Esterase mutants, engineered bacteria, and their applications in splitting R,S-2,6-dimethylphenylaminopropionic acid methyl ester

By carrying out amino acid mutation on Burkholderia esterase WZest to construct the esterase mutant WZest-W23T, the problem of insufficient stereoselectivity of esterase was solved, and the efficient separation of R,S-2,6-dimethylphenylaminopropionic acid methyl ester and the preparation of high-purity R-metalaxyl were achieved.

CN119931987BActive Publication Date: 2025-10-03ZHEJIANG UNIV OF TECH
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510066855.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-16
Publication Date
2025-10-03
Estimated Expiration
2045-01-16

AI Technical Summary

Technical Problem

Existing esterases have insufficient stereoselectivity for the splitting of R,S-2,6-dimethylphenylaminopropionic acid methyl ester, making it difficult to efficiently prepare high-purity R-metalaxyl, and the catalytic rate is low.

Method used

By mutating the tryptophan at position 23 of the amino acid sequence of the esterase WZest from Burkholderia to threonine, an esterase mutant WZest-W23T was constructed and expressed in Escherichia coli. It was used as a catalyst to catalyze the hydrolysis reaction of R,S-MAP under specific conditions.

Benefits of technology

High R-selectivity was achieved, with a substrate conversion rate of 44.64%, an optical purity of the product R-2,6-dimethylphenylaminopropionic acid of 94.70%, an enantiomeric selectivity E value of 85.0, and a catalytic rate increase of 35%.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GHA0000015437580000061
    Figure GHA0000015437580000061
  • Figure GHA0000015437580000062
    Figure GHA0000015437580000062
  • Figure GHA0000015437580000071
    Figure GHA0000015437580000071
Patent Text Reader

Abstract

The present invention discloses an esterase mutant, an engineered bacterium, and its application in the splitting of R, S-2, 6-dimethylphenylaminopropionic acid methyl ester. The encoding gene of the esterase mutant provided by the present invention can be cloned and expressed in Escherichia coli. The mutant esterase has high R-selectivity for R, S-2, 6-dimethylphenylaminopropionic acid methyl ester. The mutant esterase WZest-W23T recombinant bacteria wet cell catalyzes the hydrolysis of the substrate. The substrate concentration is 5 g / L. The reaction time is 10 min. The conversion rate of the substrate reaches 44.64%. The ee of the product R-2, 6-dimethylphenylaminopropionic acid is 0. p The value was 94.70%, and the enantiomeric selectivity E value reached 85.0.
Need to check novelty before this filing date? Find Prior Art

Description

(1) Technical field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to an esterase mutant derived from Burkholderia sp. and its application in splitting R,S-2,6-dimethylphenylaminopropionic acid methyl ester. (2) Background technology

[0002] Metalaxyl is an amide agricultural fungicide with bioactivity against downy mildew, phytophthora, and rot fungi. Metalaxyl has two isomers, S and R. While the racemic form is the primary metalaxyl sold commercially, the R-isomer is the primary fungicide, with the R-isomer being 20-30 times more potent than the S-isomer. Producing high-purity R-isomers can reduce the total amount of pesticide released into the environment and minimize the spread of inactive isomers within the biosphere, thereby minimizing potential side effects on non-target organisms. Furthermore, the amount of optically pure metalaxyl produced is half that of the racemic form, facilitating production, transportation, and storage.

[0003] Currently, a large number of chiral compounds are prepared by chemical resolution. Enzymatic resolution of chiral compounds has significant advantages over chemical resolution: (1) Enzyme-catalyzed reactions are typically highly stereospecific. Therefore, the resulting products have high optical purity. (2) Side reactions are rare, yields are high, and product separation and purification are simple. (3) Enzyme-catalyzed reactions are often carried out under very mild conditions, resulting in high production safety.

[0004] Esterases are a class of hydrolases that catalyze the formation and cleavage of ester bonds. They are diverse and widely available, and do not require coenzymes. Furthermore, many esterases exhibit high stereoselectivity for their substrates, leading to their widespread application in the production of food, materials, chemicals, and pharmaceuticals.

[0005] Methyl R,S-2,6-dimethylphenylaminopropionate (R,S-MAP) is an intermediate in the production of the agricultural fungicide R,S-metalaxyl. The chiral pesticide R-metalaxyl can be produced by splitting R,S-MAP. Currently, enzyme catalysts reported for the selective splitting of (R,S)-MAP include: lipases such as Lipase PS (from Burkhloderia cepacia, Amano), Lipase OF (Candida rugose), and Lipase QLM (Alcaligenes sp.); alkaline protease Alcalase (Bacillus licheniformis); acyltransferase Acylase Amano (Aspergillus melleus) (Park O, 2005); and esterases EHest (Achromobacter denitrificans 1104) (Lu Yanan, 2016) and PAE07 (Pseudochrobactrum asaccharolyticum WZZ003) (Yin-Jun Zhang, 2023). Some of these enzymes have R-type stereoselectivity for substrates (such as Lipase PS, EHest and PAE07), and some enzymes have S-type stereoselectivity for substrates (such as Lipozyme RMIM). Domestically disclosed esterase patents that can split R, S-MAP include: CN201510497747.7 (esterase from the genus Achromobacter), CN202010679906.6 (esterase from the genus Pseudochrobactrum). The chiral selectivity of these patented esterases for substrates is R-type. The process route for splitting R, S-MAP to produce R-metalaxyl using R-selective hydrolases is as follows: Figure 1 As shown in (Park O, 2006), the enzyme hydrolyzes R-MAP into R-MAP acid (S-MAP is not hydrolyzed), and then re-esterifies R-MAP acid to form R-MAP, which is then further synthesized into R-metalaxyl. (3) Summary of the invention

[0006] The present invention aims to provide an esterase mutant, an engineered bacterium, and their use in the resolution of R,S-2,6-dimethylphenylaminopropionic acid methyl ester. The wild-type esterase WZest has almost no enantiomeric selectivity for substrates (E value is 1.15). The mutant obtained by modification in the present invention has high R-selectivity, wherein the TE value of the mutant WZest-W23 reaches 85.0, and the catalytic rate is increased by 35%.

[0007] The technical solution adopted in the present invention is:

[0008] The present invention provides an esterase mutant, which is obtained by mutating the 23rd amino acid position of the esterase sequence shown in SEQ ID NO. 2. The esterase (WZest) is derived from Burkholderia sp., and the nucleotide sequence of the encoding gene is shown in SEQ ID NO. 1.

[0009] Furthermore, the esterase mutant is obtained by mutating the tryptophan W at position 23 of the amino acid sequence shown in SEQ ID NO.2 to a threonine T.

[0010] Due to the specificity of amino acid sequences, any fragment or variant of a polypeptide containing the amino acid sequence set forth in SEQ ID NO. 2 or a mutated version thereof, such as a conservative variant, biologically active fragment, or derivative thereof, is protected by the present invention, as long as the fragment or variant shares at least 80% homology with the aforementioned amino acid sequence. Specifically, such alterations may include deletions, insertions, or substitutions of amino acids within the amino acid sequence.

[0011] The present invention also relates to a recombinant expression vector and a recombinant genetically engineered bacterium encoding the esterase mutant or a gene encoding the gene. The recombinant expression vector uses pET28a(+) as a base vector; the recombinant genetically engineered bacterium uses E. coli BL21(DE3) as a host bacterium. The present invention utilizes inverse PCR to construct the mutant recombinant bacterium.

[0012] The present invention also provides an application of the esterase mutant in the preparation of R-2,6-dimethylphenylaminopropionic acid (R,S-MAP) by splitting R-2,6-dimethylphenylaminopropionic acid methyl ester (R,S-MAP). The application method comprises the following steps: using wet bacteria obtained by induction culture of recombinant genetically engineered bacteria expressing the esterase mutant as a catalyst, R-2,6-MAP as a substrate, Tween 80 as a cosolvent, and a pH 7-9 buffer as a reaction medium to form a conversion system, and carrying out a complete reaction at 20-40° C. and 100-300 rpm (preferably 30° C. and 200 rpm) to obtain R-2,6-dimethylphenylaminopropionic acid.

[0013] Furthermore, in the transformation system, the final concentration of wet bacteria added is 10-50 g / L, preferably 20 g / L; the final concentration of substrate added is 2-10 g / L, preferably 5 g / L; and the final concentration of Tween 80 added is 1-5 g / L, preferably 5 g / L.

[0014] Furthermore, the reaction medium is preferably 100 mM sodium phosphate buffer at pH 8.0.

[0015] Furthermore, the catalyst is prepared according to the following method: the recombinant genetically engineered bacteria are inoculated into LB liquid culture medium containing 50 μg / mL kanamycin, and cultured at 37°C and 180 rpm for 12-16 hours to obtain a seed solution; the seed solution is then inoculated into LB liquid culture medium containing 50 μg / mL kanamycin at an inoculum concentration of 1% by volume, and cultured in a constant temperature shaker at 37°C and 200 rpm for 3 hours, IPTG is added to a final concentration of 0.1 mM, and induction is carried out at 24°C and 180 rpm for 12 hours; after the fermentation is completed, the culture is centrifuged at 4°C and 8000 rpm for 10 minutes to obtain wet bacteria.

[0016] The seed culture medium consists of 5.0 g glucose, 0.8 g K2HPO4, 3.0 g KH2PO4, 1.0 g NaCl, 0.4 g MgSO4, and 10.0 mL trace element solution. 800 mL of deionized water was added, and the pH was adjusted to 7.0. The volume was then made up to 1 L with deionized water and sterilized at 115°C for 15 min.

[0017] Trace element solution composition: CoCl2 0.1g / L, MnSO4 0.5g / L, FeSO4.7H2O 0.1g / L, CuSO4 0.1g / L, ZnSO4·7H2O 0.1g / L, H3BO3 0.01g / L, Al2(SO4)3·12H2O 0.01g / L, Na2MoO4·2H2O0.01g / L, EDTA·2Na 1.0g / L, solvent: deionized water; preparation method: Accurately weigh 1.0g EDTA·2Na, dissolve it in 800mL deionized water, then add the remaining components in sequence, and finally add deionized water to make up to 1L;

[0018] Fermentation medium composition: tryptone 15.0 g, yeast powder 5.0 g, NaCl 0.5 g, K2HPO4 1.0 g, MgSO4 1.0 g, KH2PO4 0.8 g, add 800 mL of deionized water, adjust the pH to 7.0, then make up to 1 L with deionized water, and sterilize at 121°C for 20 min.

[0019] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0020] The coding gene of the esterase mutant provided by the present invention can be cloned and expressed in Escherichia coli. The mutant esterase has high R-selectivity for R,S-2,6-dimethylphenylaminopropionic acid methyl ester. The mutant esterase WZest-W23T wet bacteria catalyzes the hydrolysis of the substrate at a substrate concentration of 5g / L and a reaction time of 10min. The conversion rate of the substrate reaches 44.64%, and the ee of the product R-2,6-dimethylphenylaminopropionic acid is 2.3%. p The value was 94.70%, and the enantiomeric selectivity E value reached 85.0. (IV) Description of the accompanying drawings

[0021] Figure 1 , a process route for producing R-metalaxyl by splitting R,S-MAP using R-selective hydrolase.

[0022] Figure 2 , PCR verification of recombinant plasmid; M: Maker; Lane 1: pET-28a(+)-GE04845 recombinant plasmid; Lane 2: pET-28a(+) empty plasmid control; Lane 3: esterase gene fragment.

[0023] Figure 3 , SDS-PAGE of the expression product of the recombinant E. coli BL21(DE3)-pET-28a(+)-GE04845; M: Maker; Lane 1: with IPTG induction; Lane 2: without IPTG induction; Lane 3: empty plasmid control.

[0024] Figure 4 , normal phase HPLC chart of the hydrolysis and resolution of (R,S)-MAP by WZest-W23T recombinant bacteria for 10 minutes. The retention times of R-MAP and S-MAP were 13.2 and 13.8 minutes, respectively.

[0025] Figure 5 , esterase WZest and two esterases with the same application disclosed in domestic patents were compared (yellow indicates identical amino acids).

[0026] Figure 6 Pairwise alignment of the amino acid sequences of esterase WZest with two esterases with the same application that have been published in domestic patents. A: Pairwise alignment with the amino acid sequence of an esterase from the genus Achromobacter; B: Pairwise alignment with the amino acid sequence of an esterase from the genus Pseudochrobactrum. (V) Specific implementation methods

[0027] The present invention is further described below with reference to specific examples, but the scope of protection of the present invention is not limited thereto: the experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and biological materials described are all commercially available unless otherwise specified.

[0028] Burkholderia sp. zjutQ19 was deposited in the China Center for Type Culture Collection on December 6, 2023, with a deposit number of CCTCC NO: M 20232467. The deposit address is Wuhan University, Wuhan, China, with a postal code of 430072. It has been disclosed in patent application 202410233252.2.

[0029] Example 1: Amplification of wild-type esterase WZest gene GE04845 and construction of recombinant genetically engineered bacteria

[0030] 1. Extraction of genomic DNA from Burkholderia sp. CCTCC NO: M 20232467

[0031] Burkholderia sp. CCTCC NO: M 20232467 was inoculated into a seed culture medium and incubated at 30°C, 200 rpm, and a constant temperature shaker for 24 hours to obtain a seed solution. The seed solution was then transferred to a fermentation medium at a 5% volume concentration and incubated at 30°C, 200 rpm, and a constant temperature shaker for 24 hours. The fermentation broth was centrifuged and the wet cells were collected. Genomic DNA from the strain was extracted according to the instructions of the SK8255 column-type bacterial genomic DNA extraction kit.

[0032] The composition of the seed culture medium is as follows: glucose 5.0 g, K2HPO4 0.8 g, KH2PO4 3.0 g, NaCl 1.0 g, MgSO4 0.4 g, trace element solution 10.0 mL, add 800 mL of deionized water, adjust the pH to 7.0, then make up to 1 L with deionized water, and sterilize at 115°C for 15 min.

[0033] Trace element solution composition: CoCl2 0.1g / L, MnSO4 0.5g / L, FeSO4.7H2O 0.1g / L, CuSO4 0.1g / L, ZnSO4·7H2O 0.1g / L, H3BO3 0.01g / L, Al2(SO4)3·12H2O 0.01g / L, Na2MoO4·2H2O0.01g / L, EDTA·2Na 1.0g / L, solvent is deionized water; preparation method: Accurately weigh 1.0g EDTA·2Na, dissolve it in 800mL deionized water, then add the remaining components in sequence, and finally add deionized water to make up to 1L.

[0034] Fermentation medium composition: tryptone 15.0 g, yeast powder 5.0 g, NaCl 0.5 g, K2HPO4 1.0 g, MgSO4 1.0 g, KH2PO4 0.8 g, add 800 mL of deionized water, adjust the pH to 7.0, then make up to 1 L with deionized water, and sterilize at 121°C for 20 min.

[0035] 2. Amplification of gene GE04845 and construction of recombinant genetically engineered bacteria

[0036] Use the genomic DNA extracted in step 1 as a template to amplify the target gene, design specific primers, and insert restriction sites EcoRI and HindIII into the primers. The designed primers are as follows:

[0037] Upstream primer: CGCGGATCCGAATTCGAGATGGAGACGAACGTAACCGC;

[0038] Downstream primer: CGAGTGCGGCCGCAAGCTTGTCAGCTTTTCGCGATATCCG.

[0039] After the PCR reaction was completed, the amplified product was subjected to agarose gel electrophoresis, and there was a clear band at 900 bp, without non-specific bands, which was consistent with the expected size.

[0040] Using AxyPrep TM The target fragment was recovered from the gel using DNA Gel Extraction G Kit. The target fragment and pET28a(+) were double-digested with restriction endonucleases QuickCut EcoRI and QuickCut HindIII (Takara), respectively. The digested target fragment and pET-28a(+) were ligated, and the ligation product was transformed into the host strain E. coli BL21(DE3) to obtain recombinant E. coli BL21(DE3)-pET-28a(+)-GE04845.

[0041] The recombinant E. coli was spread on LB plates containing 50 μg / mL kanamycin and cultured in a 37°C constant temperature incubator overnight. Single colonies from several plates were randomly picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin and cultured at 37°C overnight. The recombinant plasmid was extracted using a plasmid DNA mini kit, double-enzyme digested, and plasmid PCR verification was performed using the pET28a(+) empty vector as a control (see Figure 2 ), a 900bp band was found in lane 3, consistent with expectations. The recombinant plasmid was sequenced, and the sequencing results showed that the recombinant E. coli was successfully constructed.

[0042] LB liquid culture medium composition: 5.0 g yeast powder, 10.0 g tryptone, 10.0 g sodium chloride, add 800 mL deionized water, adjust the pH to 7.0, then dilute to 1 L with deionized water, and sterilize at 121°C for 20 min.

[0043] LB solid medium: Add 20 g / L agar powder to LB liquid medium.

[0044] Example 2: Expression of wild-type recombinant esterase WZest and catalytic performance of the recombinant bacteria

[0045] A single colony of the recombinant E. coli BL21(DE3)-pET-28a(+)-GE04845 grown on a plate in Example 1 was picked and inoculated into 50 ml of LB medium containing 50 μg / mL kanamycin. The culture was carried out at 37°C and 180 rpm for 12 h until the OD value of the bacterial solution reached 0. 600 The inoculum concentration was 0.5-0.8. 50 ml of liquid LB medium containing 50 μg / mL kanamycin was inoculated at a concentration of 1% by volume. Incubate at 37°C, 180 rpm on a constant-temperature shaker for 3 hours. IPTG was added to a final concentration of 0.1 mM and induced at 24°C, 180 rpm for 12 hours. The induced culture was homogenized at 4°C under high pressure and centrifuged at 4°C, 10,000 rpm for 30 minutes. The supernatant and wet cells were used as follows:

[0046] The supernatant was subjected to SDS-PAGE electrophoresis analysis. Figure 3 As shown. Figure 3 It can be seen that after IPTG induction, the recombinant E. coli overexpressed the target protein with a size of about 38 KDa (lane 1), which was consistent with expectations.

[0047] The recombinant bacteria wet cells were used as catalysts to catalyze the hydrolysis of the substrate R,S-MAP. The wet cells were resuspended in 100mM sodium phosphate buffer, pH 8.0, to a concentration of 20g / L. R,S-MAP was added to a final concentration of 5g / L, and Tween 80 was added to a final concentration of 5g / L to form a 10mL reaction system. The reaction was catalyzed at 30°C and 200rpm for 15min. The substrate and product contents were determined by normal phase HPLC. The substrate conversion rate was 49.56%, and the ee was 0.08. p The enantiomeric selectivity E value was 8.21% and 1.15 (almost no enantiomeric selectivity).

[0048] Normal-phase chiral HPLC detection. Mobile phase: n-hexane:isopropanol = 98:2 (with 0.1% trifluoroacetic acid added), flow rate: 0.5 ml / min, UV detection wavelength: 220 nm, column temperature: 30°C, injection volume: 10 μl, chromatographic column: 250 mm × 4 mm, Daicel chiral OD column. Chromatograph: Waters.

[0049] The enantiomeric excess (ee p ), substrate conversion (C) and enantiomeric selectivity (E) are calculated as follows:

[0050]

[0051] Note: In the above formula, [P] R and [P] S Represent the contents of R-MAP acid and S-MAP acid, respectively.s0 and C s Represented as the substrate R, S-MAP concentrations at the initial reaction and time t, respectively.

[0052] Example 3: Screening of esterase WZest mutants and construction of engineered bacteria

[0053] 1. Screening of mutation sites

[0054] The following six amino acid residues were selected for mutation in the wild-type esterase WZest: (1) amino acid residues A22 and M112, which form the esterase's oxygen anion pore. (2) amino acid residues G21 and W23, which are located before and after the oxygen anion pore. (3) H110 and L192. The former is located on a loop near the substrate active site and is the residue preceding the catalytic triad active residue S111. The latter is located on another loop near the substrate's hydrophobic 2,6-dimethylphenyl group. The established mutation library is shown in Table 1.

[0055] Table 1 Esterase WZest mutation modification sites and mutation library

[0056]

[0057] The mutant was constructed by the method of step 2, and the substrate conversion rate and ee of the mutant were detected by the method of Example 1. p The experimental results showed that among the 33 mutants in Table 1, 7 had altered enantioselectivity, of which 4 became R-selective (W23T, A22I, A22V, and L192S) and 3 became S-selective (L192A, G21A, and H110I). Among the 4 R-selective mutants, WZest-W23T had the highest R-selectivity (enantioselectivity E-value of 85). Among the 3 S-selective mutants, WZest-H110I had the highest S-selectivity (E-value of 6.21).

[0058] 2. Construction of the esterase mutant WZest-W23T engineered bacteria

[0059] Plasmids were extracted from the bacterial culture of the esterase WZest engineered strain E. coli BL21(DE3)-pET-28a(+)-GE04845. Reverse-phase PCR was performed using the pET-28a(+)-GE04845 plasmid as a template and a high-fidelity enzyme. The designed primers are shown in Table 2, the PCR reaction system is shown in Table 3, and the reaction procedure is shown in Table 4.

[0060] Table 2. PCR primers for the full plasmid of the W23T site-directed mutant

[0061]

[0062] Note: -F, -R are upstream and downstream primers respectively. The underlined part is the mutation site

[0063] PCR system (50 μL):

[0064] Table 3 PCR reaction system

[0065]

[0066] PCR reaction procedure:

[0067] Table 4 PCR reaction program

[0068]

[0069] In order to avoid the false positive effect of the template plasmid on the transformation, the template DNA needs to be digested before the circularization product. The digestion system is: 40-50μL PCR product, 1μL Dpn I, mix well and react in a constant temperature metal bath at 37℃ for 2h.

[0070] Recombination reaction: Take 2 μL of the Dnp I digested product, add 2 μL of 5× CE II buffer and 1 μL of Extractase II, and bring the volume up to 20 μL with ddH2O. Incubate the reaction in a 37°C metal bath for 30 min, then immediately cool on ice.

[0071] Take 10 μL of the above recombination reaction product and gently mix it with 100 μL of competent E. coli BL21(DE3) medium. Incubate on ice for 30 minutes. Then transfer the mixture to a 42°C water bath, heat shock it for 45 seconds, and quickly place it on ice. Add 900 μL of LB liquid medium and incubate the mixture at 37°C, 200 rpm, for 45-60 minutes. Centrifuge at 5000 rpm for 3 minutes, remove the supernatant, and resuspend the cells. Spread the suspension onto a LB plate containing Kan resistance and incubate it upside down at 37°C for 16-20 hours. A single colony that grows well on the plate is the engineered mutant E. coli BL21(DE3)-pET-28a(+)-GE04845-W23T.

[0072] Example 4: Mutant enzyme WZest-W23T recombinant bacteria catalyzes the hydrolysis of R,S-2,6-dimethylphenylaminopropionic acid methyl ester

[0073] The catalytic performance of the wet cell of the mutant enzyme WZest-W23T recombinant bacteria constructed in Example 3 was determined according to the method and conditions of Example 2.

[0074] The results are shown in Table 5 and Figure 4, indicating that the WZest-W23T mutant recombinant bacteria has high R-selectivity for the substrate, the E value is increased to 85.0, and the catalytic reaction rate is increased by 35% compared with the WZest recombinant bacteria.

[0075] Table 5 Comparison of catalytic performance of the original enzyme WZest and the mutant enzyme WZest-W23T recombinant bacteria on the substrate (R,S)-MAP

[0076]

[0077] *E=1 means no chiral selectivity

[0078] Example 5: Sequence Alignment

[0079] Currently, the relevant esterases available in China for hydrolyzing (R,S)-2,6-dimethylphenylaminopropionic acid methyl ester are: esterase from the genus Achromobacter (CN201510497747.7) and esterase from the genus Pseudochrobactrum (CN202010679906.6).

[0080] The amino acid sequences of esterase WZest were compared with the two esterases reported above. Figure 5 (Multiple Sequence Alignment), Figure 6 (pairwise comparison) and shown in Table 6. The results showed that the identities and similarities of esterase WZest were very low compared with the other two enzymes, indicating that the enzyme is a new esterase.

[0081] Table 6. Pairwise comparison of the amino acid sequences of the recombinant esterase WZest and two known esterases with the same application

[0082]

[0083]

[0084] *The amino acid sequence length of esterase WZest is 294 aa.

[0085] Note: A represents the esterase from Achromobacter; B represents the esterase from Pseudochrobactrum.

Claims

1. An esterase mutant, characterized in that The esterase mutant is obtained by mutating the tryptophan W at position 23 of the amino acid sequence shown in SEQ ID NO.2 to threonine T.

2. A recombinant genetically engineered bacterium containing a gene encoding the esterase mutant according to claim 1.

3. The esterase mutant according to claim 1 is split R,S Preparation of methyl 2,6-dimethylphenylaminopropionate R -Application of 2,6-dimethylphenylaminopropionic acid.

4. The use according to claim 3, characterized in that The application method is: using wet bacteria obtained by induction culture of recombinant genetic engineering bacteria expressing esterase mutants as catalysts, R,S -2,6-dimethylphenylaminopropionic acid methyl ester was used as substrate, Tween 80 was used as cosolvent, pH 7-9 buffer was used as reaction medium to form a conversion system, and the reaction was completed at 20-40 ° C and 100-300 rpm to obtain R -2,6-dimethylphenylaminopropionic acid.

5. The use according to claim 4, characterized in that In the transformation system, the wet bacteria are added to a final concentration of 10-50 g / L; the substrate is added to a final concentration of 2-10 g / L; and Tween 80 is added to a final concentration of 1-5 g / L.

6. The use according to claim 4, characterized in that The reaction medium is 100 mM sodium phosphate buffer at pH 8.

0.

7. The use according to claim 4, characterized in that The catalyst was prepared as follows: the recombinant genetically engineered bacteria were inoculated into LB liquid culture medium containing 50 μg / mL kanamycin, and cultured at 37°C and 180 rpm for 12-16 hours to obtain a seed solution; the seed solution was then inoculated into LB liquid culture medium containing 50 μg / mL kanamycin at an inoculum concentration of 1% by volume, and cultured in a constant temperature shaker at 37°C and 200 rpm for 3 hours, IPTG was added to a final concentration of 0.1 mM, and the culture was induced at 24°C and 180 rpm for 12 hours; after fermentation, the culture was centrifuged at 4°C and 8000 rpm for 10 minutes to obtain wet cells.

Citation Information

Patent Citations

  • A kind of recombinant esterase, encoding gene, carrier, engineering bacteria and application

    CN105112385B

  • An immobilized recombinant esterase and its application in the preparation of R-2,6-dimethylphenylaminopropionic acid

    CN112195170B

  • Burkholderia and application thereof in catalytic chiral resolution

    CN118086121A

  • Method for enzyme-catalysed hydrolysis of polyacrylic acid esters, and esterases used therefor

    CN102159598A

  • Recombinant esterase, encoding gene, engineering bacterium and application of recombinant esterase in resolution of metalaxyl

    CN112143725A