Application of MrDNAJB13 gene in regulating drought resistance of hairy roots of Medicago truncatula

By constructing a vector overexpressing the MrDNAJB13 gene and transforming alfalfa into clover using Agrobacterium rhizogenes, the problem of low transformation efficiency in existing technologies was solved, significantly improving the drought resistance of the hairy roots of alfalfa and providing an effective means for its gene function research.

CN119930776BActive Publication Date: 2025-10-28LANZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510347066.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-10-28
Estimated Expiration
2045-03-24

AI Technical Summary

Technical Problem

Existing technologies for genetic transformation of alfalfa using Agrobacterium rhizogenes have low transformation efficiency, which limits in-depth research on the function of alfalfa gene, especially the study of the drought resistance of hairy roots under drought stress.

Method used

A vector overexpressing the MrDNAJB13 gene was constructed and transformed into alfalfa using Agrobacterium rhizogenes-mediated transformation to obtain hairy root material overexpressing MrDNAJB13, which significantly improved its drought resistance.

Benefits of technology

This study achieved efficient transformation of hairy roots from alfalfa, significantly increasing root length and fresh weight under drought stress. It provides a faster and simpler transformation method, laying the foundation for research on the function of drought-resistant genes in alfalfa.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119930776B_ABST
    Figure CN119930776B_ABST
Patent Text Reader

Abstract

This invention discloses the application of the MrDNAJB13 gene in regulating the drought resistance of hairy roots in alfalfa beans, belonging to the field of biotechnology. This invention discovers that overexpression of the MrDNAJB13 gene yields hairy roots with enhanced drought resistance. Furthermore, this invention constructs a MrDNAJB13 gene overexpression vector and a hairy root transformation method for alfalfa bean hairy root systems. The transformation method of this invention for alfalfa bean hairy root transformation can serve as a biotechnological means for studying the function of drought-resistant genes in alfalfa beans, and may be extended to other fields, including the study of stress resistance mechanisms, laying the foundation for the verification of alfalfa bean gene function and genetic selection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to the application of the MrDNAJB13 gene in regulating the drought resistance of hairy roots of alfalfa. Background Technology

[0002] Alfalfa (Medicago ruthenica), also known as wild alfalfa, is a plant belonging to the genus Medicago in the family Leguminosae. This plant is mainly distributed in the high mountains, typical grasslands, and desertified steppes of northern China. With its excellent cold and drought resistance, Medicago ruthenica can thrive in cold and arid environments, demonstrating great potential as a high-quality forage resource. Researchers have found that Medicago ruthenica is the only species in the genus Medicago that can survive in harsh environments such as cold, drought, and stony conditions. In terms of adaptability and tolerance, Medicago ruthenica has a significant advantage over alfalfa, making its survival ability in harsh environments particularly outstanding.

[0003] Fern clover exhibits strong resistance to adverse conditions, but research into its resistance mechanisms has largely remained at the cellular and ecophysiological levels. Historical research has focused primarily on its ecological characteristics, geographical distribution, cultivation techniques, genetic diversity, and distant hybridization with alfalfa. Nevertheless, environmental fluctuations impose multiple pressures on the normal growth and development of plants, with drought being particularly critical, profoundly impacting survival, growth, and even distribution. Given the increasing frequency and intensity of drought, further in-depth research at the molecular level, building upon existing morphological and physiological studies, is crucial. This includes identifying drought-related genes and exploring the underlying mechanisms, which has significant scientific and practical value for understanding and improving plant drought tolerance.

[0004] Because Agrobacterium rhizogenes can induce the growth of hairy roots in certain plants, and the Ri plasmid it carries can trigger the formation of hairy roots at damaged sites in plants and promote the production of a large number of secondary metabolites, there are currently some techniques for genetic transformation of alfalfa using Agrobacterium rhizogenes. However, these methods generally have low transformation efficiency and unsatisfactory results, limiting the possibility of in-depth research into the gene function of alfalfa.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the MrDNAJB13 gene in regulating the drought resistance of hairy roots in alfalfa. Transgenic plants obtained by transforming alfalfa plants with the overexpression vector constructed in this invention can significantly improve the drought resistance of hairy roots in alfalfa, which is of great significance for the study of functional genes in alfalfa.

[0007] This invention is implemented as follows:

[0008] In a first aspect, the present invention provides a protein MrDNAJB13 that can improve the drought resistance of plants, the amino acid sequence of which is shown in SEQ ID NO.1.

[0009] In a second aspect, the present invention provides biomaterials related to the aforementioned protein MrDNAJB13, comprising any one of the following (1)-(4):

[0010] (1) The nucleic acid molecule encoding the above protein MrDNAJB13;

[0011] (2) An expression cassette containing the above-mentioned nucleic acid molecules;

[0012] (3) Recombinant vectors containing the above-mentioned nucleic acid molecules or expression cassettes;

[0013] (4) Recombinant microorganisms containing the above-mentioned nucleic acid molecules, expression cassettes or recombinant vectors.

[0014] Thirdly, the present invention provides the application of the above-mentioned protein MrDNAJB13 or biological materials in improving the drought resistance of plants, the application of which includes overexpressing the protein MrDNAJB13 in plants.

[0015] Fourthly, the present invention provides a method for improving the drought resistance of alfalfa hairy roots, comprising:

[0016] Agrobacterium tumefaciens membrane containing the encoding gene of the aforementioned protein MrDNAJB13 was prepared, and the Agrobacterium tumefaciens was transfected into alfalfa seedlings. The seedlings were then subjected to rooting treatment, and drought phenotype identification was performed after rooting. Transgenic plants with improved drought resistance of hairy roots compared with normal alfalfa seedlings were obtained.

[0017] The present invention has the following beneficial effects:

[0018] This invention discovers that overexpression of the MrDNAJB13 gene can yield hairy roots with enhanced drought resistance. Furthermore, this invention constructs a MrDNAJB13 gene overexpression vector and a hairy root transformation method for the alfalfa hairy root system. Experiments show that the transformation method of this invention is faster and simpler than the Agrobacterium tumefaciens-mediated genetic transformation system to obtain transgenic plants. The relative average expression level of overexpressed MrDNAJB13 after drought stress treatment is 5.93 times that of the empty vector, and the root length and fresh weight of the overexpressed transgenic hairy roots obtained after drought stress treatment are significantly higher than those of the empty vector. Therefore, the hairy root transformation of alfalfa using the transformation method of this invention can serve as a biotechnological means for studying the function of drought-resistant genes in alfalfa, and may be extended to other fields, including the study of stress resistance mechanisms, laying the foundation for the verification of alfalfa gene function and genetic selection. Attached Figure Description

[0019] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 This is a morphological image of alfalfa seedlings dipped in Agrobacterium tumefaciens on FA medium in Example 1; Figure 1 (A) is a morphological image of alfalfa seedlings 1 day after being dipped in Agrobacterium tumefaciens, and (B) is a morphological image of alfalfa seedlings 12 days after being dipped in Agrobacterium tumefaciens.

[0021] Figure 2 This is the positive identification result of MrDNAJB13 overexpression in alfalfa in Example 2;

[0022] Figure 3 The relative expression of MrDNAJB13 in alfalfa bean overexpression in Example 2;

[0023] Figure 4 This is a graph showing the overall GFP fluorescence levels in empty vector, overexpressed, and wild-type alfalfa in Example 3.

[0024] Figure 5 This is a cellular-level GFP fluorescence observation diagram of empty vector, overexpressed, and wild-type alfalfa beans in Example 4;

[0025] Figure 6 This is a root length morphology diagram of alfalfa seedlings in Example 5 after treatment on 1 / 2B5 and 300mM Mannitol medium for 10 days. Figure 6(A) is a diagram of root length morphology of alfalfa seedlings after 10 days of treatment on 1 / 2B5 medium; Figure 6 (B) shows the root length morphology of alfalfa seedlings after 10 days of treatment on 300mM Mannitol medium.

[0026] Figure 7 Statistical analysis of root length and fresh weight of alfalfa seedlings in Example 6 after treatment on 1 / 2B5 and 300mM Mannitol medium for 10 days; Figure 7 (A) Statistical analysis of root length of alfalfa seedlings after 10 days of treatment on 1 / 2B5 and 300mM Mannitol medium; Figure 7 (B) Statistical analysis of the fresh weight of alfalfa seedlings after treatment on 1 / 2B5 and 300mM Mannitol medium for 10 days;

[0027] Figure 8 This is a comparison of the hair root results between Example 1 and Comparative Example 1, wherein... Figure 8 (A) shows the hair rooting results of Example 1. Figure 8 (B) shows the rooting results of Comparative Example 1. Detailed Implementation

[0028] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0029] In previous studies, it was discovered that the MrDNAJB13 gene may be involved in the regulation of drought resistance in alfalfa. Based on this, this invention constructed an expression vector capable of overexpressing the MrDNAJB13 gene and transformed it into Agrobacterium. Hairy root materials overexpressing MrDNAJB13 were obtained through Agrobacterium-mediated transformation. The results showed that the drought resistance of the obtained hairy roots overexpressing the MrDNAJB13 gene was improved. Thus, a new application of the alfalfa MrDNAJB13 protein and its encoding gene in improving the drought resistance of alfalfa was obtained.

[0030] The amino acid sequence of the MrDNAJB13 protein described above is shown in SEQ ID NO.1. In some embodiments, to facilitate the purification of the MrDNAJB13 protein, a conventional purification tag can be attached to the amino or carboxyl terminus of the protein with the amino acid sequence shown in SEQ ID NO.1.

[0031] Accordingly, the present invention also provides biological materials related to the aforementioned protein MrDNAJB13, comprising: nucleic acid molecules encoding the aforementioned protein MrDNAJB13.

[0032] The aforementioned nucleic acid molecules can be DNA, such as cDNA, genomic DNA, or recombinant DNA, or RNA, such as mRNA or hnRNA.

[0033] In some embodiments, the above-mentioned nucleic acid molecule is a cDNA molecule or DNA molecule as shown in SEQ ID NO.2; or a cDNA molecule or genomic DNA molecule that has more than 75% identity with the nucleotide sequence shown in SEQ ID NO.2 and encodes the above-mentioned protein MrDNAJB13.

[0034] Those skilled in the art can readily mutate the nucleotide sequence encoding the MrDNAJB13 protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that possess 75% or higher identity to the nucleotide sequence encoding the MrDNAJB13 protein, provided they encode the MrDNAJB13 protein and have the same function, are derived from and are equivalent to the nucleotide sequence of this invention.

[0035] The aforementioned biological material includes an expression cassette containing the aforementioned nucleic acid molecules. This expression cassette is DNA capable of expressing the MrDNAJB13 protein in host cells, and includes, but is not limited to, a promoter and a terminator, and may also include an enhancer. The aforementioned promoter, terminator, and enhancer components can be selected according to actual needs, and the present invention does not limit them.

[0036] Recombinant vectors containing the above-mentioned nucleic acid molecules or expression cassettes can be constructed using existing expression vectors; such expression vectors include, but are not limited to: single-stranded, double-stranded or partially double-stranded nucleic acid molecules; nucleic acid molecules containing one or more free ends, or without free ends (e.g., circular); nucleic acid molecules containing DNA, RNA or both; and other polynucleotide species known in the art.

[0037] The most commonly used vector type is the "plasmid," which is a circular double-stranded DNA loop into which additional DNA fragments can be inserted, for example, through standard molecular cloning techniques. Recombinant expression vectors can contain a form of nucleic acid suitable for expression in host cells, meaning that recombinant expression vectors include one or more regulatory elements that can be selected based on the host cell used for expression and which can be operatively linked to the nucleic acid sequence to be expressed.

[0038] In addition, the aforementioned biological materials also include recombinant microorganisms containing the aforementioned nucleic acid molecules, expression cassettes, or recombinant vectors. These microorganisms can be bacteria or fungi, such as Escherichia coli, yeast, and Agrobacterium; the specific selection can be made according to actual needs, and this invention does not limit this selection.

[0039] Based on the aforementioned MrDNAJB13 protein or the aforementioned biological material, this invention also provides the application of the aforementioned MrDNAJB13 protein or the aforementioned biological material in improving plant drought resistance. Specifically, the DNA molecule encoding the MrDNAJB13 protein is introduced into plants via a recombinant vector containing the DNA molecule encoding the MrDNAJB13 protein, resulting in transgenic hairy roots. Under drought stress, the transgenic hairy roots exhibit higher root length and fresh weight than those of hairy roots transgenic with empty vectors. This demonstrates that the MrDNAJB13 protein and its encoding gene MrDNAJB13 are associated with plant drought resistance and can significantly improve plant drought tolerance.

[0040] Therefore, the present invention also provides a method for improving the drought resistance of alfalfa hairy roots, the steps of which are as follows:

[0041] S1. Prepare Agrobacterium rhizogenes biofilm containing the target gene;

[0042] S2. Prepare alfalfa seedlings;

[0043] S3. Transfect Agrobacterium into alfalfa seeds to induce root growth in seedlings;

[0044] S4. After rooting, conduct drought phenotype identification.

[0045] The method for preparing alfalfa seedlings is as follows: After grinding and breaking the hard kernels of alfalfa seeds, they are disinfected with 20% sodium hypochlorite and then spread on water agar medium. The medium is wrapped with tin foil and placed upright in a refrigerator at 4°C for vernalization for 2-3 days. After that, it is placed in a walk-in incubator at 22°C with a light condition of 16h light / 8h darkness for 1-2 days. When the hypocotyl reaches about 1cm in length, the preparation of alfalfa seedlings is completed.

[0046] The components of the water agar medium in this invention are: 8g agar and 1L distilled water.

[0047] The root transfection process involves two steps: root cutting of alfalfa bean and infection. The root cutting method involves quickly cutting the alfalfa bean 1-3 mm above the root tip using a scalpel. The infection method involves slicing the cut end of the alfalfa bean through the Agrobacterium tumefaciens membrane to collect a small amount of Agrobacterium tumefaciens, then placing it in FA medium, sealing it with sealing film, and incubating it in a walk-in incubator at 22℃ with a 16-hour light / 8-hour dark cycle. The transfection process is complete after 7-8 days of incubation.

[0048] Compared to other alfalfa species such as purple alfalfa, hyacinth bean rooting occurs later and has higher nutrient requirements for the culture medium. Experiments showed that hyacinth bean rooting only occurs on FA medium. Furthermore, hyacinth bean exhibits strong wild-type characteristics, resulting in lower rooting efficiency than purple alfalfa and susceptibility to contamination if not properly treated. To achieve better rooting results, this invention designs the following culture medium specifically for hyacinth bean:

[0049] The FA culture medium used in this invention consists of 20 mL of macroelements (6.16 g MgSO4·7H2O, 4.76 g KH2PO4, 10.72 g Na2HPO4·7H2O, 2.00 g NH4NO3 dissolved in 1 L distilled water); 1 mL of microelements (10 mg MnCl2, 10 mg CuSO4, 10 mg ZnCl2, 10 mg H3BO3, 10 mg Na2MoO4 dissolved in 100 mL distilled water); 1 mL of CaCl2 (13.23 g CaCl2·2H2O dissolved in 100 mL distilled water); 1 mL of ferric citrate (0.05 g ferric citrate dissolved in 100 mL distilled water); 1 mL of 1 mM AIB; ferric citrate and AIB are filtered and sterilized; pH is adjusted to 6.5; and 8 g of plant agar.

[0050] The method for identifying drought phenotype after root development is as follows: when the root length reaches 5-6 cm, select empty vector and overexpressing MrDNAJB13 gene plants with consistent root length and growth vigor, and transfer them to 1 / 2 B5 medium and 300 mM Mannitol medium for drought phenotype identification.

[0051] The components of 1 / 2 B5 medium are: 1.6g B5 medium, 10g sucrose, 10g agar, 1L distilled water, pH adjusted to 5.8, and 400mg / L each of Cef and Tim added.

[0052] The 300mM Mannitol medium consists of the following components: 1.6g B5 medium, 10g sucrose, 54.651g mannitol, 10g agar, 1L distilled water adjusted to pH 5.8, and 400mg / L each of Cef and Tim.

[0053] The above-mentioned method of hairy root transformation of alfalfa can obtain transgenic hairy roots about two weeks after seedling root cutting and infection. This method is characterized by high efficiency, high transformation rate and low time consumption, and can effectively promote the research on functional genes of alfalfa.

[0054] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0055] The methods for obtaining the target gene and constructing the vector involved in the embodiments of the present invention are as follows:

[0056] 1. TOPO Cloning

[0057] The CDS sequence of MrDNA JB13 was extracted using alfalfa transcriptome sequencing results. cDNA from *Alfalfa bean* root was used as a template for candidate gene cloning, and pENTRTM Directional... Complete CDS sequences of 12 candidate genes were cloned using Cloning Kits (Invitrogen, K2400-20) and Phusion high-fidelity enzyme (Thermo Fisher Scientific, F530-S). Primers for gene amplification were designed using DNAMAN software. The primer information is: MrDNAJB13-F: CACCATGGGTGTAGACTACTACAAAATCTTGC-SEQ ID NO.3; MrDNAJB13-R: GGCCGAGGAAGCCAGG-SEQ ID NO.4. The recognition site "CACC" of the PENTR / D-TOPO entry vector was introduced at the 5' end upstream of the primers. The gene cloning reaction system was as follows: 1 μL 10 μM Forward Primer, 1 μL 10 μM Reverse Primer, 10 μL 5×Phusion HF Buffer, 4 μL 2.5 mM dNTP, 0.5 μL Phusion DNA Polymerase, 1 μL cDNA, and ddH2O to a final volume of 50 μL. The reaction procedure is as follows: 98℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 57℃ annealing for 30s, 72℃ extension for 15s / kb, for a total of 35 cycles; 72℃ extension for 5min; 4℃ termination.

[0058] 2. TOPO Connection

[0059] Prepare a 1.5% agarose gel and sequentially spot the amplified target gene into the wells. Perform electrophoresis at a constant current of 135 mA and a voltage of 135 V for 25 min. After electrophoresis, use a gel imaging analysis system (FluorChem FC2, Alpha USA) for image scanning and gel extraction. Cut off the expected target band and place it in a 1.5 mL EP tube. Extract the target band using a gel extraction kit (Tiangen Biotech, China). Refer to the instruction manual for specific procedures. After gel extraction of the PCR product, ligate it with the PENTR / D-TOPO introductory vector. The TOPO ligation system is as follows: 4 μL purified PCR product, 1 μL PENTR / D-TOPO introductory vector, and 1 μL Salt solution; ligation at room temperature (25℃) for 30 min.

[0060] 3. Heat shock method for transforming Escherichia coli

[0061] 1) Take out a centrifuge tube containing 100 μL of competent E. coli DH5α (Tiangen Biotech, China) from a -80℃ freezer and insert it into ice. After the competent cells thaw, add 3 μL of ligation product, mix gently, and incubate on ice for 30 min.

[0062] 2) The competent cells with the added ligation product were heat-shocked at 42°C for 90 seconds, and then quickly transferred to ice and placed for 2 minutes.

[0063] 3) Add 900 μL of sterile LB liquid medium to the centrifuge tube, mix well, and place in a shaker at 37°C and 200 rpm for 1 hour to recover;

[0064] 4) Spread the revived E. coli onto LB solid medium containing Kan, and invert the medium in an incubator at 37°C overnight.

[0065] 5) The grown single clones were streaked on LB solid medium containing Kan and cultured overnight at 37°C.

[0066] 4. TOPO vector colony PCR detection

[0067] Using a sterile white pipette tip, colonies were collected and mixed into the PCR reaction solution. Primers M13-F (CTGTAAAACGACGGCCAG, SEQ ID NO. 5) and M13-R (CAGGAAACAGCTATGAC, SEQ ID NO. 6) were used for PCR. Amplification was performed using a 2×F8FastLong PCR MasterMix (Beijing Aidelai Biotechnology Co., Ltd., PC80). The reaction mixture was as follows: 0.5 μL 10 μM Forward Primer, 0.5 μL 10 μM Reverse Primer, 5 μL 2×F8FastLong PCR MasterMix, colony DNA collected from the white pipette tip, and ddH2O to a final volume of 10 μL. The reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 s, 57℃ annealing for 15 s, 72℃ extension for 10 s / kb, for a total of 35 cycles; 72℃ final extension for 4 min; and termination at 4℃.

[0068] Three clonal colonies suitable for PCR detection were selected and cultured overnight at 37°C and 240 rpm in LB liquid medium containing Kans. The colonies were then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0069] 5. LR connection

[0070] Suitable single clones were selected and cultured overnight at 37°C and 240 rpm in LB liquid medium containing Kans. Plasmid extraction was performed using a plasmid miniprep kit (Tiangen Biotech, China), following the manufacturer's instructions. The LR ligation system was prepared as follows: 1 μL (≤150 ng / μL) PMDC83 expression vector, 1 μL (≤100 ng / μL) PENTR / D-TOPO initiation vector, 2 μL LR enzyme, and 6 μL ddH2O.

[0071] Using LR II Plus Enayme Mix (Invitrogen, 11791-020) was used to perform LR ligation between the introductory vector plasmid and the PMDC83 expression vector. Ligation was performed overnight at 25°C on a PCR instrument.

[0072] After ligation, add 2 μL of 10× Proteinase K Solution to the reaction tube, mix well, and incubate at 37°C for 10 min. Transform the ligation product into *E. coli* DH5α using the method described above. Then, perform colony PCR detection using primers 35S-F: GAGGACCTCGACTCTAGAACTAGT (SEQ ID NO.7) and MrDNAJB13-R: GGCCGAGGAAGCCAGG (SEQ ID NO.4). The PCR reaction system and procedure are the same as in step 4. Pick three suitable clones for PCR detection, shake them, and send them to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Shake the sequenced clones and extract plasmids.

[0073] 6. Transformation of Agrobacterium

[0074] The *Agrobacterium rhizogenes* Ar.Qual (Puente Biotechnology) was transformed using the expression vector plasmid through heat shock. The specific steps are as follows:

[0075] 1) Take the competent cells of *Agrobacterium rhizogenes* stored at -80℃ and place them at room temperature or in your palm for a moment until they partially thaw. When they are in an ice-water mixture, insert them into ice.

[0076] 2) Add 2 μL of plasmid DNA to each 100 μL competent cells, mix quickly and vigorously by hand or by pipetting, and place in ice for 15 min, liquid nitrogen for 5 min, water bath at 37°C for 5 min, and ice bath for 5 min in sequence.

[0077] 3) Remove from the ice bath and let it come to room temperature. Add 700 μL of sterile LB liquid medium and incubate at 28°C with shaking for 2 hours.

[0078] 4) Centrifuge at 6000 rpm for 1 min to collect the bacteria. Take about 100 μL of supernatant, resuspend the bacterial block by pipetting, and spread it on LB solid medium containing Kan and streptomycin resistance. Invert the medium and incubate at 28℃ for 2-3 days.

[0079] 5) The grown single clones were streaked onto LB solid medium containing Kan and streptomycin resistance for propagation, and then cultured overnight at 28°C.

[0080] Colony PCR was performed using primers 35S-F and MrDNAJB13-R, following the same PCR reaction system and procedure as in step 4. Suitable colonies for PCR detection were selected and cultured overnight at 28°C and 200 rpm in LB liquid medium containing Kan and streptomycin resistance. The bacterial culture was then mixed with 50% glycerol at a 1:1 ratio and stored at -80°C for subsequent rooting experiments.

[0081] Example 1

[0082] This example describes the root treatment of alfalfa bean with overexpression of the MrDNAJB13 gene, including the following steps:

[0083] Plant material: 'Zhongke No. 1' flat alfalfa bean.

[0084] (1) Preparation of Agrobacterium rhizogenes mulch with the target gene

[0085] Take 200 μL of the prepared Agrobacterium rhizogenes culture containing empty vector PMDC83 and target gene MrDNAJB13, spread it evenly onto LB solid medium containing the corresponding antibiotic, and incubate at 28°C upside down for two days.

[0086] (2) Preparation of alfalfa seedlings

[0087] ① Seed treatment: Grind the alfalfa seeds to remove the hard kernels, disinfect the seeds with 20% sodium hypochlorite for 10 minutes, rinse them 10 times with sterile water to thoroughly clean them, and evenly spot them on 8% water agar medium in a clean bench.

[0088] ② Seed germination: Wrap the culture medium in aluminum foil and place it upright in a refrigerator at 4℃ for vernalization for 3 days. Then, place it in a walk-in incubator at 22℃ with a light condition of 16h light / 8h darkness for 2 days. When the hypocotyl reaches about 1cm in length, the seedling preparation of alfalfa bean is completed.

[0089] (3) Transfect Agrobacterium into alfalfa beans.

[0090] ① Root cutting of alfalfa: In a clean bench, after sterilizing tweezers, small scissors and scalpel with an inoculator, wait until the temperature returns to normal. Use the scalpel to cut horizontally from left to right about 4cm above the FA square culture medium and remove this part of the culture medium. Then use the scalpel to make 10 vertical and even cuts of about 1cm at the cut. Use tweezers to gently pick up the seedling and use small scissors to quickly cut it 1mm above the root tip to prevent wilting.

[0091] ② Inoculation: Pick up the alfalfa bean with tweezers, then run the cut end across the Agrobacterium rhizogenes membrane to pick up a small amount of Agrobacterium. After picking up a small amount of Agrobacterium, insert it into the notch of the FA square culture medium described in ①. Figure 1 A), wherein the FA culture medium formula includes: 20 mL of macroelements (6.16 g MgSO4·7H2O, 4.76 g KH2PO4, 10.72 g Na2HPO4·7H2O, 2.00 g NH4NO3 dissolved in 1 L distilled water); 1 mL of microelements (10 mg MnCl2, 10 mg CuSO4, 10 mg ZnCl2, 10 mg H3BO3, 10 mg Na2MoO4 dissolved in 100 mL distilled water); 1 mL of CaCl2 (13.23 g CaCl2·2H2O dissolved in 100 mL distilled water); 1 mL of ferric citrate (0.05 g ferric citrate dissolved in 100 mL distilled water); 1 mL of 1 mM AIB, ferric citrate, and AIB were filtered and sterilized. The pH was adjusted to 6.5. 8g of plant agar was added, and the mixture was sealed with 3M sealing film. The mixture was then placed in a walk-in incubator at 22℃ with a light / dark cycle of 16 hours light / 8 hours darkness. After 7 days of culture, the transfection and root development process was complete, and the swollen root cut site of the seedlings could be clearly seen. After 12 days, the root length could reach about 3cm. Figure 1 B).

[0092] Example 2

[0093] Positive identification and expression level determination of MrDNAJB13 overexpression in alfalfa beans

[0094] (1) Positive identification of alfalfa bean overexpression of MrDNAJB13

[0095] Using tweezers, the seedlings were picked up and cut at the swollen root section with small scissors. The cut ends were placed in a 1.5 mL tube containing steel balls and immediately immersed in liquid nitrogen. The sample was then pulverized using a ball mill. DNA extraction was performed using the Tiangen DNA Extraction Kit (see instructions for extraction steps). PCR detection was performed on *Alfalfa* plants exhibiting the phenotype on 1 / 2B5 and 300 mM Mannitol media. The primers used for the PMDC83 empty vector were:

[0096] GFP-F:AGTGGAGAGGGTGAAGGTG-SEQ ID NO.8;

[0097] GFP-R:CTTGTCGGCCATGATGTATA-SEQ ID NO.9;

[0098] Amplification was performed, and the amplified band size was 381 bp.

[0099] The primers used for the MrDNAJB13 gene are:

[0100] 35sF-L1:GAGGACCTCGACTCTAGAACTAGT-SEQ ID NO.7;

[0101] MrDNAJB13-R:GGCCGAGGAAGCCAGG-SEQ ID NO.4;

[0102] Amplification was performed, and the amplified band size was 1044 bp. The identification results are as follows: Figure 2 As shown, the results indicate that all plants are positive.

[0103] (2) Determination of MrDNAJB13 overexpression in alfalfa

[0104] Using tweezers, the seedlings were picked up and cut at the swollen root section with small scissors. They were then placed in a 1.5 mL RNase-Free tube containing sterile steel balls and immediately immersed in liquid nitrogen. The sample was then pulverized using a ball mill. RNA extraction was performed using the Cisco RNA Extraction Kit (see instructions for extraction steps). Reverse transcription was then performed using the Tiangen FastKing One-Step Reverse Transcription Kit (see instructions for experimental methods) to obtain cDNA for qRT-PCR. The relative expression level of MrDNA JB13 in transgenic alfalfa was determined. qRT-PCR was performed on alfalfa plants exhibiting the phenotype on 1 / 2B5 and 300 mM Mannitol media. The primers used were as follows:

[0105] QMrDNAJB13-F:CTTATGAGGTACTTAGTGATCCTG-SEQ ID NO.10;

[0106] QMrDNAJB13-R:GATTGAACCGAAACGATCCA-SEQ ID NO. 11.

[0107] The amplification reaction was performed using the Yugong Biotechnology kit. The reaction mixture consisted of 0.2 μL of 10 μM Forward Primer, 0.2 μL of 10 μM Reverse Primer, 1 μL of cDNA, and 3.6 μL of ddH2O. The PCR amplification program was as follows: pre-denaturation at 95℃ for 30 s, denaturation at 95℃ for 10 s, annealing and extension at 55℃ for 30 s, and 40 cycles of denaturation to annealing and extension. The identification results are as follows: Figure 3 As shown, the expression level of MrDNAJB13 increased in the overexpression lines, and under drought stress, the expression level of MrDNAJB13 further increased.

[0108] Example 3

[0109] Overall GFP fluorescence observation of alfalfa

[0110] Seedlings were picked up with tweezers and cut at approximately 1.5 cm from the root tip using small scissors. They were then immersed in 0.01% Tween 20 solution and vacuum-sealed for 30 minutes. The seedlings were rinsed twice with distilled water, then washed with washing buffer (10 mM Tris-HCl pH 7.2 and 50 mM KCl), and finally rinsed 5-6 times with ddH2O. All procedures were performed on ice. Whole-cell fluorescence of the empty-vector PMDC83, overexpressed MrDNAJB13 gene, and wild-type WT was observed using a research-grade stereofluorescence microscope. The results are as follows: Figure 4 As shown, neither the control nor the WT treated with 300mM Mannitol showed fluorescence, while both the empty vector and the overexpression of the MrDNAJB13 gene showed GFP green fluorescence, indicating that they were all positive plants.

[0111] Example 4

[0112] Observation of GFP fluorescence at the cellular level in alfalfa beans

[0113] Using tweezers, the seedlings were picked up and cut at approximately 1.5 cm from the root tip with small scissors. They were then immersed in 0.01% Tween 20 solution and vacuum-sealed for 30 minutes. The seedlings were rinsed twice with distilled water, then washed with washing buffer (10 mM Tris-HCl pH 7.2 and 50 mM KCl), and finally rinsed 5-6 times with ddH2O. The entire process was performed on ice. GFP fluorescence at the empty PMDC83 vector, overexpressed MrDNAJB13 gene, and wild-type WT cell levels was observed using a laser confocal microscope (inverted). The observation results are as follows: Figure 5 As shown, neither the control nor the WT treated with 300mM Mannitol showed fluorescence, while both the empty vector and the overexpression of the MrDNAJB13 gene showed GFP green fluorescence, indicating that they were all positive plants.

[0114] Example 5

[0115] Phenotypic observation of alfalfa root development

[0116] (1) Preparation of 1 / 2 B5 and 300 mM Mannitol medium

[0117] ① The 1 / 2B5 medium consists of the following components: 1.6g of 1 / 2B5 medium, 10g of sucrose, 10g of agar, 1L of distilled water, pH adjusted to 5.8, and 400mg / L each of Cef and Tim added.

[0118] ②The 300mM Mannitol medium consists of the following components: 1.6g of 1 / 2B5 medium, 10g of sucrose, 54.651g of mannitol, 10g of agar, 1L of distilled water to adjust the pH to 5.8, and 400mg / L each of Cef and Tim.

[0119] (2) Transplant the alfalfa seedlings to 1 / 2 B5 and 300 mM Mannitol medium.

[0120] In a clean bench, after sterilizing tweezers, small scissors, and a scalpel with an inoculation device, and waiting for the temperature to return to normal, use the scalpel to make a horizontal cut from left to right about 4 cm above the top of a 1 / 2 B5 and 300 mM Mannitol square culture medium, removing this portion of the medium. Select seedlings with uniform root length, arranging them so that the root swellings are at the same horizontal level. Note that after placing each seedling, cover the culture dish to prevent wilting. Four replicates each of the empty vector PMDC83 and MrDNAJB13 genes were placed. Figure 6 A), a clear phenotype will appear after 10 days. Figure 6 B) As can be seen from the figure, under drought stress, the rooting and growth of alfalfa bean overexpressing MrDNAJB13 are better.

[0121] Example 6

[0122] Statistical analysis of root length and fresh weight of alfalfa seedlings after 10 days of treatment

[0123] The seedlings were picked up with tweezers and cut at the swollen part of the root with small scissors. The fresh weight of each root was measured on a ten-thousandth-place scale. The length from the swollen part to the root tip was counted using Digimier software. Significance analysis was then performed using SPSS software, and graphs were generated using Origin software. The results are as follows: Figure 7 As shown, the root length and fresh weight of the alfalfa bean group overexpressing MrDNAJB13 were higher, proving that the MrDNAJB13 gene can regulate the drought resistance of the hairy roots of alfalfa bean.

[0124] Comparative Example 1

[0125] The difference between this experiment and Example 1 is that the culture medium used in the infection step is: 8g agar, 1L distilled water, and 1mL 1mM AIB.

[0126] After processing for the same amount of time, the hair rooting results of Example 1 and Comparative Example 1 are compared as follows: Figure 8 As shown in Figure A, the root length is significantly longer, indicating that the rooting effect of different culture media is significantly different, and the culture medium selected in this invention has a better cultivation effect.

[0127] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of protein MrDNAJB13 or related biomaterials in improving plant drought resistance, characterized in that, The amino acid sequence of the protein MrDNAJB13 is shown in SEQ ID NO.1; the application includes overexpression of the protein MrDNAJB13 in a plant, namely alfalfa; The biomaterial is any one of the following (1)-(4): (1) The nucleic acid molecule encoding the protein MrDNAJB13; (2) An expression cassette containing the nucleic acid molecule; (3) A recombinant vector containing the nucleic acid molecule or expression cassette; (4) Recombinant microorganisms containing the nucleic acid molecule, expression cassette or recombinant vector.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

2.

3. A method for improving the drought resistance of alfalfa hairy roots, characterized in that, include: A *Agrobacterium tumefaciens* mulch containing the gene encoding the protein MrDNAJB13 as described in claim 1 was prepared, and the *Agrobacterium tumefaciens* was transfected into *Alfalfa* seedlings. The seedlings were then subjected to rooting treatment, and drought phenotype identification was performed after rooting to obtain transgenic plants with improved drought resistance of hairy roots compared to normal *Alfalfa*.

4. The method according to claim 3, characterized in that, The method for preparing the alfalfa seedlings includes: disinfecting the alfalfa seeds and then spreading them on a water agar medium, then placing them in a refrigerator for vernalization treatment, and then placing them in an incubator for cultivation until the hypocotyl reaches 1 cm in length.

5. The method according to claim 4, characterized in that, The disinfectant used is sodium hypochlorite with a mass concentration of 20%.

6. The method according to claim 4, characterized in that, The vernalization treatment conditions are: temperature 4℃, time 2-3 days.

7. The method according to claim 4, characterized in that, The incubation conditions in the incubator are: temperature 22℃, light exposure time 16 h, and incubation time 1-2 d.

8. The method according to claim 3, characterized in that, The transfection process includes: quickly cutting the root tip 1-3 mm above the root tip, slicing the cut end across the Agrobacterium rhizogenes membrane to collect Agrobacterium, then placing it in FA medium, sealing it with sealing film, and then culturing it in an incubator.

9. The method according to claim 8, characterized in that, The FA medium consists of: MgSO4·7H2O, KH2PO4, Na2HPO4·7H2O, NH4NO3, MnCl2, CuSO4, ZnCl2, H3BO3, Na2MoO4, CaCl2, ferric citrate, AIB and agar, with a pH of 6.

5.

10. The method according to claim 8, characterized in that, The incubation conditions in the incubator are: temperature 22℃, light exposure time 16 h, and incubation time 7-8 d.

11. The method according to claim 3, characterized in that, The drought phenotype identification process included selecting empty vectors and overexpressing vectors with consistent root length and growth vigor when the root length reached 5-6 cm. MrDNAJB13 Genetically modified plants were transferred to 1 / 2 B5 medium and 300 mM Nmitol medium for drought phenotype identification.

12. The method according to claim 11, characterized in that, The components of the 1 / 2 B5 medium are: B5 medium, sucrose, agar, Cef and Tim, adjusted to pH=5.

8.

13. The method according to claim 11, characterized in that, The 300 mM Mannitol medium consisted of B5 medium, sucrose, mannitol, agar, Cef, and Tim, with the pH adjusted to 5.

8.

14. The method for improving the drought resistance of hairy roots of alfalfa as described in any one of claims 3-13 is used in the cultivation of drought-resistant alfalfa.

Citation Information

Patent Citations

  • Target sequence group, vector and method for preparing gene point mutation animal model embryo by using CRISPR-Cas9 system

    CN109679953A

  • Application of OsRSS1 gene in salt stress resistance of rice

    CN117305316A