Gypenoside GpERF gene, recombinant vector, preparation method and application thereof

Abstract

The application discloses a gynostemma pentaphyllum GpERF gene, a recombinant vector, a preparation method and application thereof, and the sequence of the gynostemma pentaphyllum GpERF gene is shown as SEQ ID NO. 1. The application further provides a recombinant vector of the gynostemma pentaphyllum GpERF gene and a preparation method, and discloses a new application of the gynostemma pentaphyllum GpERF gene in regulating plant height, and provides important basis and theoretical support for crop trait improvement and dwarf cultivation, and has important scientific value and application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology. More particularly, the present application relates to a Gynostemma pentaphyllum GpERF gene, a recombinant vector, a preparation method and an application thereof. BACKGROUND

[0002] Gynostemma pentaphyllum GpERF , belonging to the family Cucurbitaceae and Gynostemma, is a perennial herbaceous vine. It is widely distributed in nature, especially in the areas south of the Qinling Mountains and the Yangtze River Basin. As a food material, Gynostemma pentaphyllum is harvested in spring and summer. Its tender stems and leaves can be cooked into various delicious dishes, such as stir-fried dishes, soups, salads, porridges, and wine. In addition, the whole plant of Gynostemma pentaphyllum is also known as "Southern Ginseng" and has many medicinal effects, such as sedation, hypnotic, relieving nervousness, anti-allergy, hair blackening, lowering blood pressure, and treating migraine. Therefore, Gynostemma pentaphyllum is not only a delicious dish, but also a valuable medicinal material. In addition, the leaf of Gynostemma pentaphyllum is emerald green, membranous or papery, unique in shape, and bird-foot-shaped, containing three leaves, five to seven leaves, and nine leaves, etc. It has a very high ornamental value. Gynostemma pentaphyllum, with excellent ecological adaptability and rapid growth rate, shows a unique beauty in the arrangement of flower beds and flower pools. However, due to its growth characteristics, it is not suitable for being a potted plant. Therefore, it is of great significance to explore the dwarfing gene of Gynostemma pentaphyllum for cultivating ornamental potted Gynostemma pentaphyllum plants.

[0003] The AP2 / ERF transcription factor family, as a family unique to the plant kingdom, plays a crucial role in the process of plant hormone-mediated signal transduction, including the signal transduction of hormones such as gibberellin, jasmonic acid, and salicylic acid. At the same time, they actively respond to stress and are involved in the regulation of plant meristem growth and development. Although the biological functions of many AP2 / ERF transcription factors have been clearly defined, there have been no reports on the use of ERF genes to regulate plant dwarfing. This situation provides a broad exploration space and potential invention value for the present application. SUMMARY

[0004] An object of the present application is to solve at least the above problems and to provide at least the advantages to be described later.

[0005] Another object of the present application is to provide a Gynostemma pentaphyllum GpERF gene, which also reveals a new function of the Gynostemma pentaphyllum GpERF gene in regulating plant height, and provides an important basis and theoretical support for crop trait improvement and dwarf cultivation, which has important scientific value and application prospect.

[0006] In order to achieve these objects and other advantages according to the present application, a Gynostemma pentaphyllum GpERF gene is provided, which is a gene obtained from Gynostemma pentaphyllum.GpERF The gene sequence is shown in SEQ ID NO.1.

[0007] This invention provides a recombinant carrier containing the above-mentioned Gynostemma pentaphyllum. GpERF Gene recombination vectors.

[0008] This invention provides a method for preparing a recombinant vector, which includes the following steps:

[0009] 1) The pCY-35D-GFP plasmid was double-digested with SacI and SalI enzymes to obtain the linearized pCY-35D-GFP vector.

[0010] 2) Take the above-mentioned Gynostemma pentaphyllum GpERF The full-length cDNA sequence of the gene was homologously recombinated with the linearized pCY-35D-GFP vector. The reaction product was transformed into competent E. coli DH5α cells. Positive clones were screened on LB medium containing kanamycin. After sequencing verification, the plasmid was extracted to obtain pCY-35D-GFP. GpERF Recombinant vector.

[0011] Preferably, the reaction system in step 1) consists of 2.5 μL of SacI enzyme, 2.5 μL of SalI enzyme, 30 μL of pCY-35D-GFP plasmid, 5 μL of 1.5*T+BSA Universal Buffer, and 10 μL of ddH2O; the enzyme digestion reaction conditions are 37 °C for 12 h.

[0012] Preferably, in step 2), the reaction system for the homologous recombination reaction is: 4 μL of pCY-35D-GFP linearized vector. GpERF 3 μL cDNA fragment, 2 μL 5 × CE II Buffer, 1 μL Exnase II; reaction conditions: 37 ℃ for 30 min.

[0013] This invention provides a method for cloning Gynostemma pentaphyllum. GpERF The primers for the gene are shown in SEQ ID NO.2 for the upstream primer and SEQ ID NO.3 for the downstream primer.

[0014] This invention provides a method using Gynostemma pentaphyllum GpERF The application of genes in regulating plant growth.

[0015] This invention provides a method using Gynostemma pentaphyllum GpERF The application of genes in the cultivation of dwarf plants.

[0016] This invention provides a method using Gynostemma pentaphyllum GpERF The application of genes in regulating gibberellins in plants.

[0017] The application provides a method for cultivating a dwarf plant by using a gynostemma pentaphyllum GpERF gene in inhibiting plant growth.

[0018] The application provides a method for cultivating a dwarf plant by using a gynostemma pentaphyllum GpERF gene, and a transgenic plant is obtained by transforming a gynostemma pentaphyllum GpERF gene. GpERF The gynostemma pentaphyllum gene in the transgenic plant can regulate the synthesis and metabolism gene expression of plant hormones gibberellin, and further affect the growth and development of the plant, so that the plant height is changed.

[0019] The application provides a method for cultivating a dwarf plant, which comprises the following steps: transforming the above-mentioned gene or the recombinant carrier into agrobacterium and then into a plant to obtain a dwarf plant.

[0020] The application at least has the following beneficial effects:

[0021] Firstly, the application discloses that the gynostemma pentaphyllum GpERF gene can affect the plant height of Arabidopsis thaliana (Arabidopsis thaliana is a model organism and has strong representativeness in botany invention, and the invention result for Arabidopsis thaliana can be popularized to the whole angiosperm category), and it is proved that the gene can regulate the synthesis and metabolism pathway of gibberellin (GA), especially reduce the content of GA1, GA3 and GA4 which have biological activity, and increase the content of GA8 and GA 34 which have no biological activity, so that the inhibition effect on the growth and development of the plant is realized, and the plant is dwarfed.

[0022] Secondly, the application result of the application provides strong theoretical support for the AP2 / ERF transcription factor family participating in the regulation of plant height by gibberellin. GpERF By deeply analyzing the influence of the gynostemma pentaphyllum gene on the expression of GA synthesis and metabolism genes, the application enriches the understanding of the role of the transcription factor family in the regulation of plant growth and development.

[0023] Thirdly, the finding of the application provides a possibility for improving the plant height and phenotypic traits of gynostemma pentaphyllum and other crops. Figure 1 By regulating the expression of the gynostemma pentaphyllum gene, a gynostemma pentaphyllum variety with dwarf phenotype can be cultivated, which not only helps to improve the lodging resistance of crops, but also can improve the ornamental and economic value of the crops.

[0024] Fourthly, the application provides a direct basis for cultivating a dwarf variety of gynostemma pentaphyllum.

[0025] Additional advantages, objects, and features of the application will be apparent from the following description, taken in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS

[0026] GpERF Figure 1 is a schematic diagram of pCY-35D-GFP Figure 2 Figure 2 is a schematic diagram of recombinant plasmid;

[0027] Figure 3 Figure 3 is a control diagram of wild type and overexpression Arabidopsis plant phenotypes;

[0028] Figure 4 Figure 4 is a control column chart of wild type and overexpression Arabidopsis plant growth changes;

[0029] Figure 5 Figure 5 is a control column chart of wild type and overexpression Arabidopsis plant endogenous GAs changes;

[0030] GpERF Figure 6 is a control column chart of wild type and overexpression Arabidopsis plant gibberellin synthesis metabolism related gene expression. DETAILED DESCRIPTION

[0031] The present application will be further described below in conjunction with the accompanying drawings so as to enable those skilled in the art to carry out the present application according to the description herein.

[0032] It should be understood that the terms such as "have", "contain" and "include" used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0033] It should be noted that the experimental methods described in the following embodiments are all conventional methods, and the reagents and materials, unless otherwise specified, can be obtained from commercial channels.

[0034] <EMBODIMENT>

[0035] I. Gynostemma pentaphyllum GpERF Gene cloning

[0036] Gynostemma pentaphyllum leaves 0.2 g were rapidly frozen in liquid nitrogen and ground into powder. The Eastep®Super Total RNA Extraction Kit from Promega Biotechnology Co., Ltd. was used to extract total RNA from Gynostemma pentaphyllum plants, and the HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper) from Novoprotein Co., Ltd. was used to reverse transcribe the total RNA into cDNA. The steps were as follows: 4 × gDNA wiper Mix 4 μL, Gynostemma pentaphyllum plant RNA 1000 μg, supplemented with RNase-free ddH2O to a total system of 16 μL, PCR instrument set to 42°C, reaction 2 min, then added 5 × HiScript III qRT SuperMix 4 μL, PCR instrument set to 37°C, 15 min, 85°C, 5 s two-step reverse transcription reaction program. According to the full-length sequence of the cDNA of Gynostemma pentaphyllum GpERF , the upstream and downstream primers (upstream primer SEQ ID NO. 2: ATGGCGATGAGAGAAAAGACTAAAG; downstream primer SEQ ID NO. 3: CTAAGCTGTCTCCAACGGAGGA) were designed and synthesized using Primer6, and the 2 × Phanta Max Master Mix from Novoprotein Co., Ltd. was used to amplify the cDNA of Gynostemma pentaphyllum as a template. The PCR reaction system was as follows: high-fidelity enzyme 25 μL, upstream primer 2 μL, downstream primer 2 μL, cDNA 2 μL, ddH2O 19 μL; the PCR reaction conditions were as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 1 min, 72°C final extension for 5 min, 35 cycles. The PCR product was subjected to 1% agarose gel electrophoresis for detection, and the DNA purification and recovery reagent from Tian Gen Biochemical Technology Co., Ltd. was used to recover the PCR product. The Gynostemma pentaphyllum GpERF gene sequence SEQ ID NO. 1 is shown below:

[0037] ATGGCGATGAGAGAAAAGACTAAAGATCGGGTTGTGACTAACGATAACAACAACAACGGGGTAGAGAGGCATTATAGAGGTGTGCGTAAGAGGCCATGGGGAAGATACGCGGCTGAGATAAGAGATCCAGCTAAAAAAACACGCGTTTGGTTAGGTACATTCGACACGGCCGAAGATGCAGCTCGGGCTTACGACAAAGCCGCAAGAGAATTCCGTGGCGCTAAGGCTAAAACCAACTTTCCTTTTCTTGGTTGCCAAGATCTCAAGATTGATCTTAACCAAAAAAGTAACGACCTGATCAAACATAGTCCCAGCCAAAGTAGTACCGTTGAATCATCAACTCCTCTTGATCTCAATATTTCTCAGTTCGATTCGGTTCGGTTTTTATACTACGATCCGGTTTTACGATCAGGAACGTTGAGTGATTCAGATTCGTCATCGGTTATAGATTTGAATCAAGATGAGTTGAAATCAGGAGGAAGAGTATTGGATATTGATCTCAATTACCCTCCTCCGTTGGAGACAGCTTAG

[0038] two, GpERF Construction of gene recombination vector plasmid

[0039] Construction using dicotyledon super-expression vector pCY-35D-GFP GpERF Gene over-expression vector. The steps are as follows: (1) using Tian Gen Bio-technology Co., Ltd. plasmid extraction kit to extract pCY-35D-GFP plasmid, double enzyme digestion with SacI and SalI, reaction conditions are as follows: SacI and SalI are 2.5 μL each, pCY-35D-GFP plasmid is 30 μL, 1.5*T+BSA Universal Buffer is 5 μL, ddH2O is 10 μL; 37℃ reaction for 12h to linearize the vector; (2) using Novozyme ClonExpress Ⅱ OneStep Cloning Kit, the cDNA full-length sequence fragment of GpERF is subjected to homologous recombination reaction with linearized pCY-35D-GFP vector, the reaction system is as follows: linearized pCY-35D-GFP vector is 4 μL, cDNA full-length sequence fragment is 2 μL, 1.5*T+BSA Universal Buffer is 5 μL, ddH2O is 10 μL, and the reaction is carried out at 37℃ for 12h; (3) using Novozyme ClonExpress Ⅱ OneStep Cloning Kit, the cDNA full-length sequence fragment of GpERFcDNA fragment 3 μL, 5 × CE II Buffer 2 μL, Exnase II 1 μL; reaction conditions: 37℃, 30 min; (3) the reaction product was transformed into DH5α cell competent, and positive clone cells were screened on LB medium containing 50 mg / L kanamycin; (4) after correct verification by sequencing, a plasmid was extracted using a plasmid extraction kit from Tiangeng Biochemical Technology Co., Ltd., and pCY-35D-GFP- Figure 1 Recombinant vector plasmid, the schematic diagram of vector plasmid construction is shown in FIG. 1. GpERF

[0040] Three, GpERF Gene overexpression strain verification

[0041] The correctly sequenced pCY-35D-GFP- GpERF ​The recombinant vector plasmid was transformed into Agrobacterium GV3101 by heat shock method, as follows: 1 μg of recombinant vector plasmid DNA was added to 100 μL of GV3101 competent cells, mixed, and then placed on ice for 30 min and on ice for 10 min; 42°C water bath for 1 min, and then placed on ice for 2 min; 900 μL of YEB liquid medium was added, and then cultured at 220 rpm / min and 28°C for 3 hr, and then coated on YEB solid medium containing 50 mg / L kanamycin, and then cultured at 28°C for 2 d to screen positive Agrobacterium cell clones. The Arabidopsis inflorescences were infected using the inflorescence infection method to obtain T0 generation plants, as follows: the Agrobacterium containing the recombinant vector plasmid was activated and cultured in YEP liquid medium overnight at 28°C and 220 r / min to an OD value of 0.8-1.0 at 600 nm; the bacterial cells were collected by centrifugation at 6000 r / min for 10 min; the bacterial cells were resuspended in 100 ml of infiltration liquid (MS, 30% sucrose, 3 mg / L 6-BA, and 2% Siwet-77) to prepare an Agrobacterium infiltration liquid; the inflorescences of healthy Arabidopsis plants were immersed in the Agrobacterium infiltration liquid for 1 min; the infection was performed once every 10 days for 3 times; the seeds were collected after the seeds matured, sieved, dried, and then the T0 generation plants were obtained. The T0, T1, and T2 generation plant seeds were used for 50 mg / L kanamycin resistance culture to screen homozygous T3 generation plants, and finally the T3 generation homozygous plants were obtained. The T3 generation plant leaf DNA was extracted using the CTAB method, and then PCR amplification verification was performed. The total RNA of the T3 generation plant leaves was extracted using the RNA extraction kit of Takara Company, and then reverse transcribed into cDNA, and then qRT-PCR verification was performed using fluorescent quantitative primers (upstream primer SEQ ID NO. 4: GAATCATCAACTCCTCTT; downstream primer SEQ ID NO. 5: CAATATCCAATACTCTTCCT), and then three strains with positive identification results and high gene expression were selected and named as OE-1, OE-2, and OE-3.

[0042] Four, GpERF Overexpression strain analysis

[0043] 1. Phenotype observation

[0044] To verify the ginseng GpERF gene function, the phenotypes of wild type and transgenic Arabidopsis plants were observed. The seedlings were transplanted into peat soil after sowing on 1 / 2MS solid medium and the true leaves grew, and the culture conditions were 21°C, 70% humidity, and long day conditions for 3 months, and then the plant height, branch number, rosette leaf number, leaf length, and leaf width were observed and counted, and each treatment had 3 repeats, and 10 plants were used as one repeat.

[0045] 2. Hormone content determination

[0046] To verify Gynostemma pentaphyllum GpERF Gene function, including the bioactive endogenous GA1, GA3, and GA4 in wild-type and transgenic Arabidopsis plants, and the non-bioactive GA8 and GA4. 34 Hormone content was determined. 50 mg of wild-type and transgenic Arabidopsis leaf samples were weighed and placed in 2.0 ml centrifuge tubes containing grinding beads. The samples were then rapidly frozen in liquid nitrogen and ground into powder using a tissue homogenizer (Shanghai Jingxin, JXFSTPRP-64L). Hormone extraction was performed using 2 ml of methanol:water:formic acid at a volume ratio of 15:4:1, at 4°C with shaking for 12 h. The extraction was repeated three times, and the extracts were combined. The extract was concentrated using a vacuum concentrator, then redissolved in 30 μL of methanol, filtered through a 0.22 μm PTFE membrane, and placed in a sample vial for LC-MS / MS analysis. The liquid chromatography conditions were as follows: Waters ACQUITY UPLC HSS T3 C18 column; mobile phase: ultrapure water containing 0.05% formic acid; organic phase: acetonitrile containing 0.05% formic acid; elution gradient: 0 min water / acetonitrile (95:5 V / V), 1 min water / acetonitrile (95:5 V / V), 8.0 min water / acetonitrile (5:95 V / V), 9.0 min water / acetonitrile (5:95 V / V), 9.1 min water / acetonitrile (95:5 V / V), 12.0 min water / acetonitrile (95:5 V / V); flow rate: 0.35 mL / min; column temperature: 40 ℃; injection volume: 2 μL. The mass spectrometry conditions mainly included: electrospray ionization source temperature: 500 ℃; mass spectrometry voltage: 4500 V; curtain gas pressure: 35 psi; collision-induced ionization parameters: set to medium for scanning detection.

[0047] 3. Detection of gene expression levels in the GA synthesis pathway

[0048] To verify Gynostemma pentaphyllum AtKS Gene function was assessed by determining the expression levels of genes involved in the GA synthesis pathway in wild-type and transgenic Arabidopsis thaliana plants. 0.2 g of Arabidopsis thaliana leaves were flash-frozen in liquid nitrogen and ground into powder. Total RNA was extracted from Gynostemma pentaphyllum using the Eastep® Super Total RNA Extraction Kit (Promegabio), and reverse transcribed into cDNA using the Novozymes HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper). Specific primers were used to target the expression levels of genes involved in the GA synthesis pathway. AtKO (Ent-kaurene synthase), AtKAO (Ent-kaureneoxidase) AtGA20ox(Ent-kaurenoic acid oxidase), AtGA2ox (GA20-oxidase) AtGA3ox (GA3-oxidase) and Figure 2 The expression level of GA2-oxidase was detected using specific primers shown in Table 1. The housekeeping gene Actin was used as an internal reference gene (upstream primer SEQ ID NO.6: gcaccctgttcttcttaccga; downstream primer SEQ ID NO.7: agtaaggtcacgtccagcaagg), and the relative expression level of the gene was calculated using the 2-ΔΔCT method.

[0049] Table 1 Specific primers

[0050]

[0051] <Effect Verification>

[0052] Experimental results showed that, compared with wild-type Arabidopsis, the overexpressed Arabidopsis exhibited dwarfing (…). Figure 3 As shown, the left plant represents the growth of wild-type Arabidopsis thaliana WT, and the three plants on the right represent the growth of overexpressing Arabidopsis thaliana OE-1, OE-2, and OE-3. The plant height was significantly reduced, decreasing by 44.44%–69.44%, and the number of rosette leaves, leaf length, and leaf width were significantly less than those of wild-type Arabidopsis thaliana. Figure 4 This is characterized by fewer leaves and shorter leaf size. This invention targets the bioactive endogenous GA1, GA3, and GA4, as well as the non-bioactive GA8 and GA4, found in wild-type and overexpressed Arabidopsis plants. 34 Hormone content was determined. For example... Figure 5 As shown, the contents of GA1, GA3, and GA4 in overexpressed Arabidopsis thaliana were all lower than those in wild type, while the contents of GA8 and GA4 were lower. 34 The contents were all higher than those of the wild type, indicating that the dwarfing phenotype observed in overexpressing plants is closely related to the endogenous GAs content. GpERF As shown, overexpression AtKS Able to reduce GA synthesis genes AtKO , AtKAO , AtGA20ox , AtGA3ox and AtGA2ox Increase GA inactivation gene GpERF Expression levels. Phenotypic observation of transgenic Arabidopsis thaliana, analysis of endogenous GAs content, and expression of GA metabolism genes showed that Gynostemma pentaphyllum... GpERF It participates in regulating the expression of genes involved in GA synthesis and metabolism, affecting the content of endogenous GAs, and inhibiting plant growth and development. In summary, ​The gene is a gene affecting plant height, mainly by regulating GA synthesis and metabolism gene expression, affecting the content of endogenous GAs, resulting in plant dwarfing, providing theoretical support for the application of AP2 / ERF transcription factor participating in GA regulation of plant height, and providing basis for improving gynostemma pentaphyllum plant height and phenotype traits and cultivating gynostemma pentaphyllum dwarf varieties.

[0053] While embodiments of the application have been disclosed in connection with the above description and the accompanying drawings, it will be apparent to those skilled in the art that many modifications, additions and deletions can be made without departing from the general scope of the application as set forth in the accompanying claims, and equivalent steps can be substituted for those illustrated and described herein. Thus, the scope of the application should be determined not with reference to the description or the appended drawings, but with reference to the appended claims, along with the full scope of equivalents to which they are entitled.

Claims

1. Gynostemma pentaphyllum GpERF Genes, characterized by, Its gene sequence is shown in SEQ ID NO.

1.

2. A recombinant vector, characterized in that, Gynostemma pentaphyllum as described in claim 1 GpERF Gene recombination vectors.

3. A method for preparing the recombinant vector according to claim 2, characterized in that, Includes the following steps: 1) The pCY-35D-GFP plasmid was double-digested with SacI and SalI enzymes to obtain the linearized pCY-35D-GFP vector; 2) The Gynostemma pentaphyllum as described in claim 1 GpERF The full-length cDNA sequence of the gene was homologously recombinated with the linearized pCY-35D-GFP vector. The reaction product was transformed into competent E. coli DH5α cells. Positive clones were screened on LB medium containing kanamycin. After sequencing verification, the plasmid was extracted to obtain pCY-35D-GFP. GpERF Recombinant vector.

4. The method for preparing the recombinant vector according to claim 3, characterized in that, The reaction system for step 1) consisted of 2.5 μL SacI enzyme, 2.5 μL SalI enzyme, 30 μL pCY-35D-GFP plasmid, 5 μL 1.5*T+BSA Universal Buffer, and 10 μL ddH2O; the enzyme digestion reaction was carried out at 37 ℃ for 12 h. In step 2), the homologous recombination reaction system consisted of 4 μL of the linearized pCY-35D-GFP vector. GpERF 3 μL cDNA fragment, 2 μL 5 × CE II Buffer, 1 μL Exnase II; reaction conditions: 37 ℃ for 30 min.

5. A device for cloning Gynostemma pentaphyllum as described in claim 1 GpERF The primers for the gene are characterized by, The upstream primer is shown in SEQ ID NO.2, and the downstream primer is shown in SEQ ID NO.

3.

6. A Gynostemma pentaphyllum as described in claim 1 GpERF Application of genes in regulating gibberellin in Arabidopsis plants.

7. A Gynostemma pentaphyllum as described in claim 1 GpERF Application of genes in inhibiting Arabidopsis plant growth.

8. A method using the Gynostemma pentaphyllum as described in claim 1 GpERF The application of genes is characterized by, Used to cultivate dwarf Arabidopsis thaliana plants.

9. A method using the Gynostemma pentaphyllum as described in claim 1 GpERF The application of genes is characterized by, The Gynostemma pentaphyllum GpERF Genetic transformation yielded transgenic Arabidopsis plants, wherein the transgenic Arabidopsis plants contained Gynostemma pentaphyllum. GpERF Genes can regulate the synthesis and metabolism of the Arabidopsis plant hormone gibberellin, thereby affecting the growth and development of Arabidopsis plants and causing changes in plant height.

10. A method for cultivating dwarf plants, characterized in that, The procedure includes the following steps: transforming Agrobacterium tumefaciens into Arabidopsis thaliana plants by transforming the gene of claim 1 or the recombinant vector of claim 2 into Arabidopsis thaliana plants to obtain dwarf Arabidopsis thaliana plants.

Images