Application of HCG18 (human chorionic gonadotropin 18) in preparing medicine for treating liver cancer by regulating hepatoma ferroptosis

Abstract

The invention provides application of HCG18 in preparation of a medicine for treating liver cancer by regulating hepatoma ferroptosis. The HCG18 silently promotes accumulation of lipid ROS and Fe < 2 + > in cells, reduces the content of GSH in the cells and enhances cell death induced by erastin at the same time, overexpression of the HCG18 causes remarkable reduction of lipid ROS and Fe < 2 + >, increases the concentration of GSH in the cells and reduces cell death induced by erastin at the same time, and the HCG18 is a competitive binding agent of miR-30a-5p and promotes expression of RRM2 through competitive binding of miR-30a-5p.

Description

Technical Field

[0001] The present invention relates to the field of pharmacy, and in particular to an application of HCG18 in preparing a drug for treating liver cancer by regulating liver cancer ferroptosis. Background Art

[0002] Hepatocellular carcinoma (HCC) is one of the most common malignancies worldwide and the third leading cause of cancer-related death. More than 85% of HCC patients are usually diagnosed in the late stage, resulting in missing the best time for surgery. Currently, chemotherapy and immunotherapy are the most important treatments for patients in the late stage, but their efficacy is still not ideal, with a 5-year survival rate of only 10%.

[0003] Ferroptosis is a unique type of programmed cell death that is iron-dependent and reacts with hydrogen peroxide to produce toxic lipid ROS, ultimately leading to cell death. Noncoding RNA-LncRNAs play a crucial role in tumorigenesis, metastasis, and drug resistance, and certain lncRNAs participate in ferroptosis by acting as competing endogenous RNAs (ceRNAs). Dysregulation of HCG18, a key lncRNA, has been observed in various cancer types and is significantly expressed in different tumor tissues. For example, HCG18 promotes ovarian cancer cell proliferation, migration, and epithelial-mesenchymal transition (EMT) by upregulating TRAF4 / TRAF5 expression. However, the role of HCG18 in ferroptosis and its underlying regulatory mechanisms remain elusive. Summary of the invention

[0004] The purpose of the present invention is to solve the shortcomings of the prior art and to propose an application of HCG18 in the preparation of a drug for treating liver cancer by regulating liver cancer ferroptosis.

[0005] To achieve the above-mentioned purpose, the present invention adopts the following technical scheme: an application of HCG18 in the preparation of a drug for treating hepatocellular carcinoma by regulating liver cancer ferroptosis.

[0006] Preferably, HCG18 silencing promotes intracellular lipid ROS and Fe 2+ The accumulation of erastin and the reduction of intracellular GSH content enhanced erastin-induced cell death.

[0007] Preferably, HCG18 overexpression results in lipid ROS and Fe 2+ The mitochondrial GSH concentration was increased, which significantly reduced the cell death induced by erastin.

[0008] Preferably, HCG18 is used in the preparation of a drug for treating liver cancer by regulating liver cancer ferroptosis through the mechanism of action of the HCG18-miR-30a-5p-RRM2 axis.

[0009] Preferably, HCG18 is a competitive binder of miR-30a-5p, and HCG18 promotes the expression of RRM2 by competitively binding to miR-30a-5p.

[0010] Compared with the prior art, the present invention has the following beneficial effects: HCG18 of the present invention can inhibit ferroptosis and promote HCC proliferation, and HCG18 silencing significantly promotes the expression of intracellular lipid ROS and Fe 2+ HCG18 silencing promotes ferroptosis of HCC cells. On the contrary, HCG18 overexpression leads to the accumulation of lipid ROS and Fe 2+ The ferroptosis of HCC cells was inhibited by HCG18 overexpression. HCG18 is a competitive binder of miR-30a-5p. HCG18 promotes the expression of RRM2 by competitively binding to miR-30a-5p. HCG18 can bind to miR-30a-5p, and miR-30a-5p can bind to RRM2. HCG18 regulates ferroptosis of liver cancer through the mechanism of action of HCG18-miR-30a-5p-RRM2 axis, and is expected to become a potential target for ferroptosis-dependent treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is an in vitro experimental diagram of the use of HCG18 in the preparation of drugs for treating hepatocellular carcinoma by regulating liver cancer ferroptosis, in which knockdown of HCG18 promotes ferroptosis of HCC cells.

[0012] Figure 2 This is an in vitro experimental diagram of the application of HCG18 in the preparation of drugs for treating hepatocellular carcinoma by regulating liver cancer ferroptosis, showing that HCG18 overexpression inhibits liver cancer cell ferroptosis.

[0013] Figure 3 This is a diagram of an animal experiment showing that HCG18 inhibits erastin-induced ferroptosis in vivo, which is used in the preparation of drugs for treating hepatocellular carcinoma by regulating ferroptosis in liver cancer.

[0014] Figure 4 This is a bioinformatics analysis diagram of the mechanism of action of HCG18-miR-30a-5p-RRM2 axis in liver cancer, which is used in the preparation of drugs for treating liver cancer by regulating liver cancer ferroptosis.

[0015] Figure 5 This is a diagram of the regulatory experiment of HCG18-miR-30a-5p-RRM2 in the mechanism of action of HCG18 in the preparation of drugs for treating liver cancer by regulating liver cancer ferroptosis. DETAILED DESCRIPTION

[0016] In order to provide a further understanding of the purpose, structure, features, and functions of the present invention, the following detailed description is given in conjunction with the embodiments.

[0017] Please refer to Figure 1-5 The present invention provides an application of HCG18 in the preparation of a drug for treating liver cancer by regulating liver cancer ferroptosis.

[0018] Primer sequences involved in the following examples: Human HCG18 primer sequences used in qRT-PCR experiments HCG18 Precursor:ATTCTCACTCTGGGGTTGGG; HCG18 post-prime: TGATGTTGGCTGTGGGTTTG; Interference gene sequence involved in the embodiment: Interference sequence of human HCG18 siHCG18 sense strand: AGCUGAAAGUCGACGAAGA; siHCG18 antisense strand: UCUUCGUCGACUUUCAGCU.

[0019] The materials and methods involved in the present invention are as follows:

[0020] (1) Construction of ferroptosis-related ceRNAs network

[0021] Ferroptosis-related genes in the FerrDb database were intersected with differentially expressed mRNAs (DEMs) in HCC to obtain ferroptosis-related DEMs. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis of ferroptosis-related differential genes was performed using the “clusterProfiler” package, aiming to investigate their potential roles and regulatory pathways in HCC. The miTarBase database was used to predict miRNA-mRNA binding sites, and ferroptosis-related miRNAs were obtained. The LncBase and starBase databases were used to predict lncRNA-miRNA binding sites and were deintersected to obtain ferroptosis-related DELs. Cytoscape software (version 3.6.1) was used to visualize the plots. In addition, survival analysis and Pearson correlation analysis were used to determine the regulatory axis, and the selection criteria were set as p value < 0.05 and correlation coefficient > 0.40.

[0022] (2) Cell line experiments

[0023] Tissues and cell lines: The HepG2 cell line (NO. HB-8065) ​​used in this study was obtained from the American Type Culture Collection (ATCC; USA), and the Huh7 cell line (NO. JCRB0403) was purchased from the Japan Research Bioresource Collection (JCRB; Tokyo, Japan). Both HCC cell lines were cultured in Dulbecco's modified EMEM medium with 10% fetal bovine serum (DMEM) supplemented with 10% fetal bovine serum (FBS; HyCyte, China) at 37°C. 1% penicillin-streptomycin (Thermo, USA) was added to the culture medium to avoid cell contamination.

[0024] Cell transfection: Transfection experiments were performed when cells were at 70% to 90% confluence. Lipofectamine 3000 (Invitrogen) and lipofectamine transfection reagent (Hieff Trans) were used for cell transfection according to the manufacturer's instructions. miR-30-5p mimics, small interfering RNA negative control (siNC), and siHCG18 were constructed by GenePharma (Shanghai, China). HCG18 and RRM2 overexpression plasmids were from Genomics Technology (Shanghai, China). All constructs were verified by PCR.

[0025] qRT-PCR: The trizol method was used to extract total RNA from the treated cells, and a reverse transcription kit (Vazyme, Nanjing, China) was used to synthesize cDNA. qRT-PCR experiments were performed using the ChamQ SYBR Green qPCR Master Mix kit (Vazyme, Nanjing, China). The primers used in the study included HCG18, RRM2, and miR-30a-5p.

[0026] Cell viability assay: Cell viability assay was performed by using Cell Counting Kit-8 (CCK-8; C0038, Beyotime). Cells were reseeded into 96-well plates at a density of 5000 cells per well and subsequently treated with erastin for 24 h. Then, 10 μL of CCK-8 solution was added to each well and incubated for another 2 h. The absorbance at 450 nm was measured to evaluate cell viability.

[0027] Lipid ROS detection: Lipid ROS content was quantified using BODIPYTM 581 / 591 C11 (D3861, Thermo) flow cytometry. Cells were counted and 2 × 10 5Cells were seeded in six-well plates at a density of 100 cells / mL and then treated with erastin for 24 hours. Subsequently, the cells were washed twice with PBS and stained with 5µM BODIPYTM 581 / 591 C11. After incubation for 15 minutes, the cells were washed at least three times to remove excess dye and resuspended in fresh PBS (300 mL). The number of fluorescent cells in each sample was measured. Approximately 1×10 cells were analyzed for each sample. 4 The results were analyzed by FlowJo software.

[0028] Intracellular GSH detection method: GSH concentration was measured using a GSH detection kit (ab112132, Abcam). First, cells were counted and re-seeded in a 24-well plate at 2 × 10 4 Cells were incubated overnight. Then, cells were treated with erastin for 24 hours and then stained with Thiol Green dye for 30 minutes. Fluorescence microscopy was used to observe and photograph, and the average fluorescence intensity of luminescent cells was quantitatively analyzed using ImageJ software.

[0029] Iron content determination: The ferrous iron (Fe) content in each sample was quantified using an iron assay kit (TC1015, LEAGENE). 2+ ) concentration. Cells at 10cm 2 The cells were grown in culture dishes at 90% confluence and exposed to erastin for 24 h at 90% confluence. The proteins were extracted and the protein concentration was determined for subsequent calculations. The 96-well plate was washed with dilute hydrochloric acid and deionized water. Then, the mixture containing the protein sample to be tested and the corresponding test reagent was added to the 96-well plate according to the instructions in the user manual. After standing for 15 minutes, the absorbance at 562 nm was measured using a microplate reader over a time range of 1 hour. The Fe content in each sample was calculated. 2+ The blank wells were used to zero and the iron standard (2 μg / mL) wells were used to normalize.

[0030] Dual luciferase reporter assay: Luciferase reporter assay was performed using a luciferase reporter assay kit (ab287865, Abcam) according to the manufacturer’s instructions. To generate HCG18 and RRM2-MT, we used gene mutation technology to change the binding site (AUGUUUAC) to (UACAAAUG), and then cloned the corresponding full-length or mutant forms of complementary DNA (cDNA) into the PGL3-CMV-LUC-MCS vector. The constructs were verified by sequencing. HCC cells were co-transfected with HCG18-WT or MT plasmids and NC or miR-30a-5p mimics. At the same time, RRM2-WT or MT plasmids were co-transfected with NC or miR-30a-5p mimics into HCC cells. Subsequently, cells were lysed using cell lysis buffer, and the relative light units (RLU) of each sample were detected.

[0031] (3) Xenotransplantation experiments

[0032] Experimental animals: BALB / c nude mice used in this study were obtained from the SLRC Laboratory Animal Center (Shanghai, China). Human Huh7 cells (1 × 10 7 cells). Mice were treated with erastin (40 mg / kg) intraperitoneally every 3 days. Tumor volume was recorded every 3 days using the following formula: volume = 1 / 2 (width 2 × length). After 21 days, the mice were euthanized and the subcutaneous tumors were surgically extracted for further study.

[0033] Colony formation assay: 48 hours after transfection, cells were treated with erastin for 24 hours. Subsequently, cells were digested, counted, and re-seeded into 6-well plates in appropriate numbers. After culturing for 2 weeks, cells were fixed with methanol for 15 minutes and stained with 0.4% crystal violet for 30 minutes. The number of colonies was used to reflect the cell proliferation ability.

[0034] Lipid peroxidation malondialdehyde (MDA) assay: The intracellular MDA content was detected using a lipid peroxidation MDA assay kit (Beyotime, China) according to the instructions provided by the manufacturer. Proteins were extracted from mouse tumor tissues using IP cell lysis buffer (P0013, Beyotime). The absorbance was measured at 532 nm.

[0035] Statistical analysis: All experimental data were statistically analyzed using Graphpad Prism (version 8.0) and R statistical software (version 3.6.1). Statistical data are presented as mean ± standard deviation (SD), and each experiment was performed at least three times. The differences between the two groups were compared using a standard t-test, and p values ​​< 0.05 were considered statistically significant.

[0036] like Figure 1 As shown, knockdown of HCG18 promoted ferroptosis in HCC cells.

[0037] Figure 1 a is the cell viability assayed by CCK-8 method. Figure 1 a It can be seen that as the concentration of ferroptosis inducer increases, the cell activity gradually decreases, and the cell activity of siHCG18 HCC cells is lower than that of the blank control group. The results show that knocking down HCG18 promotes erastin-induced cell death; Figure 1 b The lipid ROS level was measured by flow cytometry. Figure 1 b It can be seen that the lipid ROS level of siHCG18 HCC cells is higher than that of siNC control group and blank control group. The results show that the intracellular lipid ROS level of HCG18 silenced cells is high; Figure 1 c is the determination of intracellular Fe by iron detection method 2+ ,Depend on Figure 1 c It can be seen that Fe 2+ The concentration was higher than that of siNC control group and blank control group. The results showed that HCG18 silenced cells with Fe 2+ The concentration is high; Figure 1 d shows the intracellular GSH concentration measured by GSH detection method, the scale bar is 100 μm. Figure 1 d It can be seen that the GSH concentration in HCG18 HCC cells was lower than that in the vehicle control group and the blank control group. The results showed that the GSH content in HCG18 silenced cells was low; The combined results indicate that HCG18 silencing promotes ferroptosis in HCC cells. Figure 1 The control group represents untreated cells, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; ns, not significant.

[0038] like Figure 2 As shown, HCG18 overexpression inhibits ferroptosis in liver cancer cells.

[0039] Figure 2 a is the cell viability assayed by CCK-8 method. Figure 2a It can be seen that as the concentration of ferroptosis inducer increases, the cell activity gradually decreases, and the cell activity of HCG18 HCC cells is higher than that of the vector control group. The results show that overexpression of HCG18 inhibits erastin-induced cell death; Figure 2 b The lipid ROS level was measured by flow cytometry. Figure 2 b It can be seen that the lipid ROS level of HCG18 HCC cells was lower than that of the vehicle control group but higher than that of the blank control group. The results showed that the intracellular lipid ROS level of HCG18 overexpressing cells was low; Figure 2 c is the determination of intracellular Fe by iron detection method 2+ ,Depend on Figure 2 c It can be seen that Fe 2+ The concentration was lower than that of the vector control group and higher than that of the blank control group. The results showed that the intracellular Fe 2+ The concentration is low; Figure 2 d shows the intracellular GSH concentration measured by GSH detection method, the scale bar is 100 μm. Figure 2 d It can be seen that the GSH concentration in HCG18 HCC cells in the Huh7 cell line is higher than that in the vector control group but lower than that in the blank control group, and the GSH concentration in HCG18 HCC cells in the HepG2 cell line is lower than that in both the vector control group and the blank control group. The results show that the content of GSH in cells overexpressing HCG18 is high; The combined results showed that HCG18 overexpression inhibited ferroptosis of HCC cells. Figure 2 The control group represents untreated cells, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0040] like Figure 3 As shown, HCG18 inhibits erastin-induced ferroptosis in vivo.

[0041] Figure 3 a is a clone formation experiment to detect the proliferation ability of Huh7 cells. Figure 3 a It can be seen that the colony-forming ability of LV18-HCG18 HCC cells not treated with erastin is higher than that of the vector control group not treated with erastin, the colony-forming ability of V18-HCG18 HCC cells treated with erastin is higher than that of the vector control group treated with erastin, and the colony-forming ability of the vector control group treated with erastin is lower than that of the vector control group not treated with erastin; Figure 3 b (left) is a schematic diagram of animal experiments. Figure 3 b (right) Comparison of subcutaneous tumor size in nude mice after injection of Huh7 cells stably transfected with vector and LV-HCG18. Figure 3 b (right) It can be seen that the subcutaneous tumors of nude mice injected with LV-HCG18 are larger than those of nude mice in the vehicle control group; Figure 3 c is the change of subcutaneous tumor volume over time in nude mice after injection of Huh7 cells stably transfected with vector or LV-HCG18. Figure 3 c It can be seen that the subcutaneous tumor of nude mice injected with LV-HCG18 grows larger and larger over time, and the growth rate of the subcutaneous tumor of nude mice injected with LV-HCG18 is faster than that of the subcutaneous tumor of nude mice in the vehicle control group; Figure 3 d shows the changes of subcutaneous tumor weight over time in nude mice after injection of Huh7 cells with empty lentivirus or LV-HCG18. Figure 3 d It can be seen that the weight of the subcutaneous tumor of nude mice injected with LV-HCG18 is greater than that of the subcutaneous tumor of nude mice in the vehicle control group; Figure 3 e is the iron detection method to detect Fe 2+ Content, by Figure 3 e It can be seen that the intracellular Fe 2+ The concentration was lower than that of the vehicle control group; Figure 3 f is the lipid peroxidation method to detect the MDA content in the subcutaneous transplanted tumor tissue of nude mice. Figure 3 f It can be seen that the intracellular MDA content of cells injected with LV-HCG18 was lower than that of the vector control group. The results showed that the overexpression of HCG18 led to the increase of MDA and Fe 2+ *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

[0042] like Figure 4 Shown, identification of the HCG18-miR-30a-5p-RRM2 axis in liver cancer.

[0043] Figure 4 a (left) is a Venn diagram of the intersection of differentially expressed mRNAs in GSE69164, GSE77509, and TCGA-LIHC and ferroptosis-related genes in FerrDb. Figure 4 a (right) shows the list of intersecting genes and the high and low expression of genes. Figure 4a (right) It can be seen that ACSL4, AURKA, G6PD, RRM2, NOX4 and SLC7A11 genes are highly expressed, and MTIG and HAPM genes are lowly expressed; Figure 4 bc is the GO and KEGG enrichment analysis of ferroptosis-related genes in liver cancer. The main functions of these related genes involve the cell response to oxidative stress, oxidoreductase activity, glutathione metabolism and oxygen sensor activity, and glutathione metabolism is the main regulatory pathway; Figure 4 d is the intersection of differentially expressed miRNAs in GSE76903 and predicted miRNAs in miTarBase. miR-30a-5p is the only miRNA associated with ferroptosis in HCC; Figure 4 e is the intersection of lncRNAs predicted in LncBase and starbase; Figure 4 f is the ferroptosis-related ceRNA regulatory network in liver cancer, consisting of Figure 4 f It can be seen that OIP5-SA1, PVT1, SNHG16, HCG18 and NEAT1 can affect miR-30a-5p, and miR-30a-5p can affect RRM2; Figure 4 g is the impact of ceRNA network on the overall survival of patients with liver cancer. Figure 4 g It can be seen that HCC patients with high expression of HCG18, SNHG16 or RRM2 have a poor prognosis, while HCC patients with high expression of miR-30a-5p have a longer survival period; Figure 4 h is the Pearson correlation analysis between RRM2-HCG18 and RRM2-SNHC16, and the positive correlation between HCG18 (R=0.41) and RRM2 was higher than that between SNHG16 (R=0.24); Figure 4 i is the potential regulatory relationship diagram among HCG18, miR-30a-5p, and RRM2 genes. Figure 4 i It can be seen that HCG18 promotes the expression of RRM2 by mediating the expression of miR-30a-5p. HCG18 can bind to miR-30a-5p, and miR-30a-5p can bind to RRM2.

[0044] like Figure 5 As shown, miR-30a-5p is involved in the regulation of RRM2 by HCG18.

[0045] Figure 5 a is the potential binding site of miR-30a-5p; Figure 5 b Construction of wild-type and mutant sequences of HCG18 and RRM2 3′UTR; Figure 5 c is the relative expression level of miR-30a-5p in siNC and siHCG18 HCC cells. Figure 5 c It can be seen that the relative expression level of siHCG18 is higher than that of siNC, indicating that after HCG18 silencing, the expression of miR-30a-5p increased significantly; Figure 5 d is the relative expression level of miR-30a-5p in HCC cells of the blank group, HCG18 overexpression group and HCG18-MT group. Figure 5 d It can be seen that the relative expression level of miR-30a-5p in the HCG18 overexpression group was significantly reduced. When HCG18 mutated, its expression returned to normal, indicating that overexpression of HCG18 significantly inhibited the expression of miR-30a-5p in HCC cells; Figure 5 e is a luciferase reporter assay to verify the regulatory relationship between HCG18 and miR-30a-5p in HCC cells. Figure 5 e It can be seen that the luciferase activity of the NC mimic of HCG18-WT is higher than that of the mimic, and the luciferase activity of the NC mimic of RRM2-MT of HCG18-MT is not significantly different from that of the mimic, indicating that after overexpression of miR-30a-5p, the luciferase activity of HCG18 with the wild-type sequence is significantly reduced, while there is no significant effect on the mutant sequence; Figure 5 f Luciferase reporter gene assay verified the regulatory relationship between RRM2 and miR-30a-5p in HCC cells. Figure 5 f It can be seen that the luciferase activity of NC mimics in cells transfected with RRM2-WT is higher than that of miR-30a-5p mimics, and the difference between the luciferase activity of NC mimics and miR-30a-5p mimics in cells transfected with RRM2-MT is not significant, indicating that the activity of luciferase is significantly inhibited in cells containing RRM2-WT plasmid, while there is no significant change in RRM2-MT cells. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; ns, not significant.

[0046] The present invention has been described by the above-mentioned relevant embodiments, however, the above-mentioned embodiments are only examples for implementing the present invention. It must be pointed out that the disclosed embodiments do not limit the scope of the present invention. On the contrary, changes and modifications made without departing from the spirit and scope of the present invention are all within the scope of patent protection of the present invention.

Claims

1. Application of HCG18 in the preparation of drugs for treating liver cancer by regulating liver cancer ferroptosis.

2. The use of HCG18 as claimed in claim 1 in the preparation of a drug for treating liver cancer by regulating liver cancer ferroptosis, characterized in that: HCG18 silencing promotes intracellular lipid ROS and Fe 2+ accumulation, while reducing the intracellular GSH content and enhancing erastin-induced cell death.

3. The use of HCG18 as claimed in claim 1 in the preparation of a drug for treating liver cancer by regulating liver cancer ferroptosis, characterized in that: HCG18 overexpression leads to lipid ROS and Fe 2+ The mitochondrial GSH concentration was increased, which significantly reduced the cell death induced by erastin.

4. Application of HCG18 in the preparation of drugs for treating liver cancer by regulating liver cancer ferroptosis through the mechanism of action of HCG18-miR-30a-5p-RRM2 axis.

5. The use of HCG18 as claimed in claim 4 in the preparation of a drug for treating liver cancer by regulating liver cancer ferroptosis through the mechanism of action of the HCG18-miR-30a-5p-RRM2 axis, characterized in that: HCG18 is a competitive binder of miR-30a-5p. HCG18 promotes the expression of RRM2 by competitively binding to miR-30a-5p.

Images