Application of rice gene in regulating phosphorus homeostasis

Abstract

The application of a rice gene in regulating phosphorus homeostasis, the nucleotide sequence of the rice OsSPL17 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein of the rice OsSPL17 gene is shown as SEQ ID NO. 2. By cloning the rice gene OsSPL17, a transgenic vector is constructed, and OsSPL17 gene overexpression rice and OsSPL17 gene deletion rice are obtained. The phenotypic traits of the transgenic rice are determined, and it is found that compared with the wild type rice, the phosphorus content of the transgenic rice changes, the overexpression rice has a lower phosphorus absorption rate in a high phosphorus environment, and the degree of high phosphorus toxicity of the plant is reduced; and the phosphorus absorption rate of the deletion rice increases in a low phosphorus environment, and the phosphorus utilization rate of the rice is improved. It is shown that the OsSPL17 gene plays an important regulatory function in the phosphorus utilization of the rice, maintains the phosphorus homeostasis of the rice, and is helpful to improve the phosphorus fertilizer utilization rate.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological genetic engineering, and particularly relates to application of a rice gene in regulation of phosphorus homeostasis. BACKGROUND

[0002] Phosphorus is one of the essential macro-nutrients for plant growth, is an important component for constituting proteins, nucleic acids, part of enzyme activity regulating substances, cell structures, etc., affects the energy exchange process of plants, and runs through the whole process of plant growth and development, and plays an indispensable role in plant physiological development and reproductive growth. Phosphorus deficiency in plants will be manifested as obvious slowing of growth speed, small and weak plants, less branching or tillering, dark and dull leaves, and poor root development. Therefore, in agricultural production, application of phosphorus fertilizer is one of the necessary measures for guaranteeing crop yield, and reasonable supplement of phosphorus fertilizer can promote plant growth, enhance the resistance of plants, and achieve the effect of yield increase.

[0003] However, for a long time, the use of phosphorus fertilizer in China has been a problem of abuse, causing ecological pollution such as water eutrophication, and increasing the pressure on the environment and food safety. At present, the phosphorus use efficiency (PUE) of food crops in China is generally low, and the applied phosphorus fertilizer cannot be effectively absorbed and utilized by crops, and the residual phosphorus fertilizer not only wastes the cost but also causes ecological pollution. China is facing the dual challenges of relieving phosphorus fertilizer pollution and increasing crop yield demand. As one of the world's most important food crops, rice is widely planted, but there is a general situation of phosphorus deficiency and excessive application of phosphorus fertilizer in the soil of rice fields. Therefore, it is of great significance to explore phosphorus regulation genes for promoting the phosphorus absorption efficiency of rice and improving PUE.

[0004] Researches show that SPL (Squamosa Promoter-Binding Protein-Like) protein is a kind of multifunctional transcription factor unique to plants, and there are 19 OsSPL genes in rice. The coding proteins of these OsSPL genes all contain a highly conserved SBP domain, which is responsible for binding to the core motif GTAC of the downstream target gene and regulating the expression of the target gene. At present, it has been found that OsSPL genes play an important role in multiple biological processes such as root development, ligule auricle development, plant type and panicle type formation, grain development and stress response in rice, but there is no related report on the application of the genes in regulation of phosphorus absorption and utilization of rice. SUMMARY

[0005] In view of the above problems, the application provides application of a rice OsSPL17 gene in regulating phosphorus absorption. The application proves through experiments that the OsSPL17 gene plays an important regulating function in phosphorus utilization of rice, can maintain phosphorus homeostasis of rice, and is helpful to improve phosphorus fertilizer utilization rate. Meanwhile, two kinds of transgenic rice with phenotypes are provided, and compared with wild-type rice, the rice overexpressing the OsSPL17 gene has a lower phosphorus absorption rate in a high-phosphorus environment, and the degree of high-phosphorus toxicity of the plant is reduced; and the phosphorus absorption rate of the rice lacking the OsSPL17 gene is increased in a low-phosphorus environment, and the phosphorus utilization rate of the rice is improved. In order to achieve the above purpose, the following technical solutions are adopted in the application:

[0006] The application of a rice OsSPL17 gene in regulating phosphorus absorption, wherein the nucleotide sequence of the rice OsSPL17 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded protein of the rice OsSPL17 gene is shown as SEQ ID NO. 2.

[0007] Preferably, the method comprises overexpressing the OsSPL17 gene in rice, and comprises the following steps:

[0008] An expression vector containing the OsSPL17 gene is constructed, the expression vector is transformed into an intermediate bacterium to obtain a positive transformant, the transformant is used to infect rice, and phosphorus-inefficient rice is obtained through screening and crossing.

[0009] Preferably, the method for constructing the expression vector containing the OsSPL17 gene comprises:

[0010] The complete OsSPL17 open reading frame is cloned from total cDNA of rice by using a primer pair OsSPL17-F / R, the OsSPL17 open reading frame is connected with a P-easy blunt plasmid, and a vector containing the OsSPL17 open reading frame is obtained through screening and sequencing verification, and is named as pOsSPL17inP.

[0011] The complete OsSPL17 gene reading frame carrying a restriction enzyme cutting site is amplified from the pOsSPL17inP plasmid by using a primer pair overOsSPL17-F / R, the OsSPL17 gene reading frame is connected with the enzyme-cut pTCK303 plasmid, and an overexpression vector containing the OsSPL17 gene reading frame is obtained through screening and sequencing verification, and is named as OsSPL17-OE.

[0012] Preferably, the phosphorus-efficient rice is obtained by Agrobacterium-mediated method, the OsSPL17-OE vector is transformed into Agrobacterium, positive bacteria are obtained through screening and sequencing verification, and the positive bacteria are used to infect rice callus, and the phosphorus-efficient rice with stable genetic traits is obtained through co-culture, sterile water washing, selection culture, differentiation, rooting, seedling, and propagation.

[0013] Preferably, the method for inhibiting expression of the OsSPL17 gene in rice comprises the following steps:

[0014] The knock-out vector of the OsSPL17 gene is constructed, the knock-out vector is transformed into intermediate bacteria to obtain positive transformants, the transformants are used to infect rice, and the phosphorus-efficient rice is obtained through screening and propagation.

[0015] Preferably, the knock-out vector is constructed based on a target site of the OsSPL17 gene of rice, and the nucleotide sequence of the target site is shown in SEQ ID NO. 3.

[0016] Preferably, the method for constructing the knock-out vector of the OsSPL17 gene comprises:

[0017] The primer pair Cas9-OsSPL17-F / R is designed based on a target site of the OsSPL17 gene of rice, the primer pair Cas9-OsSPL17-F / R is denatured and annealed through PCR to obtain an OsSPL17 gDNA intermediate vector, and the OsSPL17 gDNA intermediate vector is connected with an enzyme-digested AarI-Cas9-PC1300 vector, and the knock-out vector of the OsSPL17 gene is obtained through screening and sequencing verification, and is named as Cas9-OsSPL17.

[0018] Preferably, the phosphorus-efficient rice is obtained by Agrobacterium-mediated method, the Cas9-OsSPL17 vector is transformed into Agrobacterium, positive bacteria are obtained through screening and sequencing verification, and the positive bacteria are used to infect rice callus, and the phosphorus-efficient rice with stable genetic traits is obtained through co-culture, sterile water washing, selection culture, differentiation, rooting, seedling, and propagation.

[0019] Preferably, the primer pair has the sequence of:

[0020] OsSPL17-F: 5'-ATGGCGACCGGCGGCAG-3';

[0021] OsSPL17-R: 5'-CTACAGAGACCAGTTCATGGCATTG-3';

[0022] overOsSPL17-F: 5'-CGGGGTACCATGGCGACCGGCGGCAG-3';

[0023] overOsSPL17-R:5'-GGACTAGTCTACAGAGACCAGTTCATGG-3';

[0024] Cas9-OsSPL17-F:5'-GGCATTGCAGGTCACAATGAACGC-3';

[0025] Cas9-OsSPL17-R:5'-AAACGCGTTCATTGTGACCTGCAA-3';

[0026] Preferably, the multiplication times are no less than two. Multiplication of transgenic materials twice or more can increase the probability of obtaining homozygotes and ensure stable inheritance of plant traits.

[0027] Preferably, the knockout vector is constructed based on the target site of the rice OsSPL17 gene, and the nucleotide sequence of the target site is shown in SEQ ID NO.3.

[0028] Preferably, the method comprises using the OsSPL17 gene and its encoded protein in promoting or inhibiting phosphorus absorption by rice.

[0029] Preferably, the method comprises the use of the OsSPL17 gene and its encoded protein in maintaining phosphorus homeostasis in rice.

[0030] Compared with the prior art, the present invention has the beneficial effect of demonstrating for the first time the role of rice SPL proteins in regulating phosphorus absorption and providing the application of the OsSPL17 gene in promoting or inhibiting phosphorus absorption in rice. The present invention obtained transgenic rice material expressing the OsSPL17 gene and measured the phenotypic traits of the transgenic rice. It was found that compared with wild-type rice, rice overexpressing the OsSPL17 gene had a lower phosphorus absorption rate in high-phosphorus environments, reducing the degree of high-phosphorus toxicity in the plants; whereas rice lacking the OsSPL17 gene had an increased phosphorus absorption rate in low-phosphorus environments, improving the rice's phosphorus utilization efficiency. This suggests that the OsSPL17 gene plays an important regulatory role in rice phosphorus utilization, maintaining phosphorus homeostasis in rice and contributing to improved phosphorus fertilizer utilization efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0033] In the attached figure:

[0034] Figure 1 : The molecular identification results of the OsSPL17 gene overexpressing rice materials obtained in Example 1, wherein ZH11 is the wild-type rice Zhonghua 11, and OE-1 and OE-2 are OsSPL17 gene overexpressing rice materials.

[0035] Figure 2 : The molecular identification results of the OsSPL17 gene-deficient rice materials obtained in Example 2, wherein ZH11 is the wild-type rice Zhonghua 11, and spl17-1 and spl17-2 are OsSPL17 gene-deficient expression vector fragments.

[0036] Figure 3 : Symptoms of phosphorus toxicity at the leaf tips of the OsSPL17 overexpressing rice materials (OE-1 and OE-2) obtained in Example 1 and the OsSPL17 gene deletion expressing rice materials (spl17-1 and spl17-2) obtained in Example 2 under high phosphorus (HP) conditions.

[0037] Figure 4 : Total phosphorus concentrations in the OsSPL17 overexpressing rice materials (OE-1 and OE-2) obtained in Example 1 and the OsSPL17 gene deletion expressing rice materials (spl17-1 and spl17-2) obtained in Example 2 under high phosphorus (HP) and low phosphorus (LP) treatments. DETAILED DESCRIPTION

[0038] The following examples are intended to illustrate the present invention but are not intended to limit the scope of the present invention. Any modifications or substitutions to the methods, steps, or conditions of the present invention, without departing from the spirit and substance of the present invention, fall within the scope of protection of the present invention. Unless otherwise specified, the experimental materials, reagents, and instruments used in the examples of the present invention are commercially available; unless otherwise specified, all technical means in the examples of the present invention are conventional means well known to those skilled in the art.

[0039] A rice OsSPL17 gene is used to regulate phosphorus absorption. The nucleotide sequence of the rice OsSPL17 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the rice OsSPL17 gene is shown in SEQ ID NO.2.

[0040] The application includes overexpression of the OsSPL17 gene in rice, comprising the following steps:

[0041] An expression vector containing the OsSPL17 gene was constructed, and the expression vector was transformed into an intermediate bacterium to obtain a positive transformant, which was used to infect rice, and phosphorus-low-efficiency rice was obtained through screening and hybridization.

[0042] The application includes expressing the OsSPL17 gene in rice, comprising the following steps:

[0043] A knockout vector of the OsSPL17 gene was constructed, and the knockout vector was transformed into an intermediate bacterium to obtain a positive transformant, which was used to infect rice, and phosphorus-efficient rice was obtained through screening and hybridization.

[0044] Example 1 Obtaining transgenic phosphorus-low-efficiency rice material

[0045] (1) Total RNA extraction and cDNA synthesis

[0046] Rice seeds were sterilized with 30% NaClO and germinated with warm water. When the rice plants reached two leaves and one bud, uniformly sized rice plants were selected, the endosperm removed, and the plants were transplanted into 50% IRRI nutrient solution with a pH of 5.5. When the rice reached four leaves and one bud, the culture medium was replaced with IRRI complete nutrient solution.

[0047] After one week of cultivation, rice root and leaf samples were collected and quickly frozen in liquid nitrogen. About 0.1 g of the sample was weighed and the total rice DNA was obtained using the Trizol extraction method. The RNA quality was detected by 1.0% agarose gel electrophoresis, and the concentration and purity of the total RNA were detected using a spectrophotometer.

[0048] The qualified total RNA was used for reverse transcription and cDNA was synthesized using the reverse transcription kit of Fermentas.

[0049] (2) Construction of pOsSPL17inP vector

[0050] Using the cDNA obtained in step (1) as a template, the primer pair OsSPL17-F / R was designed and the complete OsSPL17 open reading frame was amplified from the total cDNA of rice by PCR. The PCR product was separated by agarose gel electrophoresis and then recovered by gel cutting to obtain the OsSPL17 open reading frame fragment. The fragment was ligated with the P-easy blunt plasmid vector after enzyme digestion at 16°C overnight by T4 ligase and transformed into Escherichia coli DH5a competent cells. After enrichment of the cells, the cells were smeared on a plate containing 100 μg·mL of kanamycin. -1 After growing on LB solid medium for 12 h, positive colonies were picked and plasmids were extracted. After screening and sequencing verification, a vector containing the open reading frame of OsSPL17 was obtained and named pOsSPL17inP.

[0051] (3) Construction of OsSPL17-OE overexpression vector

[0052] Using the cDNA obtained in step (1) as a template, a primer pair overOsSPL17-F / R was designed, and the complete OsSPL17 gene reading frame was amplified from the pOsSPL17inP plasmid obtained in step (2) by PCR. The PCR product was separated by agarose electrophoresis and then cut and recovered to obtain a fragment of the OsSPL17 gene reading frame carrying the restriction endonuclease sites KpnI and SpeI. The fragment was double-digested with KpnI and SpeI to obtain a linearized pTCK303 plasmid vector and the enzyme-digested PCR fragment by T4 ligase at 16°C overnight, and transformed into Escherichia coli DH5a competent cells. After enrichment of the cells, the cells were smeared on a plate containing 50 μg·mL of kanamycin. -1 After growing on LB solid medium for 12 h, the plasmid was extracted and screened and sequenced to obtain an overexpression vector containing the gene reading frame of OsSPL17, which was named OsSPL17-OE.

[0053] (4) Preparation of transgenic rice materials

[0054] The OsSPL17-OE plasmid was transformed into competent cells of Agrobacterium tumefaciens EHA105 by electroporation and then plated on a plate containing 50 μg·mL of kanamycin and 50 μg·mL of streptomycin. -1 The Agrobacterium was grown on YEP solid medium for 48 h, positive colonies were picked, plasmids were extracted, and double enzyme digestion with KpnI and SpeI was used to verify that the plasmids were correct, thus obtaining Agrobacterium liquid containing OsSPL17-OE plasmid.

[0055] After the peeled rice seeds were disinfected with ethanol and sodium hypochlorite, they were placed on an induction medium and cultured for 5 days to induce callus tissue. The Agrobacterium tumefaciens culture containing the OsSPL17-OE plasmid was first streaked on an alkaline bile salt agar medium and cultured in the dark at 28°C for 3 days. After obtaining a single colony, the single colony was transferred to an AAM culture medium containing acetosyringone and suspended to a bacterial concentration of approximately 0.1 at OD600. The suspended bacterial solution was centrifuged, the culture medium was discarded, and the culture medium was added with 200 μmol·L -1 The cells were collected and prepared into a suspension. The callus was mixed with the suspension for 5 minutes to allow Agrobacterium to infect the callus. The callus was then removed and the suspension was drained. The callus was then placed on a co-cultivation medium and cultured in the dark for 3 days. After the culture was completed, the callus was washed with sterile water and transferred to a selective medium containing different concentrations of carbenicillin and hygromycin for two screenings. The resistant callus obtained by screening was transferred to a differentiation medium for differentiation into seedlings, and then transferred to a rooting medium for seedling growth. The well-differentiated seedlings were hardened for 3-7 days and transplanted to a greenhouse for growth to obtain transgenic seedlings.

[0056] Use hygromycin to quickly detect transgenic seedlings: Cut fresh green leaves about 1 cm long from the leaves of the seedlings to be tested (leave an incision at both ends), place them flat on a culture medium containing hygromycin, and culture at 30°C for 48 hours. Plants with leaves that remain bright green are positive (successful transgenic), while plants with necrosis are negative (failed transgenic). Hygromycin is used to screen positive T0 plants, which are then planted to obtain T0 generation seeds. After the T0 generation seeds germinate, T1 generation transgenic seedlings are obtained, and T1 generation seeds are obtained. The T1 generation seeds are planted on a culture medium containing hygromycin, and homozygous T2 generation transgenic seedlings are screened to obtain transgenic phosphorus-inefficient rice materials.

[0057] (5) Molecular identification of OsSPL17 overexpression lines

[0058] The transgenic phosphorus-inefficient rice material obtained in step (4) was subjected to RNA extraction and cDNA synthesis, and quantitative PCR identification was performed to determine that the expression level of the OsSPL17 gene in rice was much higher than that in wild-type rice Zhonghua 11 ( Figure 1 ), indicating that the T2 transgenic seedlings obtained in step (4) are the OsSPL17 overexpression strains.

[0059] Example 2 Obtaining Transgenic Phosphorus-Efficient Rice Material

[0060] (1) Construction of OsSPL17 gene knockout vector

[0061] According to the sequence of OsSPL17 gene, the target was selected in the third exon of OsSPL17 gene: TTGCAGGTCACAATGAACGC ( Figure 2 ) for gene knockout. According to the target sequence, a primer pair Cas9-OsSPL17-F / R was designed, and the primer pair was denatured and annealed by PCR to obtain the OsSPL17 gDNA fragment. AarI enzyme was used to cut AarI-Cas9-PC1300 and the vector fragment after enzyme cutting was recovered. The OsSPL17 gDNA fragment was connected to the AarI-Cas9-PC1300 vector after AarⅠ enzyme cutting, and the connection product was recovered. The connection product was transformed into Escherichia coli DH5α competent cells, positive colonies were picked, and the plasmid was extracted for DNA sequencing. After screening and sequencing verification, the Cas9-OsSPL17 plasmid, i.e., the OsSPL17 gene knockout vector, was obtained. Among them, the connection, recovery, and screening verification steps are the same as in Example 1.

[0062] (2) Preparation of transgenic rice materials

[0063] The OsSPL17 gene knockout vector was transformed into competent cells of Agrobacterium tumefaciens EHA105 by electroporation. The positive Agrobacterium was used to infect rice callus to obtain OsSPL17 gene knockout material, which was then spread on a plate containing 50 μg·mL of kanamycin and 50 μg·mL of streptomycin.-1 The positive colonies were picked and plasmid was extracted. The plasmid was digested by KpnI and Spel to verify the plasmid. The Agrobacterium containing the plasmid of Cas9-OsSPL17 was obtained.

[0064] The peeled rice seeds were sterilized by ethanol and sodium hypochlorite, and then were placed on the induction medium for 5 days to induce callus. The Agrobacterium containing the plasmid of Cas9-OsSPL17 was streaked on the alkaline bile salt agar medium, and was cultured at 28°C in the dark for 3 days. After obtaining single colonies, the single colonies were transferred to the AAM medium containing acetosyringone, and were suspended to a concentration of OD600 of about 0.1. The suspended liquid was centrifuged, and the culture medium was discarded. The callus was mixed with the suspension liquid containing acetosyringone for 5 minutes to allow the Agrobacterium to infect the callus. Then, the callus was taken out, and the suspension liquid was drained. The callus was placed on the co-culture medium and was cultured in the dark for 3 days. After the culture, the callus was washed with sterile water, and was transferred to the selection medium containing different concentrations of carbenicillin and hygromycin for two times of screening. The resistant callus obtained by screening was transferred to the differentiation medium to differentiate into seedlings, and was transferred to the rooting medium to grow seedlings. The seedlings obtained by differentiation were hardened for 3-7 days, and were transplanted to a greenhouse to grow to obtain transgenic seedlings. -1 The callus was mixed with the suspension liquid containing acetosyringone for 5 minutes to allow the Agrobacterium to infect the callus. Then, the callus was taken out, and the suspension liquid was drained. The callus was placed on the co-culture medium and was cultured in the dark for 3 days. After the culture, the callus was washed with sterile water, and was transferred to the selection medium containing different concentrations of carbenicillin and hygromycin for two times of screening. The resistant callus obtained by screening was transferred to the differentiation medium to differentiate into seedlings, and was transferred to the rooting medium to grow seedlings. The seedlings obtained by differentiation were hardened for 3-7 days, and were transplanted to a greenhouse to grow to obtain transgenic seedlings.

[0065] The transgenic seedlings were rapidly detected by hygromycin. Fresh green leaves of about 1 cm in length were cut from the seedlings to be detected, and were placed on the medium containing hygromycin and were cultured at 30°C for 48 hours. The leaves remained green were positive plants (transgenic success), and the leaves appeared necrosis were negative (transgenic failure). The positive T0 plants were obtained by hygromycin screening, and were planted to obtain T0 generation seeds. The T1 generation transgenic seedlings were obtained after the T0 generation seeds germinated, and T1 generation seeds were obtained. The T1 generation seeds were planted on the medium containing hygromycin, and the homozygous line T2 generation transgenic seedlings were obtained by screening, that is, the transgenic phosphorus-efficient rice material.

[0066] (3) Molecular identification of the OsSPL17 gene deletion line

[0067] The OsSPL17 gene knockout rice material obtained in step (2) and the wild type Zhonghua 11 seedling leaves were taken, and DNA was extracted. The extracted DNA was subjected to PCR amplification using the primer pair Cas9-OsSPL17'-F / R. The obtained amplification product was subjected to sanger first generation sequencing, and the sequencing results were compared with the sequencing results of the Zhonghua 11 amplification product. The comparison results are shown in Table 1. Figure 2As shown, compared with the wild-type rice Zhonghua 11, the OsSPL17 gene knockout rice materials (spl17-1, spl17-2) have successfully inserted bases into the target, interrupting the coding of the OsSPL17 gene and inhibiting the expression of the OsSPL17 gene, confirming that the gene knockout was successful.

[0068] The primer sequences involved in Example 1 and Example 2 are shown in Table 1 below:

[0069] Table 1 Primer sequences

[0070]

[0071] Experimental Example Phenotypic Identification of Transgenic Rice

[0072] (1) Transgenic rice cultivation

[0073] The T2 generation OsSPL17 overexpressing rice transgenic materials (OE-1, OE-2) obtained in Experimental Example 1, the T2 generation OsSPL17 deletion expressing rice transgenic materials (spl17-1, spl17-2) obtained in Experimental Example 2, and the wild-type rice Zhonghua 11 (ZH11) were cultured in high-phosphorus medium and low-phosphorus medium for 7 days, respectively, to obtain the plant materials to be tested.

[0074] (2) Observation of rice symptoms

[0075] Take the plant material obtained from the high phosphorus medium and observe the symptoms of rice leaves. The results are as follows: Figure 3 As shown in Figure 2, the wild-type rice had slightly yellowed leaf tips. Compared to the wild-type rice variety Zhonghua 11 (ZH11), the OsSPL17-overexpressing rice plants (OE-1 and OE-2) obtained in Experimental Example 1 did not show any phosphorus toxicity symptoms such as yellowing and withering leaf tips. However, the OsSPL17-deficient rice plants (spl17-1 and spl17-2) obtained in Experimental Example 2 exhibited obvious phosphorus toxicity symptoms of yellowing and withering leaf tips. This suggests that OsSPL17 maintains phosphorus homeostasis in rice. When this gene is deleted, rice absorbs excessive phosphorus, resulting in toxic symptoms.

[0076] (3) Determination of phosphorus content in rice

[0077] The phosphorus content of rice is determined using a colorimetric method. The specific steps include: washing, drying, and grinding leaves from the plant to be tested. An appropriate amount of plant tissue sample powder is added to a digester and heated for digestion. After cooling, the digestion solution is filtered to obtain a digestion solution. The digestion solution is aspirated, quantitatively diluted, and then a dinitrophenol indicator is added. The solution is neutralized with sodium hydroxide solution until the digestion solution appears slightly yellow. The solution is titrated with a molybdenum antimony solution until the digestion solution appears blue. After sufficient reaction, the absorbance is measured. The phosphorus concentration is calculated using a standard curve, and the total phosphorus content is determined based on the sample size and digestion solution volume.

[0078] The results are as follows Figure 4 Different letters indicate significant differences among treatments within the group (p < 0.05). Under high-phosphorus or low-phosphorus conditions, the phosphorus content of the OsSPL17-overexpressing rice (OE-2) obtained in Experimental Example 1 was significantly lower than that of the wild-type rice control (ZH11), indicating that excessive OsSPL17 expression reduces the efficiency of phosphorus absorption in rice. Under high-phosphorus or low-phosphorus conditions, the OsSPL17-deficient rice (spl17-1 and spl17-2) obtained in Experimental Example 2 exhibited higher phosphorus contents compared to the wild-type rice Zhonghua 11 (ZH11), indicating that OsSPL17 deficiency promotes phosphorus absorption in rice.

[0079] Taken together, these experimental results show that compared to wild-type rice, rice overexpressing the OsSPL17 gene exhibited lower phosphorus uptake in high-phosphorus environments, alleviating the severity of high-phosphorus toxicity. In contrast, rice lacking the OsSPL17 gene exhibited increased phosphorus uptake in low-phosphorus environments, improving phosphorus utilization efficiency. This suggests that the OsSPL17 gene plays an important regulatory role in phosphorus utilization in rice, maintaining phosphorus homeostasis and contributing to improved phosphorus fertilizer utilization efficiency.

[0080] It is understandable that the above embodiments only express the preferred implementation modes of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the patent scope of the present invention. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present invention, the above technical features can be freely combined, and several deformations and improvements can be made, all of which fall within the scope of protection of the present invention. Therefore, all equivalent changes and modifications made to the scope of the claims of the present invention should fall within the scope of coverage of the claims of the present invention.

Claims

1. An application of a rice gene in regulating phosphorus homeostasis, characterized in that: The rice OsSPL17 The nucleotide sequence of the gene is shown in SEQ ID NO.1, rice OsSPL17 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that Make the OsSPL17 Gene overexpression in rice includes the following steps: Build contains OsSPL17 The expression vector of the gene is transformed into an intermediate bacteria to obtain a positive transformant, which is used to infect rice, and after screening and two or more propagation, phosphorus-low-efficiency rice is obtained.

3. The use according to claim 2, characterized in that The construct contains OsSPL17 The gene expression vector comprises the following steps: Cloned rice OsSPL17 Gene open reading frame OsSPL17 The open reading frame was connected to the plasmid and verified by screening and sequencing to obtain OsSPL17 vectors of gene open reading frames; Amplification contains OsSPL17 The vector of the gene open reading frame is obtained by carrying the restriction enzyme cutting site OsSPL17 Gene reading frame OsSPL17 The gene reading frame was connected to the plasmid after enzyme digestion, and the plasmid containing OsSPL17 Gene expression vector.

4. The use according to claim 2, characterized in that The screening comprises the following steps: After the positive transformant is co-cultured with the rice callus, the rice callus is washed with sterile water and then transferred to a culture medium containing antibiotics for selective culture, followed by differentiation, rooting, and seedling hardening.

5. The use according to claim 1, characterized in that Inhibit the OsSPL17 Gene expression in rice includes the following steps: Build OsSPL17 A gene knockout vector is used to transform the knockout vector into an intermediate bacterium to obtain a positive transformant, which is used to infect rice. After screening and two or more propagation cycles, phosphorus-efficient rice is obtained.

6. The use according to claim 5, characterized in that The knockout vector is based on rice OsSPL17 The target site of the gene is constructed, and the nucleotide sequence of the target site is shown in SEQ ID NO.

3.

7. The use according to claim 5, characterized in that The construction OsSPL17 The gene knockout vector comprises the following steps: Primers are designed based on the target site of claim 6, and the primers are denatured and annealed to obtain an intermediate vector, which is connected to the vector after enzyme digestion, and the vector is obtained after screening and sequencing verification. OsSPL17 Gene knockout vector.

8. The use according to claim 5, characterized in that The screening comprises the following steps: After the positive transformant is co-cultured with the rice callus, the rice callus is washed with sterile water and then transferred to a culture medium containing antibiotics for selective culture, followed by differentiation, rooting, and seedling hardening.

9. The use according to claim 1, characterized in that described OsSPL17 The expression levels of the gene and its encoded protein in rice are negatively correlated with rice phosphorus accumulation.

10. The use according to claim 1, characterized in that Including the OsSPL17 Application of genes and their encoded proteins in promoting or inhibiting phosphorus absorption in rice.

11. The use according to claim 1, characterized in that Including the OsSPL17 Application of genes and their encoded proteins in maintaining phosphorus homeostasis in rice.

Images