Application of MLK3 gene as a target in the preparation of drugs for preventing or treating ischemic cerebrovascular disease

Abstract

The present invention belongs to the field of medicine and discloses the use of the MLK3 gene as a target in the preparation of a drug for preventing or treating ischemic cerebrovascular disease. The drug for preventing or treating ischemic cerebrovascular disease contains a component that targets and interferes with the MLK3 gene or its expression. The targeted interference with the MLK3 gene or its expression includes gene destruction, transcription inhibition, translation inhibition, and post-translational protein modification inhibition. Knocking down the MLK3 gene can alleviate oxidative stress, ferroptosis, and phagocytosis in microglia in ischemic cerebrovascular disease, thereby enabling the drug to be used in the preparation of ischemic cerebrovascular disease drugs, with good clinical application value.

Description

Technical Field

[0001] The present invention belongs to the field of medicine, and in particular relates to the use of the MLK3 gene as a target in the preparation of a drug for preventing or treating ischemic cerebrovascular disease. Background Art

[0002] Cerebrovascular disease is a general term for a class of diseases resulting from cerebrovascular lesions that cause brain dysfunction. It encompasses localized or diffuse brain dysfunction caused by various cerebrovascular lesions, including vascular occlusion or stenosis, rupture, vascular malformations, vascular wall damage, or altered permeability. Cerebrovascular disease is primarily categorized as ischemic and hemorrhagic, with ischemic disease accounting for approximately 85% of all cerebrovascular diseases. Ischemic stroke, caused by ischemic cerebrovascular disease, is currently the second leading cause of death in humans. Ischemic cerebrovascular disease has a high incidence, recurrence rate, mortality, and disability rates, resulting in a significant disease burden.

[0003] Damage caused by ischemic cerebrovascular disease (ICD) can extensively affect the entire brain. Different pathogenic mechanisms and affected vessels can lead to damage in different brain regions, resulting in varying symptoms. The brain is primarily composed of white matter and gray matter. Gray matter primarily consists of neuronal cell bodies, while white matter is primarily composed of the myelin sheath that wraps around nerve fibers. In the context of ICD, the clinical manifestations of white matter damage vary significantly: periventricular white matter damage often presents as a cap, fine line, or halo. Smaller cap or punctate forms may be asymptomatic and progress slowly. Deeper white matter damage often presents as a punctate, patchy, or large, fused patch. These lesions progress rapidly and can cause a variety of clinical manifestations, including cognitive impairment, mood swings, gait instability, and urinary incontinence, leading to significant socioeconomic and family challenges.

[0004] Mixed lineage protein kinase 3 (MLK3) is a member of the MLK family of serine / threonine kinases and a member of the mitogen-activated protein kinase kinase kinase (MAP3K) family. It primarily activates the JNK and p38 MAPK pathways by phosphorylating the MAP2Ks MKK4 / 7 and MKK3 / 6, and also directly activates the ERK MAPK pathway. MLK3 plays an important role in cancer cell proliferation, migration, and invasion. Studies have shown that MLK3 exhibits dual functions in breast cancer: promoting cell migration and spread in triple-negative breast cancer (TNBC) and promoting apoptosis in estrogen receptor (ER)- and HER2-positive breast cancers. Furthermore, MLK3-induced apoptosis and ferroptosis can lead to aggravated cardiac hypertrophy and fibrosis, contributing to the progression of chronic heart failure (CHF). However, the biological function and clinical significance of MLK3 in ischemic cerebrovascular disease remain largely unknown.

[0005] Therefore, it is crucial to explore the application of MLK3 gene as a target in the preparation of drugs for preventing or treating ischemic cerebrovascular disease. Summary of the Invention

[0006] The present invention discloses the use of MLK3 gene as a target in the preparation of a medicine for preventing or treating ischemic cerebrovascular disease, which has good clinical application value.

[0007] In order to achieve the above objectives, this application adopts the following technical solutions:

[0008] In a first aspect, the present invention provides the use of the MLK3 gene as a target in the preparation of a drug for preventing or treating ischemic cerebrovascular disease.

[0009] In the above technical solution, the ischemic cerebrovascular disease includes transient ischemic attack, different types of acute ischemic stroke, cerebral artery steal syndrome and chronic cerebral ischemia.

[0010] In the above technical solution, the drug for preventing or treating ischemic cerebrovascular disease contains a component that targets and interferes with the MLK3 gene or its expression.

[0011] In the above technical solutions, the targeted interference with the MLK3 gene or its expression includes gene destruction, transcription inhibition, translation inhibition and post-translational protein modification inhibition.

[0012] In the above technical solution, the gene is destroyed by knocking down the ML K3 gene using recombinant adenovirus AAV-MLK3. The recombinant adenovirus AAV-MLK3 is constructed by inserting mir30 shRNA into the genome of adenovirus AAV, wherein the nucleotide sequence of mir30 shRNA is as shown in SEQ ID No. 1, which is GC TGTAAACAAGTTAACGTTA.

[0013] In the above technical solution, the method for constructing the recombinant adenovirus AAV-MLK3 includes the following steps:

[0014] Step 1. Interference target design and sequence synthesis: Design the target and synthesize the sequence shown in SEQ ID No. 1: GCTGTAAACAAGTTAACGTTA;

[0015] Step 2, preparation of linearized expression vector: the expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases EcoRI and XhoI, with the digestion sites being 1596 (EcoRI) to 1620 (XhoI), and the digestion products were subjected to agarose gel electrophoresis to detect the digestion effect;

[0016] Step 3: The target fragment is connected to the expression vector and transformed into DH5α competent cells;

[0017] Step 4: Pick the transformants grown on the plate and resuspend them in LB culture medium for colony PCR identification;

[0018] Step 5: Sequencing and verifying the positive clones obtained by colony identification. After verifying the correct positive clones, high-purity plasmids were extracted to obtain the recombinant adenovirus AAV-MLK3.

[0019] In the above technical solution, knocking down the MLK3 gene can alleviate the oxidative stress of microglia in ischemic cerebrovascular disease.

[0020] In the above technical scheme, knocking down the MLK3 gene can alleviate the iron death of microglia in ischemic cerebrovascular disease.

[0021] In the above technical scheme, knocking down the MLK3 gene can alleviate the phagocytic level of microglia in ischemic cerebrovascular disease.

[0022] In a second aspect, the present invention provides a drug for preventing or treating ischemic cerebrovascular disease, which contains a component that targets and interferes with the MLK3 gene or its expression.

[0023] The beneficial effects of the present invention are as follows: the present invention creatively discovered the application of the MLK3 gene as a target in the preparation of drugs for preventing or treating ischemic cerebrovascular disease, and knocking down the MLK3 gene alleviates the oxidative stress and ferroptosis and phagocytosis level of microglia in ischemic cerebrovascular disease, so that it can be applied to the preparation of drugs for ischemic cerebrovascular disease, and has good clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Statistical graph of the positive area of ​​MLK3 expression in the BCAS model;

[0025] Figure 2 Statistical graph of MLK3-positive cell area in the BCAS model;

[0026] Figure 3 Statistical graph of MLK3 and pMLK3 expression;

[0027] Figure 4 Statistical graphs of the fluorescence intensities of mitoSOX, FerroOrgance, and C11-BODIPY;

[0028] Figure 5 is the fluorescence intensity statistical graph of 8-OHdG;

[0029] Figure 6 Statistical graph of the fluorescence intensity of 4-HNE. DETAILED DESCRIPTION

[0030] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that this disclosure will be thorough and complete and will fully convey the concept of the present invention to those skilled in the art. The present invention will be limited only by the claims.

[0031] The present invention provides the use of the MLK3 gene as a target in the preparation of a drug for preventing or treating ischemic cerebrovascular disease. Specifically, the drug for preventing or treating ischemic cerebrovascular disease contains a component that targets and interferes with the MLK3 gene or its expression.

[0032] Targeted interference with the MLK3 gene or its expression includes gene destruction, transcription inhibition, translation inhibition, and post-translational protein modification inhibition.

[0033] The gene disruption method is to knock down the MLK3 gene using recombinant adenovirus AAV-MLK3, wherein the recombinant adenovirus AAV-MLK3 is constructed by inserting mir30 shRNA into the genome of the adenovirus AAV, wherein the nucleotide sequence of mir30 shRNA is as shown in SEQ ID No. 1, which is GCTGTAAACAA GTTAACGTTA.

[0034] The method for constructing recombinant adenovirus AAV-MLK3 includes the following steps:

[0035] Step 1. Interference target design and sequence synthesis: Based on the general principles of mir30 shRNA design and the transcript of the MLK3 gene, the target was designed and the sequence shown in SEQ ID No. 1 was synthesized: GCTGT AAACAAGTTAACGTTA.

[0036] Step 2. Preparation of linearized expression vector: The expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases EcoRⅠ and XhoⅠ, with the digestion sites being 1596 (EcoRⅠ) to 1620 (XhoⅠ). The resulting digestion products were subjected to agarose gel electrophoresis to detect the digestion effect.

[0037] Step 3: The target fragment was connected to the expression vector and transformed into DH5α competent cells.

[0038] The ligation reaction system for ligating the target fragment into the expression vector is shown in Table 1, and the ligation is carried out at 16°C overnight.

[0039] Table 1 Ligation reaction system

[0040] Reagents Positive control (ul) Self-linking control (ul) Connector group (ul) Destination fragment 1 - 1 Linearized vector 40ng / ul 3 3 3 10×T4 DNA ligase Buffer 2 2 2 T4 DNA ligase 1 1 1 <![CDATA[Dd H2O]]> Up to 20 Up to 20 Up to 20

[0041] Step 4: Pick the transformants grown on the plate and resuspend them in 10 μl LB culture medium. Take 1 μl as a template for colony PCR identification.

[0042] The reaction system and PCR cycle conditions are as follows:

[0043] PCR reaction solution composition:

[0044]

[0045] PCR reaction conditions:

[0046] 3-Step PCR (30 cycles)

[0047] 94℃ 30sec

[0048] 55℃ or 60℃ 30sec

[0049] 72℃ 1min / kb

[0050] 2-Step PCR (30 cycles)

[0051] 98℃ 10sec

[0052] 68℃ 1min / kb

[0053] Step 5: Sequencing and verifying the positive clones obtained by colony identification. After verifying the correct positive clones, high-purity plasmids were extracted to obtain the recombinant adenovirus AAV-MLK3.

[0054] In addition, in the present invention, the inventors found that knocking down the MLK3 gene can alleviate the oxidative stress of microglia in ischemic cerebrovascular disease, alleviate the ferroptosis of microglia in ischemic cerebrovascular disease, and alleviate the phagocytic level of microglia in ischemic cerebrovascular disease.

[0055] In the present invention, ischemic cerebrovascular disease includes transient ischemic attack, different types of acute ischemic stroke, cerebral artery steal syndrome and chronic cerebral ischemia.

[0056] At the same time, the present invention also provides a drug for preventing or treating ischemic cerebrovascular disease, which contains a component that targets and interferes with the MLK3 gene or its expression.

[0057] Experimental process

[0058] Ischemic cerebrovascular disease mouse model: The present invention uses bilateral common carotid artery stenosis surgery to establish an ischemic cerebrovascular disease mouse model. Specifically, after the mice are anesthetized with isoflurane, the skin is incised along the midline of the neck, the thyroid gland is peeled off, and the mouse trachea and bilateral common carotid arteries are exposed. A microspring with an inner diameter of 0.18mm, a pitch of 0.50mm, and a total length of 2.5mm is wrapped around the bilateral common carotid arteries of the mouse. The incision is closed, the skin is sutured, and cerebral blood flow is monitored. A 40% decrease in cerebral blood flow indicates a successful establishment of a BCAS mouse model. One month is selected as the observation time point for ischemic cerebrovascular disease.

[0059] Example 1 MLK3 expression is upregulated in the ischemic cerebrovascular disease injury area

[0060] Ischemic cerebrovascular disease is accompanied by significant white matter damage, primarily manifested by significant demyelination. dMBP, or damaged myelin basic protein, is abundantly expressed in areas of white matter damage. Frozen brain sections from mice undergoing BCAS modeling for one month were immunostained with antibodies against dMBP and MLK3.

[0061] Specifically, the frozen sections were rewarmed at room temperature and washed with phosphate buffer for 5 minutes. Next, the membrane was permeabilized with Trit on X-100 immunofluorescence permeabilization solution at room temperature for 15 minutes. Subsequently, the specimens were blocked with immunofluorescence rapid blocking solution at room temperature for 15 minutes. After the antibody was diluted and mixed with the primary antibody diluent, 10 μL of the diluent was added to each sample. After incubation at 4°C for 12 hours, the secondary antibody was incubated for one hour at room temperature in the dark. Finally, the sections were sealed and the positive areas of MLK3 and dMBP were observed and counted.

[0062] Figure 1 The results showed that at one month after BCAS modeling, the positive area of ​​MLK3 in the demyelinated area of ​​ischemic cerebrovascular disease increased significantly. This indicates that MLK3 expression is upregulated in the damaged area of ​​ischemic cerebrovascular disease, suggesting that MLK3 may have a suggestive significance for ischemic cerebrovascular disease caused by BCAS.

[0063] Example 2 MLK3 is mainly expressed in microglia in the ischemic cerebrovascular disease injury area

[0064] Demyelination in ischemic cerebrovascular disease is closely related to glial cells. Microglia are immune-active cells that can be activated early during ischemic injury to release inflammatory factors, causing a persistent neuroinflammatory response and damage to white matter neurons. Oligodendrocytes, which wrap around axons and form myelin sheaths in the CNS, undergo apoptosis in large numbers during ischemic injury, making them highly susceptible to damage from inflammatory factors, leading to demyelination in the white matter. Astrocytes are closely associated with the formation of the blood-brain barrier and neuronal synapses.

[0065] Specifically, mouse brain tissue sections were immunofluorescently stained with antibodies against oligodendrocyte protein Olig2 (a marker of primary and mature oligodendrocytes), glial fibrillary acidic protein GFAP (a marker of astrocytes), IBA1 (a marker of microglia), and MLK3.

[0066] Figure 2 The results showed that the number of MLK3+IBA1+ microglia was significantly increased compared with astrocytes and oligodendrocytes, indicating that MLK3 is mainly expressed in microglia in the damaged area of ​​ischemic cerebrovascular disease.

[0067] Microglia were labeled using flow cytometry using dual labeling with CD45-APC and CD11b-FITC. One month after BCAS surgery, mice were anesthetized with isoflurane inhalation. Brain tissue was then removed and isolated. The cells were blocked with Fc-Block and dual labeled with CD45-APC / CD11b-FITC flow cytometry antibodies. The cells were incubated at 4°C for 30 minutes. The resulting cell suspension was filtered through a 40 μm filter into a flow cytometer, ready for loading. Microglial proteins were then extracted for Western blotting. Specifically, the electrophoresis gel was placed in an electrophoresis tank, and electrophoresis buffer was added until the level of the buffer reached the sample wells on the inner side of the two glass plates. After loading the sample, electrophoresis was performed. After electrophoresis, an electrotransfer cartridge was prepared using a transfer mechanism consisting of a "sponge pad-filter paper-gel-PVDF membrane-filter paper-sponge pad." The electrotransfer cartridge was placed in a transfer tank filled with transfer buffer and transferred to a foam box filled with an ice-water mixture. After transfer, remove the NC membrane, wash once in TBST, and block with a universal blocking solution for 15-30 minutes. After blocking, wash three times with TBST for 5 minutes each. Place the membrane in an antibody incubation box containing the primary antibody, label it, and incubate it on a 4°C rocking platform overnight. After incubation, wash the membrane three times with TBST for 5 minutes each. Place the membrane in an antibody incubation box containing the secondary antibody, label it, and incubate it at room temperature for 1 hour. After incubation, wash the membrane three times with TBST for 5 minutes each. After washing, add ECL exposure solution to develop the color in the gel system.

[0068] Figure 3 The results showed that MLK3 expression was elevated on flow-sorted CD45+CD11b+ microglia, and the expression of the activated form of MLK3 (phosphorylated MLK3, pMLK3) was also significantly elevated.

[0069] The above results indicate that MLK3 is highly expressed in microglia in the demyelinated area of ​​ischemic cerebrovascular disease. This suggests that MLK3 may be involved in the neural damage caused by microglia in ischemic cerebrovascular disease. Example 3 Knockdown of MLK3 alleviates oxidative stress and ferroptosis of microglia in ischemic cerebrovascular disease

[0070] Ischemic cerebrovascular disease causes damage to the white matter of the brain, and clinical manifestations vary significantly depending on the distribution of white matter within the brain. Based on this, an in vitro model of white matter damage was constructed. Specifically, the brain tissue of neonatal rats was dissected, minced, digested, and cultured in a 37°C incubator with 5% CO2 for 14 days. Primary microglia were collected and stimulated with 10 μg / ml of exogenous myelin to simulate the in vitro environment of white matter damage.

[0071] Studies have shown that increased mitochondrial complex I activity in microglia is closely related to the occurrence and development of chronic neuroinflammation. Ferropoptosis stimulation can also trigger an inflammatory response in microglia, thereby participating in demyelinating lesions. Increased CI activity will increase the production of ROS in microglia, thereby aggravating neuroinflammation and related neurotoxic damage. mitoSOX is a commonly used cell fluorescent probe and a living cell permeable dye. It can be used to detect changes in intracellular reactive oxygen species (ROS) levels. FerroOrange is a ferrous ion probe that can be used to detect changes in intracellular divalent iron content levels. C11-BODIPY is often used to study lipid peroxidation and antioxidant properties in living cells, or react with hydroxyl radicals to detect ferroptosis.

[0072] Small interfering RNA (siRNA) is a double-stranded RNA with a length of 20-25 nucleotides. It has many biological applications and is currently mainly used to interfere with RNA to achieve the purpose of regulating gene expression (knockdown). Its essence is that siRNA specifically binds to the corresponding mRNA and degrades it, thereby achieving the purpose of blocking the continued translation of mRNA. Specifically,

[0073] Step 1. Prepare reagent 1: Prepare 3.75 μL of transfection reagent lipo3000 and 1.25 μL of culture medium opti-men 12, mix well, and incubate at room temperature for 5 minutes to obtain reagent 1 (volume 125 μL).

[0074] Step 2. Prepare reagent 2: Prepare 5 μL of si-MLK3 or si-NC (control RNA) and 120 μL of culture medium, mix well, and incubate at room temperature for 5 minutes to obtain si-MLK3 reagent (volume 125 μL) or si-NC reagent (volume 125 μL), respectively.

[0075] Step 3. Prepare the transfection system (si-NC system or si-MLK3 system): Add reagent 2 to reagent 1, mix well, and incubate at 37°C for 15 minutes to obtain the si-NC system and si-MLK3 system, respectively.

[0076] Step 4. Transfection: Myelin + si-NC group: Remove primary microglial cells (6-well plates) that have been stimulated with exogenous myelin and add 250 μL of the negative control si-NC system and 1750 μL of 10% FBS high glucose to each well. Myelin + si-MLK3 group: Remove primary microglial cells (6-well plates) that have been stimulated with exogenous myelin and add 250 μL of the si-RNA system and 1750 μL of 10% FBS high glucose solution to knock down MLK3 expression.

[0077] Flow cytometry was used to detect the fluorescence intensity of mitoSOX, FerroOrgance and C11-BO DIPY in microglial cells of each group.

[0078] Figure 4 The results showed that compared with the myelin+si-NC group, the mean fluorescence intensity of mitoSOX, FerroOrgance, and C11-BODIPY staining in the myelin+si-MLK3 group was significantly reduced, suggesting that knockdown of MLK3 helps alleviate oxidative stress and ferroptosis in microglia in ischemic cerebrovascular disease.

[0079] Example 4 Knockdown of MLK3 gene alleviates oxidative stress in microglia in ischemic cerebrovascular disease

[0080] We further knocked down the MLK3 gene in vivo to observe the changes in microglia in ischemic cerebrovascular disease.

[0081] Specifically, 2 weeks before BCAS surgery, Cx3cr1 CreER Mice were injected with 1 μl of AAV bilaterally into the corpus callosum (coordinates: midline ± 1.0 mm; 1.0 mm anterior to bregma; 2.2 mm deep). The final injection volume of virus was 1.0E+10 vg / mouse. Specifically:

[0082] BCAS-AAV-NC group: BCAS mice were injected with negative control AAV-NC;

[0083] BCAS-AAV-MLK3 group: BCAS mice were injected with AAV-MLK3 to knock down the MLK3 gene of mice.

[0084] 8-Hydroxydeoxyguanosine (8-OHdG), a modified form of DNA purine residues induced by reactive oxygen species (ROS), is a sensitive indicator of oxidative DNA damage and a commonly used biomarker of oxidative stress. Immunofluorescence staining of brain tissue sections from mice expressing 8-OHdG and Iba-1 was performed to assess oxidative stress in microglia.

[0085] Figure 5 The results showed that the fluorescence intensity of 8-OHdG was significantly reduced in the BCAS-AAV-MLK3 group compared with the BCAS-AAV-NC group, indicating that knocking down the MLK3 gene can help alleviate oxidative stress in microglia in ischemic cerebrovascular disease.

[0086] Example 5 Knockdown of MLK3 gene alleviates ferroptosis of microglia in ischemic cerebrovascular disease

[0087] 4-Hydroxynonenal (4-HNE) is an important lipid peroxidation marker of ferroptosis and accumulates in large quantities during ferroptosis. Immunofluorescence staining of brain tissue sections from mice with 4-HNE and Iba-1 was performed to measure ferroptosis levels in microglia.

[0088] Figure 6 The results showed that the fluorescence intensity of the BCAS-AAV-MLK3 group was significantly reduced compared with the BCAS-AAV-NC group, indicating that knocking down the MLK3 gene can help alleviate the ferroptosis of microglia in ischemic cerebrovascular disease.

[0089] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will readily appreciate that other variations or modifications based on the above descriptions are possible. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. Use of recombinant adenovirus AAV-MLK3 in the preparation of a drug for preventing or treating ischemic cerebrovascular disease, wherein the recombinant adenovirus AAV-MLK3 is constructed by inserting mir30 shRNA into the genome of the adenovirus AAV, wherein: The nucleotide sequence of mir30 shRNA is shown in SEQ ID No. 1, which is GCTGTAAACAAGTTAACGTTA.

2. The application according to claim 1, characterized in that: The ischemic cerebrovascular diseases include transient ischemic attack, different types of acute ischemic stroke, cerebral artery steal syndrome and chronic cerebral ischemia.

3. The application according to claim 1, characterized in that: The method for constructing the recombinant adenovirus AAV-MLK3 comprises the following steps: Step 1. Interference target design and sequence synthesis: Design the target and synthesize the sequence shown in SEQ ID No. 1: GCTGTAAACAAGTTAACGTTA; Step 2, preparation of linearized expression vector: the expression vector pAAV-CBG-DIO-EGFP-miR30shRNA-WPRE was digested with restriction endonucleases EcoRI and XhoI, with the digestion sites from 1596 (EcoRI) to 1620 (XhoI). The digestion products were subjected to agarose gel electrophoresis to detect the digestion effect; Step 3: The target fragment is connected to the expression vector and transformed into DH5α competent cells; Step 4: Pick the transformants grown on the plate and resuspend them in LB culture medium for colony PCR identification; Step 5: Sequencing and verifying the positive clones obtained by colony identification. After verifying the correct positive clones, high-purity plasmids were extracted to obtain the recombinant adenovirus AAV-MLK3.

4. The application according to claim 1, characterized in that: The recombinant adenovirus AAV-MLK3 knocks down the MLK3 gene, and knocking down the MLK3 gene can alleviate the oxidative stress of microglia in ischemic cerebrovascular disease.

5. The application according to claim 1, characterized in that: The recombinant adenovirus AAV-MLK3 knocks down the MLK3 gene, and knocking down the MLK3 gene can alleviate the iron death of microglial cells in ischemic cerebrovascular disease.

6. The application according to claim 1, characterized in that: The recombinant adenovirus AAV-MLK3 knocks down the MLK3 gene, and knocking down the MLK3 gene can alleviate the phagocytic level of microglia in ischemic cerebrovascular disease.

Images