A gene SlLHP1 regulating parthenocarpy in tomatoes, its encoded protein, and its applications.

By knocking out the SlLHP1 gene in tomato using CRISPR/Cas9 gene editing technology, the problem of the impact on the development of tomato flower organs and pollination and fertilization under greenhouse cultivation was solved. This enabled the regulation of parthenocarpy traits in tomatoes, improved the fruit setting rate, and cultivated seedless fruits, providing new breeding resources.

CN119932036BActive Publication Date: 2025-10-31YANGZHOU UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411835830.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-13
Publication Date
2025-10-31
Estimated Expiration
2044-12-13

AI Technical Summary

Technical Problem

In existing technologies, the development of flower organs and pollination and fertilization of tomatoes are affected under greenhouse cultivation, resulting in reduced yield. Furthermore, traditional breeding methods make it difficult to obtain tomato materials with parthenocarpy traits and normal morphology of other organs.

Method used

By knocking out the SlLHP1 gene in tomato using CRISPR/Cas9 gene editing technology, and by designing target sgRNA and constructing the gene knockout vector pToCas9-LHP1, the parthenocarpy trait of tomato was regulated.

Benefits of technology

It improved the fruit setting rate of tomatoes, cultivated seedless fruits, provided new parthenocarpy gene resources and methods, and promoted the application prospects of parthenocarpy breeding of tomatoes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119932036B_ABST
    Figure CN119932036B_ABST
Patent Text Reader

Abstract

This invention discloses a gene SlLHP1 that regulates parthenocarpy in tomatoes, its encoded protein, and its applications. The sequence of the SlLHP1 gene is shown in SEQ ID NO.1. This invention identifies a novel gene SlLHP1 that regulates parthenocarpy in tomatoes. Editing this gene using CRISPR / Cas9 increases the tomato fruit set rate, indicating that the SlLHP1 gene plays a regulatory role in tomato parthenocarpy. Therefore, this invention provides a new gene resource and method for obtaining the parthenocarpy trait in tomatoes, and this method has good application prospects in tomato parthenocarpy breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding of horticultural crops, and in particular relates to a gene SlLHP1 that regulates parthenocarpy in tomatoes, its encoded protein, and its applications. Background Technology

[0002] Parthenocarpy refers to the phenomenon where the ovary produces seedless fruit without pollination and fertilization. This trait not only ensures fruit setting in horticultural plants under adverse conditions such as low temperature and low light, reducing the labor costs associated with the application of exogenous growth regulators, but also makes parthenocarpy fruits highly favored by consumers and processors due to their higher soluble solids content, larger fruit volume, and seedlessness. Tomato (Solanum lycopersicum L.) is one of the most widely cultivated vegetables. Currently, tomato production largely utilizes greenhouse cultivation, but the low light and extreme temperatures within these facilities often affect the development of tomato flower organs and pollination and fertilization, thus reducing tomato yield. Therefore, tomato breeding targeting parthenocarpy is particularly important. However, only a small number of parthenocarpy genes have been successfully located in natural tomato germplasm resources, and these genes often lead to abnormal growth and development of leaves, stems, and fruits, which greatly limits the application of traditional breeding methods in tomato parthenocarpy breeding. Therefore, tomato breeding materials with parthenocarpy traits but unaffected morphology of other organs urgently need to be created.

[0003] Genome editing technologies, exemplified by CRISPR / Cas9, enable precise modification of target sequences, thereby targeted improvement of relevant traits and accelerating the breeding process. Target selection is related to gene editing efficiency and is one of the key factors for the successful implementation of CRISPR / Cas9 technology. Summary of the Invention

[0004] Purpose of the invention: In order to solve the above-mentioned technical problems, the present invention aims to provide a gene for regulating parthenocarpy in tomatoes, SlLHP1. The present invention has identified a new parthenocarpy gene in tomatoes, SlLHP1. Knocking out this gene using CRISPR / Cas9 gene editing technology will increase the fruit setting rate of tomatoes, and therefore has good application prospects in the breeding of parthenocarpy tomato varieties.

[0005] The present invention also provides a protein encoding the gene SlLHP1 that regulates parthenocarpy in tomatoes and its application.

[0006] Technical solution: In order to achieve the above objectives, the present invention provides a gene SlLHP1 for regulating parthenocarpy in tomatoes, the sequence of which is shown in SEQ ID NO.1.

[0007] Furthermore, the primer pair used to amplify the SlLHP1 gene is:

[0008] LHP1-F: ATGAAAGGAGGGAAAACAAGAAT,

[0009] LHP1-R: TCATAGAGACGGATGATGTTGAATATG.

[0010] The amino acid sequence of the protein encoded by the tomato parthenocarpy gene SlLHP1, as described in this invention, is shown in SEQ ID NO.2.

[0011] The gene knockout vector pToCas9-LHP1 that regulates the parthenocarpy gene SlLHP1 in tomatoes described in this invention.

[0012] Furthermore, the gene knockout vector construction method involves designing an sgRNA that recognizes the target site, digesting it with enzymes and ligating it into the pToCas9 vector, and then transforming it to finally obtain the gene knockout vector pToCas9-LHP1.

[0013] Furthermore, the sgRNA at the target site includes target site 1 and target site 2, wherein the sequence of target site 1 is CCGGCACCGGCACCAGCACCAG, and the sequence of target site 2 is TAAGCGTAAGCGCACTCATGGG.

[0014] The application of the gene SlLHP1 or its encoded protein or knockout vector described in this invention in regulating parthenocarpy in tomatoes.

[0015] Furthermore, editing the tomato SlLHP1 gene using CRISPR / Cas9 increased the tomato's fruit set rate.

[0016] The application of the gene SlLHP1, which regulates parthenocarpy in tomatoes, or its encoded protein or knockout vector, as described in this invention, in the breeding of parthenocarpy tomato varieties.

[0017] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0018] This invention utilizes gene editing technology to knock out the SlLHP1 gene. Compared to wild-type non-parthenocarpic tomato varieties, the gene-edited Slhp1 mutant produces seedless fruits. This indicates that the SlLHP1 gene plays a regulatory role in tomato parthenocarpy. Therefore, this invention provides a new gene resource and method for obtaining the parthenocarpic trait in tomatoes, and this method has good application prospects in tomato parthenocarpy breeding. Attached Figure Description

[0019] Figure 1 The spectrum of the pToCas9 vector;

[0020] Figure 2A schematic diagram of the mutant DNA sequence obtained by knocking out the target sequence of the SlLHP1 gene in CRISPR / Cas9.

[0021] Figure 3 The parthenocarpic phenotype of the obtained Sllhp1 mutant line. Detailed Implementation

[0022] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0023] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. Experimental methods not specifically described in the examples are generally performed under standard conditions or as recommended by the manufacturer.

[0024] The tomato variety 'Ailsa Craig' (AC) in this invention (Sun et al. A Ranscriptional Network Promotes Anthocyanin Biosynthesis in Tomato Flesh. Mol Plant, 2020, 13(1): 42-58.) was provided by Yangzhou University.

[0025] In this invention, the various carriers pCE2 TA / Blunt-Zero and pCBC-DT1T2 are all commercially available or publicly disclosed carriers.

[0026] Example 1

[0027] I. Cloning of SlLHP1 and Construction of the pToCas9-LHP1 Vector:

[0028] Using cDNA from the tissue of tomato variety 'Ailsa Craig' (AC) as a template, primers LHP1-F and LHP1-R were designed and cloned using the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme).

[0029] The primer sequences are: LHP1-F: ATGAAAGGAGGGAAAAACAAGAAT and LHP1-R: TCATAGAGACGGATGATGTTGAATATG.

[0030] The reaction mixture consisted of 18 μL ddH₂O, 25 μL buffer, 1 μL dNTP, 2 μL each of forward and reverse primers, 1 μL cDNA, and 1 μL enzyme. The reaction program was as follows: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 15 seconds, 55°C annealing for 15 seconds, 72°C extension for 30 seconds, for a total of 35 cycles; and a final extension at 72°C for 5 minutes. The PCR product was purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme) and ligated into pCE2 TA / Blunt-Zero (Vazyme). The plasmid was sequenced, and the nucleotide sequence of the SlLHP1 gene is shown in SEQ ID No. 1, while the amino acid sequence encoded by this sequence is shown in SEQ ID No. 2.

[0031] Two 22bp target sites were screened from the coding sequence of SlLHP1, and primers were designed. The sequence of target site 1 is CCGGCACCGGCACCAGCACCAG, and the sequence of target site 2 is TAAGCGTAAGCGCACTCATGGG. The corresponding primers were designed as follows: CR-LHP1-F: ATTATTGGTCTCGAAACGCACCGGCACCAGCACCAGCA AACTACACTGTTAGATTC; CR-LHP1-R: ATTATTGGTCTCGTTTGTAAGCGTAAGCG CACTCATGTTTTAGAGCTAGAAATAGC. Using plasmid pCBC-DT1T2 (Addgene, Plasmid #50590) as a template, PCR cloning was performed using 2×Phanta Max Master Mix (Vazyme). The PCR-recovered and purified fragments were ligated into the pToCas9 vector (pToCas9 vector such as...) using the Golden Gate system. Figure 1As shown in SEQ ID No. 3 (synthesized by a biotechnology company), the sequence was obtained from the Golden Gate assay. The specific system was as follows: 2 μL T4 DNA ligase buffer, 1 μL T4 DNA ligase (Promega), 1 μL Bsa I-HF-V2 (NEB), 1 μL PCR-purified fragment, 1 μL pCBC-DT1T2, and 14 μL ddH2O. The ligation product was transformed into *E. coli* Tran s5α competent cells and incubated overnight at 37°C in Kans resistant medium. Positive clones were screened by PCR using the following primers: pToCas9-F: GCAGGCATGCAAGCTTATTGG and pToCas9-Seq-R: CAGCTGGCGAAAGGGG GAT. Positive clones were subjected to Sanger sequencing using the pToCas9-Seq-R primer. After successful sequencing, plasmid was extracted using a plasmid miniprep kit (Takara) and named pToCas9-LHP1. The corresponding Escherichia coli strains were added to glycerol and then flash-frozen in liquid nitrogen at -80°C.

[0032] II. Construction and Detection of Genome Editing Materials:

[0033] The obtained plasmid pToCas9-LHP1 was transformed into Agrobacterium strain LBA4404 (Weidi Biotechnology). Positive clones were screened by PCR using pToCas9-F and pToCas9-Seq-R primers. Positive colonies were used to infect the cotyledons of tomato variety 'A ilsaCraig' (AC). Before infection, the cotyledons underwent pre-culture. The pre-culture process was as follows: Tomato cotyledons from one week after sowing were selected, leaving only the middle section. These were soaked in a pre-culture solution (MS liquid medium + 0.2 mg / L 2,4-D + 0.1 mg / L Kinetin) for 1 hour, blotted dry with filter paper, and then placed on a pre-culture medium (MS solid medium + 1 mg / L IAA + 1.75 mg / L zeatin). One day later, the pre-cultured cotyledons were immersed in Agrobacterium bacterial solution for 15 minutes (OD value of bacterial solution 2.0), and excess bacterial solution was blotted dry with filter paper. The mixture was then cultured for a total of 2 days. Two days later, the cotyledons were transferred to resistance medium (MS solid medium + 1.0 mg / L IAA + 1.75 mg / L zeatin + 75 mg / L kanamycin + 200 mg / L termetidine). After callus formation at the cut site, they were transferred to shoot-forming medium (MS solid medium + 1.0 mg / L zeatin + 50 mg / L kanamycin + 200 mg / L termetidine). Once shoots emerged, they were excised and transferred to rooting medium (MS solid medium + 200 mg / L termetidine). PCR detection of the Cas9 gene in the obtained regenerated plants was performed using primers: Cas9-F: CCACATGATTAAGTTCAGGGGCCAT and Cas9-R: GAGCCTCGTAATCTCGGTGTTC. The PCR products were subjected to agarose gel electrophoresis. Positive plants were further subjected to editing site detection using amplification primer sequences CRLHP1-F: ATGAAAGGAGGGAAAAACAAGAATTCC GATTTG and CRLHP2-R: ATCCACGTGATCCAATGTAGGCAG. Sanger sequencing confirmed successful construction of the mutant plants, yielding 21 successfully edited plants. These 21 plants were used to obtain T1 generation seeds, which were then self-pollinated. PCR was performed again using primers Cas9-F and Cas9-R. Two homozygous T2 generation mutant lines without the Cas9 sequence were selected and named CR-lhp1-1 and CR-lhp1-2, respectively. Their gene editing site sequences are as follows: Figure 2 As shown, CR-lhp1-1 has a 1bp deletion at the first target site, while CR-lhp1-2 has 2bp and 1bp deletions at the first and second target sites, respectively. These base deletions alter the reading frames of CR-lhp1-1 and CR-lhp1-2 at the first target site.

[0034] III. Parthenocarpy Phenotypic Detection:

[0035] Ten plants each of CR-lhp1-1, CR-lhp1-2, and the control 'AC' were cultivated in a glass greenhouse. Emasculation was performed one day before flowering, and the parthenocarpy rate was calculated seven days later. The parthenocarpy rates of CR-lhp1-1 and CR-lhp1-2 were 75.4% and 81.2%, respectively, while that of 'AC' was 0%. Figure 3 As shown, seedless fruits can be obtained after male removal from CR-lhp1-1 and CR-lhp1-2 plants.

[0036] This invention utilizes CRISPR / Cas9 gene editing technology to construct the tomato SlLHP1 mutant and conducts functional studies on the SlLHP1 gene. Experiments demonstrate that tomatoes using the SlLHP1 gene-edited material can produce seedless fruits, indicating that the SlLHP1 gene plays a negative regulatory role in the parthenocarpic trait of tomatoes. The discovery of the SlLHP1 gene function provides a basis for creating parthenocarpic tomato germplasm materials and has promising application prospects.

Claims

1. A gene regulating parthenocarpy in tomatoes SlLHP1 Its characteristics are, The gene SlLHP1 The sequence is shown in SEQ ID NO.

1.

2. A gene for regulating parthenocarpy in tomatoes as described in claim 1 SlLHP1 The encoded protein is characterized by, The amino acid sequence is shown in SEQ ID NO.

2.

3. A gene for regulating parthenocarpy in tomatoes as described in claim 1 SlLHP1 gene knockout vector pToCas9- LHP1 The gene knockout vector construction method involves designing an sgRNA that recognizes the target site, digesting it with enzymes and ligating it into a pToCas9 vector, followed by transformation to obtain the final gene knockout vector. pToCas9-LHP1 The sgRNA at the target site includes target site 1 and target site 2. The sequence of target site 1 is CCGGCACCGGCACCAGCACCAG, and the sequence of target site 2 is TAAGCGTAAGCGCACTCATGGG.

4. A method for knocking out the gene described in claim 1 SlLHP1 Or the application of the knockout vector as described in claim 3 in improving the parthenocarpy rate of tomatoes.

5. The application according to claim 4, characterized in that, Editing tomatoes with CRISPR / Cas9 SlLHP1 Genes that increase the parthenocarpy rate of tomatoes.

6. A method for regulating parthenocarpy in tomatoes by knocking out the gene described in claim 1. SlLHP1 Or the application of the knockout vector as described in claim 3 in the cultivation of parthenocarpic tomato varieties.

Citation Information

Patent Citations

  • Mycobacterium tuberculosis specific fusion protein, and encoding gene and application thereof

    CN105524177A

  • Corn plant height regulation and high temperature stress response related protein ZmLHP1 and application thereof

    CN117947087A