like.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a multiplex qPCR detection reagent for detecting pathogens of neonatal gastrointestinal infection. Background Art

[0002] Gastrointestinal infections are a major global public health burden and the second leading cause of infant mortality. Although this infection can occur at any age, newborns are more susceptible due to their immature intestinal immune response, intestinal flora imbalance, physiological vulnerability, and higher risk of pathogen exposure. Related literature consistently reports outbreaks of gastrointestinal infections in neonatal wards. The World Health Organization reported that 9.1% of the 5.3 million deaths in children under five years of age each year are related to gastrointestinal infections. Therefore, it is particularly important to strengthen the early diagnosis and treatment of neonatal gastrointestinal infections.

[0003] There are many types of pathogens for neonatal gastrointestinal infections, mainly including bacteria, viruses, parasites and fungi. Among bacterial infections, Escherichia coli, Klebsiella pneumoniae, Staphylococcus aureus, etc. are the most common pathogens. In particular, Escherichia coli has a relative advantage in neonatal gastrointestinal infections. It can cause intestinal inflammation through its various virulence factors (such as enterotoxins, adhesins, etc.). It is also the most common Gram-negative bacteria that causes neonatal urinary tract infections, sepsis and meningitis. In premature newborns, Escherichia coli is an important cause of sepsis within the first week of birth, and its related mortality rate can be as high as 40%. Studies have shown that after pathogenic Escherichia coli strains invade the gastrointestinal tract, their toxins or antigens can damage neonatal intestinal epithelial cells, then enter the blood circulation, induce sepsis and lead to systemic inflammatory responses, which has been confirmed in animal models. Escherichia coli usually colonizes the intestines of newborns early in life and becomes an important part of their intestinal microbiota shortly after birth. The Escherichia coli population in the intestine is diverse, including multiple commensal strains, and there may also be pathogenic strains, namely enteropathogenic Escherichia coli (EPEC). These pathogenic strains can invade host tissues and cause neonatal sepsis and neonatal necrotizing enterocolitis (NEC), a severe intestinal inflammatory disease caused by intestinal dysbiosis. In view of these risks, a deep understanding of the early colonization mechanism of Escherichia coli and its relationship with neonatal health is crucial to improving the diagnosis and treatment outcomes of neonates and preventing related diseases. Klebsiella pneumoniae usually causes severe infection through hematogenous transmission, accompanied by complications such as sepsis and meningitis. Viral gastrointestinal infections are mainly caused by rotavirus, norovirus and adenovirus, among which rotavirus is one of the important pathogens of childhood diarrhea worldwide.

[0004] Pathogenic microorganisms invade the host and cause disease through a variety of pathways. Bacteria invade intestinal epithelial cells, secrete toxins or their antigens to cause local inflammatory reactions, damage the intestinal barrier function, and thus affect the absorption and excretion function of the intestine. Viral gastrointestinal infections directly infect intestinal epithelial cells, causing cell damage and death, and then causing clinical symptoms such as diarrhea. The susceptibility of neonatal gastrointestinal infections lies in the fact that the neonatal immune system is not fully developed and the gastrointestinal barrier function is weak. Therefore, pathogenic microorganisms have strong proliferation and pathogenicity in the intestine, which can easily lead to systemic infection.

[0005] Common traditional detection methods, including culture and microscopy, have significant limitations, especially in key indicators such as diagnostic time, sensitivity and specificity. To address these shortcomings, multiplex fluorescence quantitative PCR (qPCR), as a new molecular diagnostic technology, has shown important clinical application prospects. Multiplex qPCR can detect multiple pathogens in a single sample at the same time, thereby reducing the need for newborn samples and reducing the risk of invasive operations. This technology has the following significant advantages: (1) Rapid diagnosis: It can quickly and accurately identify a variety of potential pathogens including viruses, bacteria and fungi, helping clinicians to take effective treatment measures in a timely manner; (2) Accurately distinguish pathogens: It can effectively distinguish different types of pathogens to avoid misdiagnosis due to similar pathogen characteristics; (3) Improve resource utilization efficiency: In the case of limited resources, multiplex qPCR can efficiently detect multiple pathogens, reducing the need for equipment, reagents and operation time, thereby saving time and cost; (4) Simple operation: Compared with traditional methods, multiplex qPCR has lower requirements for experimental equipment and operating conditions, can be completed in basic laboratories, has strong adaptability, and helps to improve the accessibility of diagnosis. Summary of the invention

[0006] The present invention provides a multiplex qPCR detection reagent for detecting pathogens of gastrointestinal infection in neonates, which comprises specific primers and probes for detecting enterohemorrhagic Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus agalactiae, Klebsiella pneumoniae, Staphylococcus epidermidis, beta-hemolytic Streptococcus, Salmonella, rotavirus, and adenovirus. The detection reagent of the present invention also comprises other conventional reagents for multiplex qPCR. The present invention evaluates the specificity, sensitivity, repeatability and accuracy of the established method, and finds that the multiplex qPCR method has the advantages of high detection sensitivity, strong specificity, good repeatability, low requirements on instruments and equipment, simple operation, short time required, etc. Therefore, it has great application value, provides a convenient method for rapid detection of pathogens of gastrointestinal infection in neonates, and is of great significance to epidemiological research and early clinical molecular diagnosis.

[0007] The specific primers for enterohemorrhagic Escherichia coli are GGCGATTGTCGAAGCTTACG and ATTAAAATGGGCGTTGATGGTT, and the probe is CAAACCCGCTGCCGGTGGC; The specific primers for Staphylococcus aureus were CATCACAAACAGATAACGG and AATTAATGTCGCAGGTTC, and the probe was AAGTTGCACTATATACTGTTGGATCTTCAG; The specific primers for P. aeruginosa were TCATCAAGACCCATCCGAAGT and CCGAGAACCAGACTTCATCG, and the probe was CAAGTACCAGGTGCTGCCGATCGC; The specific primers for S. agalactiae were GCAACAAATGCTGCTGGTCA and TGTTGCTGCTTCTGGTGTCA, and the probe was ACCAATCAAGTTTCTGTTGCAGACCA; The specific primers for Klebsiella pneumoniae were GGGCTGAATCTGGGACCAT and CTGAGCTGCAGACCGGTAAAA, and the probe was CACACCCTACGCAGCCAGCTGGT; The specific primers for Staphylococcus epidermidis were GCATGCTGCAATAAAAAAATCGT and CCGGAAGTGTATTCCAATGGA, and the probe was CGAGGATTAAATGCATGATGCTGAC; The specific primers for β-hemolytic streptococci were ATCCTGAGACAACACTGACA and TTGCTGGTGTTTCTRTTTTCA, and the probe was TTGCTGGTGTTTCTRTTTTCA; The primers specific for Salmonella were TTCATCGCACCGTCAAAGGA and ATTGTCACCGTGGTCCAGTT, and the probe was TCGGGCCGCGACTTCCGCGACACGT; The specific primers for rotavirus were ATGTCCTGTACTCCTTGTCAAAA and CCAGTTTGGAACTCATTTCCA, and the probe was ATAATGTGCCTTCGACAAT; The specific primers for adenovirus were GCACTTAACTGTTCTTGTCGTA and CCAAAATAGTTTGCAAAATTGTCTGTT, and the probe was GGATGAGCCCACACTTCTYTATGB.

[0008] The present invention realizes the object of the present invention by adopting the following technical solutions: 1. Collection of fecal samples from clinical patients: Collect feces from the middle and rear part of defecation, and try to dig out the feces from the inner side of the middle part as samples. Use a sterile spoon to dig fresh feces, and put the fecal samples into a sterile tube containing Simple Protect fecal nucleic acid preservation solution. The collected samples are immediately placed in a -80°C refrigerator for cryopreservation; Blood sampling from clinical patients: Collect whole blood samples in anticoagulant tubes, check the patient information and record the hospital number, register them, preserve them at low temperature during transportation, and then store them at -80°C; 2. Select the fecal genomic DNA extraction kit (DP328) or blood genomic DNA extraction kit (DP348) provided by Tiangen Biochemical Technology (Beijing) Co., Ltd. to extract DNA from the collected clinical samples; 3. Using the nucleic acid extracted in step 2 as a template, specific primers and probes targeting 10 pathogens are used for detection by multiplex real-time fluorescence quantitative PCR. The β-actin gene is used as an internal reference, and the results are judged according to the Ct value; Fluorescence signals are collected during the annealing and extension stages of each cycle; In the detection, the specific primers and probes for detecting Enterohemorrhagic Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Streptococcus agalactiae are used simultaneously, and the specific primers and probes for detecting Klebsiella pneumoniae, Staphylococcus epidermidis, β-hemolytic Streptococcus, and Salmonella are used simultaneously; The specific primers and probes for detecting Rotavirus and Adenovirus are used simultaneously; The β-actin gene is used as an internal reference; 4. The interpretation of positive test results includes: (1) The amplification curve is S-shaped and has no abnormal fluctuations. The negative control group and the no-template control group have no Ct value, and the experiment is considered valid; (2) When the Ct value > 38 or the target gene is not detected, it is judged as negative; If the amplification curve is S-shaped and the Ct value ≤ 36, it is judged as positive; If the amplification curve is S-shaped and 36 < Ct value ≤ 38, it is judged as suspicious and needs to be retested. If the retest results are consistent, it is judged as positive.

[0009] Compared with the prior art, the present invention has the following advantages and technical effects: 1. The triple-tube ten-plex fluorescence quantitative PCR detection method for neonatal gastrointestinal infection pathogens (Enterohemorrhagic Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus agalactiae, Klebsiella pneumoniae, Staphylococcus epidermidis, β-hemolytic Streptococcus, Salmonella, Rotavirus, Adenovirus) provided by the present invention has the characteristics of high sensitivity, high specificity, and high repeatability; Using gradient-diluted plasmid standards (10 7 copies / μL - 10 0The sensitivity of the multiplex qPCR method was evaluated using 10 copies / μL) as a template; the results showed that the minimum detection limit for enterohemorrhagic Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, β-hemolytic Streptococcus, and adenovirus was 10 1 The minimum detection limit for Staphylococcus epidermidis, Salmonella and rotavirus was 10 copies / μL. 2 The minimum detection limit for Staphylococcus aureus and Streptococcus agalactiae is 10 0 copies / μL. This shows that the established multiplex qPCR detection method has high sensitivity. At the same time, under the same concentration of plasmid standard template, plasmids containing other common gastrointestinal microorganism-specific gene fragments were added to the multiplex qPCR system for specificity evaluation, and no cross reaction occurred, further proving that the method has high specificity; further repeatability evaluation showed that the coefficient of variation (CV value) within and between batches was less than 5, indicating that the multiplex qPCR detection method has high repeatability; 2. The present invention conducts qualitative detection of pathogen-specific target genes based on the real-time fluorescence quantitative PCR technology platform. Multiple samples can be detected at one time. It has the characteristics of rapidity, specificity, and economy, which greatly reduces the detection cost of each sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 Results of single-plex qPCR specificity tests for four pathogens; Figure 2 Results of single-plex qPCR specificity tests for four pathogens; Figure 3 Results of single-plex qPCR specific tests for two pathogens; Figure 4 This is the multiplex qPCR specificity test result of combination 1 in experimental group 2; Figure 5 The multiplex qPCR specificity test results of combination 2 in experimental group 2; Figure 6 This is the multiplex qPCR specificity test result of combination 3 in experimental group 2; Figure 7 The results of multiplex qPCR sensitivity test for Escherichia coli; Figure 8 The results of multiplex qPCR sensitivity test for Staphylococcus aureus; Fig. 9 The results of the multiplex qPCR sensitivity test for Pseudomonas aeruginosa; Fig.10 The results of multiplex qPCR sensitivity test for Streptococcus agalactiae; Fig.11The results of the multiplex qPCR sensitivity test for Klebsiella pneumoniae; Fig.12 The results of multiplex qPCR sensitivity test for Staphylococcus epidermidis; Fig.13 The results of the multiplex qPCR sensitivity test for β-hemolytic streptococci; Fig.14 The results of multiplex qPCR sensitivity test for Salmonella; Fig.15 This is the result of multiplex qPCR sensitivity test for rotavirus; Fig.16 The results of multiplex qPCR sensitivity test of adenovirus. DETAILED DESCRIPTION

[0011] The technical scheme of the present invention is further described in detail below through examples, but the content of the present invention is not limited thereto. The methods in the present examples are conventional methods unless otherwise specified, and the materials and reagents used are obtained from commercial channels or prepared according to conventional methods unless otherwise specified; Example 1: Design of primers and probes 1. We reviewed relevant literature and identified specific gene fragments of 10 common pathogens of neonatal gastrointestinal infection. Specifically, Klebsiella pneumoniae ( Klebsiella pneumoniae ) selected the KPHS_03130 gene as the target, Escherichia coli ( Escherichia coli ) selected the trpD encoding gene of enterohemorrhagic Escherichia coli (EHEC). For rotavirus, the VP6 gene fragment was selected, while for Staphylococcus epidermidis ( Staphylococcus epidermidis ) and Staphylococcus aureus ( Staphylococcus aureus ) used the gltB gene and spa gene as targets respectively. Adenovirus used the E1A gene of human adenovirus type 3 as the target gene fragment. Streptococcus agalactiae ) selected the AMM49_RS00390 gene, Pseudomonas aeruginosa ( Pseudomonas aeruginosa ) selected the braG gene, while Salmonella ( Salmonella enterica ) selected the invA gene as the target, and the reference sequences of all target genes were downloaded from the website of the National Center for Biotechnology Information (NCBI). Based on these gene sequences, we further consulted relevant literature or designed primers and probes ourselves. After the design was completed, the designed primers and probes were strictly sequenced and optimized using the BLAST tool provided by the NCBI website and primer design software such as Oligo7 and PrimerSelect to ensure high sensitivity and specificity. The following conditions must be met: (1) Tm value: Generally, the probe Tm value is 8-10°C higher than the primer Tm value, and the probe Tm value is generally above 60°C; (2) GC content: generally not less than 40%; (3) No primer dimers were generated, and the hairpin structure software evaluation result was OK; (4) The size of the amplified fragment is generally less than 200 bp; 2. Use the BLAST search function on the NCBI website to compare and select primers and probe sequences with high specificity; the nucleotide sequences of specific primers and probes targeting 10 neonatal gastrointestinal infection pathogens and the internal reference β-actin gene are shown in the table below; ; 3. Construction of plasmid The specific sequences of 10 pathogens and the sequence of the internal reference gene β-actin were connected to the pUC57 vector. The specific sequences of Klebsiella pneumoniae, enterohemorrhagic Escherichia coli, Staphylococcus epidermidis, Staphylococcus aureus, β-hemolytic Streptococcus, Pseudomonas aeruginosa, and rotavirus were connected to pUC57 as plasmid 1 (the nucleotide sequence is shown in SEQ ID NO: 1), and the specific sequences of Salmonella, Streptococcus agalactiae, and adenovirus were connected to pUC57 as plasmid 2 (the nucleotide sequence is shown in SEQ ID NO: 2).

[0012] The specific sequences of other microorganisms commonly found in intestinal infections, such as Shigella sonnei, Bifidobacterium, Clostridium perfringens, and Norovirus, were connected to pUC57 as plasmid 3 (the nucleotide sequence is shown in SEQ ID NO: 3). The copy number of each plasmid was calculated based on the size of the constructed recombinant plasmid and the plasmid concentration. The results of the plasmid copy number are as follows:

[0013] These plasmids were diluted in a 10-fold gradient, with a total of eight gradients of 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 copies / μL level.

[0014] Example 2: Establishment of a ten-plex fluorescence quantitative PCR method 1. Optimization of reaction system The multiplex qPCR grouping was determined, i.e., Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Streptococcus agalactiae were group one, Klebsiella pneumoniae, Staphylococcus epidermidis, β-hemolytic Streptococcus, and Salmonella were group two, and rotavirus and adenovirus were group three. At the same time, β-actin was added to group three as an internal quality control gene, and the three combinations were reacted in three-tube systems respectively.

[0015] All templates use 10 6 The multiplex QPCR reaction system was optimized by using 15μL 2×SuperReal PreMix (Probe), 4μL DNA template, upstream and downstream primers, and probes. ddH2O was added to make up to 30μL. To optimize the reaction conditions, the final concentrations of the upstream and downstream primers of each gene in the reaction system were set to 150, 200, 250, 300, 350, and 400nmol / L, respectively, and the final concentration of the probe was fixed at 160nmol / L. At the same time, six gradient annealing temperatures were set to 51℃, 53℃, 55℃, 57℃, 59℃, and 61℃, respectively, with the final concentrations of primers and probes fixed. The reaction program in the experiment was: 95℃15min, 1 cycle; 95℃5s, 55℃10s, 72℃30s, 40 cycles; at least three replicate wells were set under each condition.

[0016] By comparing the Ct values ​​obtained by primer systems with different final concentrations and annealing temperatures at different temperatures, the appropriate multiplex QPCR reaction system was screened. After comparing the Ct values, the reaction system with a primer final concentration of 300nmol / L and an annealing temperature of 55°C had the best results. Therefore, the final reaction system after optimization is as follows:

[0017] The final reaction conditions were: 95°C for 15 min, 1 cycle; 95°C for 5 s, 55°C for 10 s, 72°C for 30 s, 40 cycles.

[0018] 2. Single-plex qPCR specificity test Plasmid 1 or plasmid 2 was used as template, and the template concentration was 10 6 copies / μL, the primers in step 2 of Example 1 were used to perform single-plex qPCR detection on 10 pathogens, and the results are shown in Figure 1-3 The experimental results showed that the specific primers designed for each pathogen were able to amplify the corresponding pathogen genes. The results showed that the primers designed by the present invention had excellent specificity.

[0019] 3. Multiplex qPCR specificity test The template concentration used for multiplex qPCR specific detection was 106 copies / μL, including plasmid DNA of Klebsiella pneumoniae and 9 other pathogens, as well as β-Actin and plasmids containing non-target microbial genes; the experiment set up four groups: (1) Experimental group 1: only the gene plasmid of common non-target pathogens (plasmid 3) and the multiplex qPCR primers and probes in Table 1 were added; (2) Experimental group 2: Gene plasmids of common non-target pathogens (plasmid 3), multiplex PCR target templates (plasmid 1 or plasmid 2), and multiplex qPCR primers and probes in Table 1 were added simultaneously, and the three-tube system was divided according to step 1; (3) Positive standard group: add multiplex qPCR target template (plasmid 1 or plasmid 2) and multiplex qPCR primers and probes in Table 1; (4) Negative control group: only the multiplex qPCR primers and probes in Table 1 were added, and the template was ddH2O; There was no reaction in experimental group 1 and the negative control group; both experimental group 2 and the positive standard group reacted normally, and the Ct values ​​were all less than 38; the experimental results showed that there was no cross-reaction between the pathogens in each group, indicating that the multiplex qPCR method has good specificity. The specific experimental results are as follows Figure 4-6 shown.

[0020] 4. Multiplex qPCR sensitivity test Different concentrations of pathogen plasmids (including 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0 copies / μL) as DNA template, 10 pathogen plasmids were added to the corresponding primer-probe multiplex system reaction tubes, and ddH2O was set as the negative control of the template. The sensitivity and detection limit of the system in multiplex QPCR were evaluated by recording the Ct value of each experimental group to evaluate the sensitivity and detection limit of the primer-probe system.

[0021] The results are as follows Figures 7 to 16 As shown, the amplification curves from left to right are 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 , 10 0The results showed that the minimum detection limit of enterohemorrhagic Escherichia coli, Pseudomonas aeruginosa, Streptococcus agalactiae, Klebsiella pneumoniae, β-hemolytic Streptococcus, and adenovirus was 10 1 The minimum detection limit for Staphylococcus epidermidis, Salmonella and rotavirus was 10 copies / μL. 2 The minimum detection limit for Staphylococcus aureus and Streptococcus agalactiae is 10 0 copies / μL.

[0022] 5. Multiplex qPCR repeatability evaluation Take 10 6 The positive standard plasmid with 100 copies / μL was used as a template to perform repeatability evaluation of multiplex qPCR, including repeatability evaluation within and between batches. Repeatability evaluation within batch: In the same experiment, three groups of parallel experiments were set up, and all Ct values ​​were recorded in each group. Repeatability evaluation between batches: Three technical repeat groups were set up for each experiment, the average Ct value of each group was calculated, the experiment was repeated three times, and all Ct values ​​were recorded. The coefficient of variation (CV value) within and between batches was calculated to evaluate its repeatability. The experimental results showed that the calculated CV values ​​were all less than 5. This shows that the repeatability of the mqPCR method is good, and the repeatability results are as follows: .

[0023] Example 3: Detection of clinical samples using ten-plex fluorescence quantitative PCR technology 1. Sample collection Fecal sample collection from clinical patients: Collect feces from the middle and rear part of the excretion, and try to dig out feces from the inner middle part as samples. Use a sterile spoon to dig fresh feces, and place the fecal sample in a sterile preservation tube with 1.5mL Simple Protect fecal nucleic acid preservation solution. The sample needs to be about 1g. The collected sample is immediately placed in a -80℃ refrigerator for low-temperature storage; Blood sampling from clinical patients: Collect 1.5 mL of whole blood sample in an anticoagulant tube, check the patient information and record the hospitalization number, register it, keep it at low temperature during transportation, and then store it at -80℃.

[0024] 2. Genomic DNA Extraction DNA was extracted from the collected clinical samples using the fecal genomic DNA extraction kit (DP328) and blood genomic DNA extraction kit (DP348) provided by Tiangen Biochemical Technology (Beijing) Co., Ltd. The extracted nucleic acid was transferred to an enzyme-free centrifuge tube and immediately frozen in a -80°C refrigerator to ensure its stability and provide samples for subsequent testing.

[0025] DNA was extracted from stool samples collected from the case group and the control group using a stool genomic DNA extraction kit. The specific steps are as follows: (1) Transfer 200 µL of Simple Protect Fecal Nucleic Acid Preservation Solution containing the fecal sample into a 1.5 mL centrifuge tube and place it on ice; (2) Add 500 µL of buffer SA, 100 µL of buffer SC, 15 µL of Proteinase K, and 0.25 g of grinding beads to the sample and shake intermittently for 1 min to ensure that the sample is fully mixed; (3) Place the centrifuge tube in a constant temperature box, set the temperature to 70°C, incubate for 15 minutes, and shake every 5 minutes; (4) Vortex the sample for 15 seconds, centrifuge at 12000 rpm ~13400g for 3 minutes, collect the supernatant and transfer it to a new centrifuge tube, add 10μLRNase A, shake and mix, and let it stand at room temperature for 5 minutes; (5) Add 200 μL of buffer SH to the sample, shake to mix, and place on ice for 5 minutes; (6) Centrifuge at 12000 rpm ~13400 g for 3 min; (7) Transfer the supernatant to a new 1.5 mL centrifuge tube, add an equal volume of buffer GFA and mix; (8) Transfer the mixed solution to adsorption column CR2 (placed in a collection tube), centrifuge at 12000 rpm ~13400g for 30 seconds, discard the waste liquid, and keep the adsorption column CR2 in the collection tube; (9) Add 500 µL of buffer GD to the adsorption column CR2, centrifuge at 12000 rpm ~13400 g for 30 seconds, discard the waste liquid, and keep the adsorption column CR2 in the collection tube; (10) Add 700 µL of rinse solution PW to adsorption column CR2, centrifuge at 12000 rpm ~13400 g for 30 s, discard the waste liquid, and keep adsorption column CR2 in the collection tube; (11) Repeat step (10); (12) Place the adsorption column CR2 back into the collection tube and centrifuge at 12000 rpm ~ 13,400 g for 2 minutes, and discard the waste liquid. Place the adsorption column CR2 at room temperature for several minutes to ensure that the residual rinse liquid in the adsorption column is completely evaporated; (13) Transfer the adsorption column CR2 to a new clean centrifuge tube, add 50 µL of elution buffer TB to the center of the adsorption membrane, let it stand at room temperature for 2-5 minutes, then centrifuge at 12000 rpm ~13400g for 2 minutes, and collect the eluate; The centrifuge tubes containing the eluate were stored in a -80°C freezer to ensure the stability of the DNA contained therein.

[0026] DNA was extracted from blood samples and cerebrospinal fluid samples collected from the case group and the control group using a blood genomic DNA extraction kit. The specific steps are as follows: (1) Take 200 μL of blood sample and transfer it to a 1.5 mL centrifuge tube; (2) Add 200 µL of Buffer GB and 20 µL of Proteinase K premix solution to the 200 µL sample obtained by the above treatment, mix thoroughly by inversion, and incubate at 56°C for 10 minutes. During the incubation process, invert and mix several times at intervals until the solution becomes clear; (3) After the sample has stood at room temperature for 2-5 minutes, add 350 µL of buffer BD and mix thoroughly by inversion. At this time, the formation of flocculent precipitate may be observed. (4) Transfer the solution and flocculent precipitate obtained in the previous step to adsorption column CG2 (place adsorption column CG2 in the collection tube), centrifuge at 12000 rpm ~13,400g for 30 seconds, discard the waste liquid in the collection tube, and then put the adsorption column CG2 back into the collection tube; (5) Add 500 µL of buffer GDB to the adsorption column CG2, centrifuge at 12000 rpm ~13400 g for 30 seconds, discard the waste liquid in the collection tube, and then put the adsorption column CG2 back into the collection tube; (6) Add 600 µL of rinse solution PWB to the adsorption column CG2, centrifuge at 12000 rpm ~13400 g for 30 seconds, discard the waste liquid in the collection tube, and then return the adsorption column CG2 to the collection tube; (7) Repeat step (6); (8) Centrifuge at 12000 rpm ~13400g for 2 minutes and discard the waste liquid. Place the adsorption column CG2 at room temperature for 2 minutes to ensure that the residual rinse liquid in the adsorption material is completely dry; (9) Transfer the adsorption column CG2 to a 1.5 mL centrifuge tube, add 50-200 μL of elution buffer TB to the center of the adsorption membrane, and let it stand at room temperature for 2 minutes. Then centrifuge at 12000 rpm ~13400 g for 2 minutes, collect the solution in the centrifuge tube; freeze the centrifuge tube containing the elution solution in a -80 ° C refrigerator to ensure the stability of the DNA contained therein.

[0027] 3. The established multiplex fluorescence quantitative PCR method was used to test 10 clinical samples, of which 5 samples (FB-1~FB-5) were initially tested positive by single-plex qPCR, and the other 5 samples (XY-6~XY-10) were initially tested negative by blood culture.

[0028] The test results showed that the internal reference gene β-Actin of all samples had normal Ct values. In 5 samples (FB-1 to FB-5), positive results of the target pathogen were successfully detected, while in the other 5 samples (XY-6 to XY-10), the pathogen targeted by this method could not be detected. The test results are detailed in the table below:

[0029] As can be seen from the above table, the primer and probe set for multiplex qPCR detection of 10 major exogenous pathogens of neonatal gastrointestinal infection diseases designed by the present invention is faster and more convenient than traditional culture detection and single-plex qPCR methods.

Claims

1. A multiplex qPCR detection reagent for detecting pathogens of gastrointestinal infection in neonates, characterized in that: Includes specific primers and probes for detecting enterohemorrhagic Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus agalactiae, Klebsiella pneumoniae, Staphylococcus epidermidis, beta-hemolytic Streptococcus, Salmonella, rotavirus, and adenovirus; The specific primers for enterohemorrhagic Escherichia coli are GGCGATTGTCGAAGCTTACG and ATTAAAATGGGCGTTGATGGTT, and the probe is CAAACCCGCTGCCGGTGGC; The specific primers for Staphylococcus aureus were CATCACAAACAGATAACGG and AATTAATGTCGCAGGTTC, and the probe was AAGTTGCACTATATACTGTTGGATCTTCAG; The specific primers for P. aeruginosa were TCATCAAGACCCATCCGAAGT and CCGAGAACCAGACTTCATCG, and the probe was CAAGTACCAGGTGCTGCCGATCGC; The specific primers for S. agalactiae were GCAACAAATGCTGCTGGTCA and TGTTGCTGCTTCTGGTGTCA, and the probe was ACCAATCAAGTTTCTGTTGCAGACCA; The specific primers for Klebsiella pneumoniae were GGGCTGAATCTGGGACCAT and CTGAGCTGCAGACCGGTAAAA, and the probe was CACACCCTACGCAGCCAGCTGGT; The specific primers for Staphylococcus epidermidis were GCATGCTGCAATAAAAAAATCGT and CCGGAAGTGTATTCCAATGGA, and the probe was CGAGGATTAAATGCATGATGCTGAC; The specific primers for β-hemolytic streptococci were ATCCTGAGACAACACTGACA and TTGCTGGTGTTTCTRTTTTCA, and the probe was TTGCTGGTGTTTCTRTTTTCA; The primers specific for Salmonella were TTCATCGCACCGTCAAAGGA and ATTGTCACCGTGGTCCAGTT, and the probe was TCGGGCCGCGACTTCCGCGACACGT; The specific primers for rotavirus were ATGTCCTGTACTCCTTGTCAAAA and CCAGTTTGGAACTCATTTCCA, and the probe was ATAATGTGCCTTCGACAAT; The specific primers for adenovirus were GCACTTAACTGTTCTTGTCGTA and CCAAAATAGTTTGCAAAATTGTCTGTT, and the probe was GGATGAGCCCACACTTCTYTATGB.

Images