BnA03.CHYR.1 gene and application of protein coded by BnA03.CHYR.1 gene in improvement of salt tolerance of plants

Abstract

The invention discloses an application of a BnA03. CHYR.1 gene and a protein coded by the BnA03. CHYR.1 gene in improving salt tolerance of plants. A nucleotide sequence of the BnA03. CHYR.1 gene is shown as SEQ ID NO: 1, and a CDS sequence of the BnA03. CHYR.1 gene is shown as SEQ ID NO: 2. The BnA03. CHYR.1 gene is screened and identified, phenotype identification based on an arabidopsis thaliana plant over-expressed by the BnA03. CHYR.1 gene shows that the BnA03. CHYR.1 gene can improve the salt stress resistance of the plant under the salt treatment condition, it is indicated that the BnA03. CHYR.1 gene can positively regulate the salt tolerance of the plant, a new choice is provided for screening dominant stress resistance genes, and the BnA03. CHYR.1 gene has important application value in the field of plant genetic engineering.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the application of BnA03.CHYR.1 gene and the protein encoded by it in improving the salt tolerance of plants. Background Art

[0002] Salt-alkali is one of the main abiotic stresses that affects crops and limits the growth, development and yield of crops worldwide. The saline-alkali environment poses a significant threat to plant growth. About 20% of agricultural land in the world is affected by salt damage, and the area of ​​soil salinization is increasing year by year. The main effects of salinization on plants: disrupting normal plant growth, inducing osmotic stress, ion imbalance / toxicity and oxidative stress. Salt stress is mainly caused by high salt in the soil that hinders the effective absorption of water and nutrients by plants, and causes damage to mesophyll cells by transpiration, which in turn inhibits normal plant growth. Studies have shown that CHYR is an E3 ubiquitin ligase, which mainly regulates plant salt tolerance by affecting the stability of salt stress-related proteins in plants.

[0003] Rapeseed is one of the most important oil crops in the world, and its planting areas are widely distributed. Rapeseed has a wide range of application values, and it has the functions of oil, vegetables, flowers, honey, fertilizer, feed, and medicine. With the increasing demand for renewable energy, rapeseed oil can also be used as a raw material for biodiesel, that is, the increase in rapeseed area can reduce dependence on fossil fuels and greenhouse gas emissions. In order to give full play to the multi-purpose potential of rapeseed and increase its yield, it is necessary to expand the rapeseed planting area and plant it in saline-alkali or soil-poor areas, which requires the breeding of salt-alkali tolerant rapeseed varieties. Rapeseed production practice shows that rapeseed has important salt tolerance characteristics, which can improve saline-alkali soil and increase the security of edible oil supply. For a long time, there have been relatively few studies on the cloning and function of genes related to salt-alkali tolerance in rapeseed in my country.

[0004] The present invention uses bioinformatics methods to analyze 24 members of the CHYR gene family in Brassica napus "westar", which can be divided into three subfamilies, and screens out that the expression of the BnA03.CHYR.1 (BnaA03G0094800) gene is induced by salt stress. At present, there are no relevant reports on the number of members of the BnA03.CHYR.1 family in Brassica napus, genes and their CDS sequences, salt tolerance, and their applications in genetic engineering. Summary of the invention

[0005] The object of the present invention is to provide an application of the BnA03.CHYR.1 gene and the protein encoded by the gene in improving the salt tolerance of plants. The present invention obtains transgenic materials with Arabidopsis thaliana as a receptor through Agrobacterium-mediated genetic transformation. Studies have found that overexpression of the BnA03.CHYR.1 gene of Brassica napus can improve the salt tolerance of Arabidopsis thaliana during the germination period. Therefore, the BnA03.CHYR.1 gene can be applied to the breeding of Brassica napus to improve the salt tolerance of Brassica napus, providing a new feasible approach for cultivating new salt-tolerant Brassica napus varieties.

[0006] In order to achieve the above purpose, this application adopts the following technical solutions:

[0007] In a first aspect, the present invention provides any of the following applications of the BnA03.CHYR.1 gene:

[0008] (1) Used to improve plant salt tolerance;

[0009] (2) Used for cultivating salt stress-tolerant transgenic plants;

[0010] (3) Used for breeding plant varieties with improved salt tolerance;

[0011] (4) Used for saline-alkali land improvement;

[0012] The nucleotide sequence of the BnA03.CHYR.1 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:2.

[0013] In a second aspect, the present invention provides any of the following applications of the protein encoded by the BnA03.CHYR.1 gene:

[0014] (1) Used to improve plant salt tolerance;

[0015] (2) Used for cultivating salt stress-tolerant transgenic plants;

[0016] (3) Used for breeding plant varieties with improved salt tolerance;

[0017] (4) Used for saline-alkali land improvement;

[0018] The amino acid sequence of the protein encoded by the BnA03.CHYR.1 gene is shown in SEQ ID NO:3.

[0019] In the above technical solution, the plants include cruciferous plants.

[0020] In the above technical solution, the plants include Brassica napus and Arabidopsis thaliana.

[0021] In a third aspect, the present invention provides any of the following applications of a biomaterial:

[0022] (1) Used to improve plant salt tolerance;

[0023] (2) Used for cultivating salt stress-tolerant transgenic plants;

[0024] (3) Used for breeding plant varieties with improved salt tolerance;

[0025] (4) Used for saline-alkali land improvement;

[0026] The biological material is any one of the following A1)-A8):

[0027] A1) a nucleic acid molecule whose nucleotide sequence is shown in SEQ ID NO: 1;

[0028] A2) an expression cassette containing the nucleic acid molecule described in A1);

[0029] A3) a recombinant vector containing the nucleic acid molecule described in A1) or a recombinant vector containing the expression cassette described in A2);

[0030] A4) a recombinant microorganism containing the nucleic acid molecule described in A1) or a recombinant microorganism containing the expression cassette described in A2) or a recombinant microorganism containing the recombinant vector described in A3);

[0031] A5) a transgenic plant cell line containing the nucleic acid molecule described in A1), or a transgenic plant cell line containing the expression cassette described in A2), or a transgenic plant cell line containing the recombinant vector described in A3);

[0032] A6) transgenic plant tissue containing the nucleic acid molecule described in A1), or transgenic plant tissue containing the expression cassette described in A2), or transgenic plant tissue containing the recombinant vector described in A3);

[0033] A7) a transgenic plant organ containing the nucleic acid molecule described in A1), or a transgenic plant organ containing the expression cassette described in A2), or a transgenic plant organ containing the recombinant vector described in A3);

[0034] A8) A transgenic plant containing the nucleic acid molecule described in A1), or a transgenic plant containing the expression cassette described in A2), or a transgenic plant containing the recombinant vector described in A3).

[0035] In a fourth aspect, the present invention provides a method for improving plant salt tolerance, the method being selected from the following: ①

[0036] Or ②: ① causing the plant to express the protein encoded by the BnA03.CHYR.1 gene;

[0037] ② Overexpression of the BnA03.CHYR.1 gene in plants;

[0038] The nucleotide sequence of the BnA03.CHYR.1 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:2.

[0039] In the above technical solution, the overexpression method is selected from the following 1)-5), or an optional combination:

[0040] 1) by introducing a plasmid having the BnA03.CHYR.1 gene;

[0041] 2) by increasing the copy number of the BnA03.CHYR.1 gene on the plant chromosome;

[0042] 3) by changing the promoter sequence of the BnA03.CHYR.1 gene on the plant chromosome;

[0043] 4) by operably linking a strong promoter to the BnA03.CHYR.1 gene;

[0044] 5) By introducing enhancers.

[0045] In the above technical solution, the plants include cruciferous plants.

[0046] In the above technical solution, the plants include Brassica napus and Arabidopsis thaliana.

[0047] The beneficial effect of the present invention is that the present invention screened and identified the BnA03.CHYR.1 gene, and phenotypic identification based on its overexpression plants showed that it can improve salt stress resistance under salt treatment, indicating that the BnA03.CHYR.1 gene can positively regulate the salt tolerance of plants, providing a new option for screening superior stress resistance genes, and has important application value in the field of forest genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 :Schematic diagram of the construction of pCAMBIA2300-BnA03.CHYR.1 overexpression vector.

[0049] Figure 2 : Expression levels of BnA03.CHYR.1 in westar seedlings treated with 0.15 μM NaCl for 3 h, 6 h, 12 h and 24 h.

[0050] Figure 3 :The phenotypes of BnA03.CHYR.1-overexpressing Arabidopsis positive plants and col-0 germinated for 15 days under 0μM and 50μM NaCl conditions.

[0051] Figure 4: Root length phenotype statistics of BnA03.CHYR.1 overexpressing Arabidopsis positive plants and col-0 germinated for 15 days under 0μM and 50μM NaCl conditions. DETAILED DESCRIPTION

[0052] In order to better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. The present invention can be implemented in many different forms and should not be construed as being limited to the embodiments set forth herein. On the contrary, these embodiments are provided so that this disclosure will be thorough and complete, and the concept of the present invention will be fully conveyed to those skilled in the art, and the present invention will only be limited by the claims.

[0053] Example 1 Cloning and overexpression vector construction of BnA03.CHYR.1 gene and expression analysis under salt stress

[0054] 1. Extraction of RNA and acquisition of cDNA

[0055] Westar (a variety of Brassica napus) seedlings hydroponically cultured for 21 days under 0.15M NaCl treatment conditions were extracted with liquid nitrogen. The whole seedlings were sampled at 0h, 3h, 6h, 12h and 24h after treatment. Every 5 plants were used as a biological replicate. RNA was extracted using a kit (Tiangen). CDNA was synthesized using 1μg RNA as a template (Thermo Fisher). Each cDNA was diluted 50 times and stored at -20℃ for future use.

[0056] 2. Using cDNA as template and pCAMBIA2300 vector plasmid as backbone, PCR amplification was performed using the following primers to construct the overexpression vector pCAMBIA2300-BnA03.CHYR.1( Figure 1 ).

[0057] pCAMBIA2300-BnA03.CHYR.1-F:

[0058] cacggaattctctagaATGGAAGCTTCACCCAATG

[0059] pCAMBIA2300-BAn03.CHYR.1-R:

[0060] GGGCGAATTGGTCGACTTGAGGAAGAACAGGAGGTG

[0061] The PCR reaction conditions were: 98°C pre-denaturation for 5 min; 98°C for 30 sec, 56°C for 30 sec, 72°C for 1 min, 35 cycles; 72°C extension for 10 min. The PCR product was recovered using a purification recovery kit (Tian Gen) and connected to the pCAMBIA2300 vector at 37°C for 30 min using the homologous recombination method (homologous recombination enzyme purchased from Novozyme). Among them, the restriction sites of pCAMBIA2300 are F: BamHI, R: SalI, and the restriction enzymes were digested at 37°C in a water bath using Thermo Fisher restriction enzymes, and purified and recovered using a purification recovery kit (Tian Gen).

[0062] 3. The recombinant plasmid was transformed into DH5α (Qingke Biotechnology) by heat shock transformation. After 12-16 hours, a single clone was picked for PCR positive detection and sent to Sangon Biotechnology for sequencing. The sequencing primers are as follows:

[0063] pCAMBIA2300-BnA03.CHYR.1-F:

[0064] cacggaattctctagaATGGAAGCTTCACCCAATG

[0065] M13-48: AGCGGATAACAATTTCACACAGGA

[0066] By comparing the sequencing results with the westar reference genome, it was determined that its coding sequence is shown in SEQ ID NO:2, and the protein sequence encoded by the gene is shown in SEQ ID NO:3.

[0067] The correct recombinant plasmid was transformed into Agrobacterium strain GV3101 by conventional electroporation transformation method.

[0068] 4. Analysis of the expression pattern of BnA03.CHYR.1 gene under salt stress

[0069] Using the diluted cDNA obtained in step 1 as a template, design primers:

[0070] Qpcr-CHYR-F:GGTGTCAGCACTACAGGAGGAGATG

[0071] Qpcr-CHYR-R:ACCACAGTTGGAGCATACTTGAGCAA

[0072] and BnaActin7 primers

[0073] BnaActin7-F:CTATCCTCCGTCTCGATCTCGC

[0074] BnaActin7-R:CTTAGCCGTCTCCAGCTCTTGC

[0075] It was used as an internal reference primer for relative quantitative analysis.

[0076] The results are as follows Figure 2 As shown, the expression level of BnA03.CHYR.1 gene increased significantly under salt stress, indicating that this gene can respond to salt stress.

[0077] Example 2 Genetic transformation of BnA03.CHYR.1 gene and screening and identification of positive plants

[0078] The material shown is wild-type Arabidopsis col-0.

[0079] The specific steps are as follows:

[0080] (1) Arabidopsis thaliana was sown in a nutrient pot with vermiculite as the culture soil, and 10 seeds were evenly sown in each pot. After growing in a light culture room for 7 days, the seedlings were thinned out, and 4 seedlings were retained in each pot.

[0081] (2) When the plant grows to about 3 cm in height after bolting, remove the main stem to obtain more lateral stems. Transformation is performed when most inflorescences have grown and are in the bud state.

[0082] (3) Before transformation, remove the flowers that have opened at the bottom of the inflorescence and the siliques that have been pollinated and grown.

[0083] (4) Prepare 2 mL of Agrobacterium bacterial solution and inoculate it into 200 mL of liquid culture medium containing antibiotics one day before transformation. Incubate the culture overnight at 28°C and 250 rpm on a shaker. On the second day, when the bacterial solution OD600 is between 1.2 and 1.4, centrifuge at 4°C and 4000 g for 10 min, discard the supernatant, and obtain the bacterial cells.

[0084] (5) The precipitated bacteria were suspended in 100 mL of infiltration medium containing 5% sucrose (containing Silwet 100 μl / L).

[0085] (6) Pour the Agrobacterium suspension into a petri dish and soak the Arabidopsis inflorescence in the Agrobacterium suspension for 2 min. Take out the plant, place it horizontally on a plastic tray covered with absorbent paper, cover it with plastic wrap to maintain humidity, and place it in the dark for 24 h. Then place it in a greenhouse to allow it to grow normally.

[0086] (7) One week later, infect again. This time, it is not necessary to remove the flowers and siliques. When the seeds are mature, harvest them, air-dry them, and store them at 4°C for positive seedling screening.

[0087] (8) Arabidopsis seeds were sterilized by soaking in 75% ethanol for 1 min, the alcohol was discarded, and then the seeds were sterilized by soaking in 3% 84 disinfectant for 5 min, and then washed 5-6 times with sterile water, soaking for 2 min each time. The sterilized seeds were evenly sown on 1 / 2MS screening medium containing kanamycin and cultured in the culture room for 15 days.

[0088] (9) The seedlings with normal true leaves and root growth were transplanted into nutrient soil, and about 0.5 g of leaves were taken into a 2.0 mL centrifuge tube to extract DNA for positive identification.

[0089] (10) Extract RNA from positive plants and perform qRT-PCR to detect the relative expression of genes.

[0090] The results showed that the BnA03.CHYR.1 gene was successfully overexpressed in the positive plants.

[0091] The culture medium formula used in this example

[0092] Screening medium: MS 2.2 g / L, sucrose 10 g / L. After sterilization, add carbenicillin and kanamycin and dispense for later use.

[0093] Example 3 Study on the salt tolerance function of BnA03.CHYR.1

[0094] pCAMBIA2300-BnA03.CHYR.1 was transferred into wild-type Arabidopsis col-0 by Agrobacterium-mediated genetic transformation. The recipient col-0 was used as the control material, and the positive strains OE-CHYR-1 and OE-CHYR-3 were used as the experimental groups. 0 μM NaCl was used as the control and 50 μM NaCl was used as the experimental group for 15 days of germination stress treatment (16 hours of light, 8 hours of darkness, and temperature of 22°C).

[0095] Example 4 Phenotypic Observation

[0096] Phenotypic observations and statistics were performed on Example 3. The salt tolerance phenotype was observed in the transgenic T3 generation and compared with col-0 to verify the function of the introduced candidate gene. The phenotype was as follows Figure 3 The results showed that in the transgenic positive T3 plants, both overexpression lines significantly enhanced the salt tolerance of Arabidopsis thaliana during the germination period. Figure 3 The phenotypes of the transgenic lines and wild-type controls at 15 days of germination. Figure 4 It is the statistical result of root length under 0μMNaCl and 50μMNaCl conditions. Finally, it can be determined that BnA03.CHYR.1 can significantly enhance the salt tolerance of Arabidopsis thaliana during the germination period and is a positive regulatory gene of salt tolerance.

[0097] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. Any of the following applications of the BnA03.CHYR.1 gene: (1) Used to improve plant salt tolerance; (2) Used for cultivating salt stress-tolerant transgenic plants; (3) Used for breeding plant varieties with improved salt tolerance; (4) Used for saline-alkali land improvement; The nucleotide sequence of the BnA03.CHYR.1 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:

2.

2. Any of the following applications of the protein encoded by the BnA03.CHYR.1 gene: (1) Used to improve plant salt tolerance; (2) Used for cultivating salt stress-tolerant transgenic plants; (3) Used for breeding plant varieties with improved salt tolerance; (4) Used for saline-alkali land improvement; The amino acid sequence of the protein encoded by the BnA03.CHYR.1 gene is shown in SEQ ID NO:

3.

3. The use according to any one of claims 1-2, characterized in that: The plants include plants of the family Cruciferae.

4. The use according to any one of claims 1-2, characterized in that: The plants include Brassica napus and Arabidopsis thaliana.

5. Any of the following applications of a biomaterial: (1) Used to improve plant salt tolerance; (2) Used for cultivating salt stress-tolerant transgenic plants; (3) Used for breeding plant varieties with improved salt tolerance; (4) Used for saline-alkali land improvement; The biological material is any one of the following A1)-A8): A1) a nucleic acid molecule whose nucleotide sequence is shown in SEQ ID NO: 1; A2) an expression cassette containing the nucleic acid molecule described in A1); A3) a recombinant vector containing the nucleic acid molecule described in A1) or a recombinant vector containing the expression cassette described in A2); A4) a recombinant microorganism containing the nucleic acid molecule described in A1) or a recombinant microorganism containing the expression cassette described in A2) or a recombinant microorganism containing the recombinant vector described in A3); A5) a transgenic plant cell line containing the nucleic acid molecule described in A1), or a transgenic plant cell line containing the expression cassette described in A2), or a transgenic plant cell line containing the recombinant vector described in A3); A6) transgenic plant tissue containing the nucleic acid molecule described in A1), or transgenic plant tissue containing the expression cassette described in A2), or transgenic plant tissue containing the recombinant vector described in A3); A7) a transgenic plant organ containing the nucleic acid molecule described in A1), or a transgenic plant organ containing the expression cassette described in A2), or a transgenic plant organ containing the recombinant vector described in A3); A8) A transgenic plant containing the nucleic acid molecule described in A1), or a transgenic plant containing the expression cassette described in A2), or a transgenic plant containing the recombinant vector described in A3).

6. A method for improving plant salt tolerance, characterized in that: The method is selected from the following ① or ②: ① Make the plant express the protein encoded by the BnA03.CHYR.1 gene; ② Overexpression of the BnA03.CHYR.1 gene in plants; The nucleotide sequence of the BnA03.CHYR.1 gene is shown in SEQ ID NO:1, and the CDS sequence is shown in SEQ ID NO:

2.

7. The method according to claim 6, characterized in that: The overexpression method is selected from the following 1)-5), or an optional combination: 1) by introducing a plasmid having the BnA03.CHYR.1 gene; 2) by increasing the copy number of the BnA03.CHYR.1 gene on the plant chromosome; 3) by changing the promoter sequence of the BnA03.CHYR.1 gene on the plant chromosome; 4) by operably linking a strong promoter to the BnA03.CHYR.1 gene; 5) By introducing enhancers.

8. The method according to claim 6, characterized in that: The plants include plants of the family Cruciferae.

9. The method according to claim 6, characterized in that: The plants include Brassica napus and Arabidopsis thaliana.

Images